Báo cáo khoa học: Leishmania infantum LeIF protein is an ATP-dependent RNA helicase and an eIF4A-like factor that inhibits translation in yeast docx

Leishmania infantum LeIF protein is an ATP-dependent
RNA helicase and an eIF4A-like factor that inhibits
translation in yeast
Mourad Barhoumi
1
, N. K. Tanner
2
, Josette Banroques
2,3
, Patrick Linder
2
and Ikram Guizani
1
1 Laboratoire d’Epide
´
miologie et d’Ecologie Parasitaire, Institut Pasteur de Tunis, Tunisia
2De
´
partement de Microbiologie et Me
´
dicine Mole
´
culaire, Centre Me
´
dical Universitaire, Gene
`
ve, Switzerland
3 Centre de Ge
´
ne
´

tique Mole
´
culaire, CNRS, Gif-sur-Yvette, France
The leishmaniases constitute a group of diverse, world-
wide-distributed, parasitic diseases caused by proto-
zoan parasites of the genus Leishmania that are
transmitted by female sandflies. Leishmania are Tryp-
anosomatidae protozoans having two main stages in
their life cycle: intracellular amastigotes in the macro-
phage of mammalian host and motile promastigotes
in the sandfly midgut [1]. At least 20 species of Leish-
mania are pathogenic to humans. Leishmaniases range
from mild, often self-healing, cutaneous lesions to
mucocutaneous, severely mutilating lesions, to fatal vis-
ceral leishmaniasis. The clinical outcome of leishmanial
infections depends on a complex interplay involving
the host, vector, parasite and environmental determi-
nants. The annual incidence is two million cases in 88
countries. The mainstay therapy is based on the use of
pentavalent antimonials; no efficient vaccine is yet
available [2].
A number of Leishmania antigens have been cloned
and characterized with respect to the immune
responses elicited during experimental murine or nat-
ural human infections [3–13]. Among these antigens,
LeIF was described originally as an antigen that indu-
ces an IL12-mediated Th1 response in the peripheral
Keywords
ATPase; DEAD box; eIF4AIII; Leishmaniasis;
unwindase

Correspondance
I. Guizani, Laboratoire d’Epide
´
miologie et
d’Ecologie Parasitaire, Institut Pasteur de
Tunis, 13 Place Pasteur, BP74, 1002 Tunis,
Tunisia
Fax: +216 71 791 833
Tel: +216 71 844 171
E-mail:
(Received 7 July 2006, revised 15 September
2006, accepted 18 September 2006)
doi:10.1111/j.1742-4658.2006.05506.x
LeIF, a Leishmania protein similar to the eukaryotic initiation factor
eIF4A, which is a prototype of the DEAD box protein family, was origin-
ally described as a Th1-type natural adjuvant and as an antigen that indu-
ces an IL12-mediated Th1 response in the peripheral blood mononuclear
cells of leishmaniasis patients. This study aims to characterize this protein
by comparative biochemical and genetic analysis with eIF4A in order to
assess its potential as a target for drug development. We show that a His-
tagged, recombinant, LeIF protein of Leishmania infantum, which was puri-
fied from Escherichia coli, is both an RNA-dependent ATPase and an
ATP-dependent RNA helicase in vitro, as described previously for other
members of the DEAD box helicase protein family. In vivo experiments
show that the LeIF gene cannot complement the deletion of the essential
TIF1 and TIF2 genes in the yeast Saccharomyces cerevisiae that encode
eIF4A. In contrast, expression of LeIF inhibits yeast growth when endog-
enous eIF4A is expressed off only one of its two encoding genes. Further-
more, in vitro binding assays show that LeIF interacts with yeast eIF4G.
These results show an unproductive interaction of LeIF with translation

initiation factors in yeast. Furthermore, the 25 amino terminal residues
were shown to enhance the ability of LeIF to interfere with the translation
machinery in yeast.
Abbreviations
eIF, eukaryotic initiation factor; EJC, exon junction complex; 5-FOA, 5-fluoro-orotic acid; GST, glutathione S-transferase; PABP, polyA-binding
protein; PBMC, peripheral blood mononuclear cells; SD, synthetic dextrose; SF2, superfamily 2.
5086 FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS
blood mononuclear cells (PBMC) of leishmaniasis
patients, which also acts as a Th1-type natural adju-
vant [8,10,11,14]. Its importance in host–parasite inter-
actions is not clear yet; several studies have highlighted
its immunomodulatory properties on cells of healthy
donors [8]. Along with two other antigens, stress indu-
cible protein 1 (ST11) and thiol-specific antioxidant
(TSA), LeIF is part of a trifusion recombinant protein
vaccine, leish-111f, which proved efficient in signifi-
cantly reducing the parasite load and size of the lesion
in mice and in primate models [15]. These recombinant
proteins, when administered as a cocktail, were effi-
cient for immunotherapy [16]. Immunomodulatory
activity leading to production of IL12 is thought to
occur via a yet unknown receptor [14], as supported
by the existence of a polarity in the molecule with
respect to the levels of cytokine induced; the 226
amino terminal residues are sufficient for this activity
[8,11,14]. LeIF protein contains 403 residues and it
shows high sequence similarity to the mammalian
translation initiation factor eIF4A and to other homo-
logues in lower and higher eukaryotes. It is expressed
both in the promastigote and amastigote parasite

forms of all the different Leishmania species tested [8].
Its role in the biology of the parasite is unknown.
In silico predictions and expression levels seem to indi-
cate an involvement in the translation process [17],
although recent alignments of the LeIF protein from
Leishmania braziliensis and Leishmania major with
eIF4A from other organisms show some divergence
[18]. The purpose of this work is to characterize the
LeIF protein by a comparative biochemical and gen-
etic analysis with its apparent homologue in yeast,
eIF4A, in order to assess its potential as a target for
drug development.
The eIF4A-like proteins are the archetype of the
DEAD box family of proteins [19]. The DEAD box
helicases belong to superfamily 2 (SF2) in the classifi-
cation of Gorbalenya and Koonin [20]. All members
of the DEAD box family share nine conserved amino
acid motifs [21–24], including the sequence Asp-Glu-
Ala-Asp (D-E-A-D) that inspired their name. Members
of the DEAD box family are found in a wide range of
organisms, including bacteria and eukaryotes ranging
from yeast to humans, and they are implicated in vir-
tually every cellular process involving RNA. These
include transcription, ribosomal biogenesis, pre-mRNA
splicing, RNA export, translation, and RNA degrada-
tion [25–27]. In vitro analyses of purified proteins show
an RNA-dependent ATPase activity and in some cases
ATP-dependent unwinding activity [28–31]. The solved
crystal structures of various DEAD box proteins,
including yeast eIF4A, show a core structure that

consists of two RecA-like domains connected by a
flexible linker [21,32–34]. The tertiary structure of this
core can be largely superimposed on the solved crystal
structures of other SF1 and SF2 helicases, which
suggests a common mechanistic theme among these
helicases [21,34]. The eIF4A-like helicases are close to
the minimal size constituting the core structure alone
[21,24,34].
Translation initiation in eukaryotes involves a series
of steps that result in the recruitment of a transla-
tion-competent 80S ribosome to the initiation codon
of an mRNA. The process is catalyzed by a large
number of eukaryotic initiation factors (eIFs). Among
these factors, eIF4A is part of the translation initi-
ation complex eIF4F that binds to the cap structure
of mRNAs, in conjunction with eIF4E and eIF4G, to
promote the binding of the 40S ribosomal subunit to
the mRNA and the subsequent scanning for the initi-
ation AUG codon [35,36]. eIF4A has been proposed
to facilitate the ‘melting’ of secondary structures in
the 5¢ untranslated region of the mRNA during the
scanning process [35–38]. Translation initiation in
trypanosomatidae protozoans is not well character-
ized; translation factors were identified according to
their sequence similarities to known factors in other
organisms. Among these factors, polyA-binding pro-
tein (PABP) from Trypanosoma cruzi, Trypanosoma
brucei and L. major have been identified [39–41]. The
eIF4F components of L. major have been predicted
[17], and the analysis of the eIF4E component of the

eIF4F complex has been initiated [42]. However, little
is known regarding the role of these factors in trans-
lation.
In this work we studied the biochemical properties
of purified, recombinant, LeIF protein from Leishma-
nia infantum, and we demonstrate that it is an
RNA-dependent ATPase and an ATP-dependent RNA
helicase. Sequence alignments show that LeIF is closely
related to known eIF4A factors, but its closest homo-
logue in humans is DDX48, also known as eIF4AIII,
which plays a role in nonsense-mediated mRNA decay
and nuclear mRNA splicing [43–46]. Genetic studies in
the yeast Saccharomyces cerevisiae provided evidence
that LeIF can impair cell growth and can associate
with yeast proteins involved in translation initiation,
although it is not able to complement the deletion of
the yeast-encoded eIF4A. Finally, in vitro coimmuno-
precipitation experiments show that LeIF interacts
with the yeast translation initiation factor eIF4G. Our
results also point to the importance of the 25 amino
terminal residues in enhancing the ability of the pro-
tein to interfere with the translation machinery of
yeast. All this confirms an unproductive interaction of
M. Barhoumi et al. Leishmania LeIF is an eIF4A-like RNA helicase
FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5087
LeIF with translation initiation factors in yeast and
interest for it as a potential drug target.
Results
Sequence analysis
LeIF protein of L. infantum has 98% and 100% iden-

tity with LeIF proteins of L. braziliensis and L. major,
respectively [11]. The alignment shown in Fig. 1 and
summarized in Table 1 compares the LeIF protein of
L. infantum with eIF4A-like proteins from humans,
mouse and yeast. IF41 and IF42 are identical between
mice and humans while DDX48 shows only three
differences. IF41 and IF42, also called eIF4AI and
eIF4AII, are known translation initiation factors in
mammalians, as is eIF4A in yeast [35]. IF42 is func-
tionally equivalent to IF41 but its tissue-specific
expression and developmental regulation is somewhat
different. DDX48 is involved in splicing and nonsense-
mediated mRNA decay [44–46]. It cannot substitute
for IF41 in ribosome binding assays, it inhibits transla-
tion in vitro in reconstitution experiments, and its
affinity for eIF4G is somewhat different from that of
eIF4AI [47]. Fal1 (for eIF4A-Like) is a nucleolar pro-
tein involved in ribosomal biogenesis [48]. It has 56%
identity with yeast eIF4A, and it cannot substitute for
eIF4A in vivo.
Fig. 1. Sequence comparison of L. infantum LeIF with eIF4A homologues. CLUSTALW alignment shows the comparison of the predicted
amino acid sequences of L. infantum eIF4A (LieIF), with the eIF4A-like proteins from human (Hu), and yeast (Sc). The mouse equivalents
are essentially the same as the human. Conserved motifs found in RNA helicases, are as indicated in light blue (Q, I–VI). Identical amino
acids shared between the proteins are shown in magenta and green. Asterisk indicates fully conserved residues; colon means that substitu-
tions are conserved; period means that substitutions are semiconserved.
Leishmania LeIF is an eIF4A-like RNA helicase M. Barhoumi et al.
5088 FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS
The mammalian protein with the closest similarity
to LeIF is DDX48, although the predicted pKi of
LeIF is intermediate between the IF proteins and

DDX48. The differences on the sequence level seem to
be randomly distributed on the carboxyl terminal
RecA-like domain (domain 2) while they tend to be
more clustered in the amino terminal domain (domain
1). In particular, the most notable differences are seen
in the sequence upstream of the isolated, highly con-
served phenylalanine of the recently identified Q motif
[49] and between motifs I and II. The LeIF protein
has all the conserved motifs characteristic of DEAD
box helicase (motifs Q, I, Ia, Ib, II, III, IV, V, and VI)
that are known to be important for ATP binding and
hydrolysis, for RNA binding and for RNA unwinding.
This prompted us to characterize its biochemical activ-
ities and compare them to yeast eIF4A.
LeIF protein has an RNA-dependent ATPase
activity
We subcloned the LeIF gene into a pET22b plasmid
containing a carboxyl terminal His6 tag, expressed the
protein in the Origami Escherichia coli strain and puri-
fied the soluble protein by nickel-nitrilotriacetic acid
agarose chromatography (Fig. 2). We estimated the
protein to be greater than 90% pure after this column.
We also cloned, expressed and purified a mutant in
motif I (K76A) as a control; a similar mutation in
eIF4A disrupts ATP binding and ATPase activity
[49,50]. The identity of the proteins was verified using
antibodies raised against His and LeIF (data not
shown).
The purified recombinant proteins were used in ATP-
ase assays that measured the free phosphate released,

in the presence of commercially available total yeast
RNA, with a colorimetric assay based on molybdate-
Malachite Green [49,51]. The optimal reaction condi-
tions were determined for the wild-type LeIF and yeast
eIF4A proteins. LeIF showed a sharp peak around
pH 6.0, and there was little activity at pH 5.0 or below
and a gradual decrease at pH 6.5 and above. A similar
profile was obtained for eIF4A. Likewise, both LeIF
and eIF4A were more active with acetate ions than
chloride, with a peak activity around 10–20 mm. The
divalent cation optimum was 1–5 mm for LeIF and 1–
2mm for eIF4A. The ATPase activity for both pro-
teins was saturated at the RNA concentration typically
used (500 ngÆlL
)1
), but LeIF showed saturation at a
Table 1. Protein characteristics and sequence homology to LeIF. The L. infantum LeIF protein sequence was used to find similar proteins
using BLAST2.0 on the EMBnet web site () using the SwissProt and TrEMBL databases and the default settings.
CLUSTALW analyses were also carried out on the EMBnet site with the default setting. All values are relative to LeIF. Molecular mass (m) and
pK
i
were calculated through ExPASy web site ( Hu, human; Mus, mouse; Sc, S. cerevisiae. %Similarity includes
conserved and semiconserved substitutions. E value, a measure of the expected random matches.
Protein (Accession no.) Length (aa) m (Da) pK
i
% Identity % Similarity E Value
LeIF 403 45327 5.83 — — —
DDX48_Hu (P38919) 411 46871 6.30 55.6 85.9 e
)118
DDX48_Mus (Q91VC3) 411 46840 6.30 55.6 85.9 e

)118
IF42_Hu (Q14240) 407 46402 5.33 56.3 84.6 e
)117
IF42_Mus (P10630)
IF41_Hu (P60842) 406 46154 5.32 56.1 84.1 e
)115
IF41_Mus (P60843)
eIF4A_Sc (P10081) 394 44566 5.02 54.6 83.4 e
)109
Fal1_Sc (Q12099) 399 45213 9.09 52.6 83.9 e
)104
124 K
80.0K
49.0K
34.8K
28.9K
20.6K
209 K
MW
GST-elF4G
LeIF
elF4A
Δ25LeIF
Fig. 2. Expression and purification of the proteins used. Aliquots of
purified His6-LeIF, His6-D25LeIF, His6-eIF4A and GST-eIF4G protein
were resolved by SDS polyacrylamide gel and stained with Coo-
massie brilliant blue. The positions of the Bio-Rad prestained mark-
ers (in kDa) are indicated at the left. The K76A mutant of LeIF had
purity similar to LeIF (not shown).
M. Barhoumi et al. Leishmania LeIF is an eIF4A-like RNA helicase

FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5089
lower concentration (around 100–200 ngÆlL
)1
RNA)
than eIF4A, which suggested a higher affinity for
RNA. This was consistent with electrophoretic
mobility shift assays (EMSA) that indicated LeIF had
roughly a two-fold higher affinity (data not shown).
ATPase activity was directly proportional to the
enzyme concentration for both proteins, which showed
that they were probably functional as monomers. As
expected the LeIF mutant with a substitution in motif
I (K76A) showed no significant ATPase activity. The
amount of ATP hydrolyzed for LeIF and eIF4A
increased in a time-dependent manner in the presence
of saturating concentrations of total yeast RNA
(Fig. 3A). Thus, the LeIF protein exhibited an RNA-
dependent ATPase activity that is characteristic of pro-
teins from the DEAD box family.
The nucleotide specificity of LeIF protein was
assessed using different NTPs and dNTPs. Both ATP
and dATP were efficiently hydrolyzed in the presence
of RNA, as was found for eIF4A [49]. The other
NTPs and dNTPs had no effect. As shown in Fig. 3,
the Michaelis–Menten parameters were determined
with variable concentrations of ATP at saturating con-
centrations of RNA. We determined the K
m
for ATP
of LeIF to be 350 ± 120 lm, the k

cat
was 72 ± 9 s
)1
and the k
cat
⁄ K
m
was 0.21 ± 0.7 s
)1
Ælm
)1
. LeIF was
inhibited by ADP, which had a binding affinity similar
to that for ATP. We also determined the kinetic
parameters for eIF4A. However, ADP binds eIF4A
with a higher affinity than ATP [49], which made our
measurements less reliable, especially at higher ATP
concentrations. Nevertheless, the values were in
the same range as those for LeIF with a K
m
of
250 ± 90 lm,ak
cat
of 39 ± 7 s
)1
and a k
cat
⁄ K
m
of

0.16 ± 0.06 s
)1
Ælm
)1
. These values of eIF4A are sim-
ilar to those obtained by other workers [30,52].
LeIF protein has an ATP-dependent RNA helicase
activity in vitro
To test whether LeIF has an RNA unwinding activity
in vitro, we constructed two RNA ⁄ DNA heteroduplex-
es containing 44 or 45 nucleotide long RNAs and a 16
nucleotide long DNA that could hybridize on either
the 5¢ or 3¢ end of the RNAs (Fig. 4A). It was previ-
ously shown that RNA ⁄ DNA duplexes are substrates
for RNA helicases as long as the single-stranded
region is RNA; it functions as the initial binding site
for the proteins [21,51,53]. As shown in Fig. 4B,C,
LeIF and eIF4A were able to unwind both the 5¢ and
the 3¢ duplexes when they were in 20-fold excess of
the substrate. There was significant unwinding in the
absence of ATP, which probably reflected the intrinsic
affinity of the protein for the RNA at these high pro-
tein concentrations. However, there was approximately
30% more unwinding activity in the presence of ATP.
This relatively poor ATP-dependent helicase activity of
eIF4A proteins has been noted previously [53]. The 5¢
duplex was unwound more efficiently than the 3¢
duplex with both proteins, but we do not consider this
evidence for directionality. Rather, this probably
reflects the intrinsic properties of the duplexes

themselves. Although the same oligonucleotide was
hybridized on both RNAs (calculated DG° ¼ –19.8
kcalÆmol
)1
under standard conditions), the 5¢ duplex
had a slightly lower T
m
, which probably resulted
because the 5¢ duplex RNA (K06) could form a
moderately stable (calculated DG° ¼ –4.5 kcalÆmol
)1
)
intramolecular hairpin that could compete for the
A

0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0 0.5 1.0 1.5 2.0 2.5 3.0 3.5
Velocity (µM/min)
[ATP] mM
B
0
10
20

30
40
50
0
20 40 60 80 100
[PO
4
]µM
Time (min)
Fig. 3. Kinetic measurements of the ATPase activity of LeIF. (A) An
example of a time course for the ATPase activity of 540 n
M LeIF
with 0 n
M (n), 50 nM (s), 100 nM (+), 400 nM (m), 1 mM (r), or
3m
M (n) ATP in the presence of 500 ngÆlL
)1
RNA. The control con-
sisted of 3 m
M ATP and no RNA (h). The K76A mutant control of
LeIF showed ATPase activity comparable to the control (not
shown). (B) Michaelis–Menten plot of the medium values of three
independent experiments.
Leishmania LeIF is an eIF4A-like RNA helicase M. Barhoumi et al.
5090 FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS
oligonucleotide binding site (NK Tanner, unpublished
data). Thus, it is important to incorporate the proper-
ties of the substrates when interpreting the unwinding
activity of the helicases.
LeIF cannot complement the deletion of eIF4A

Our biochemical analyses showed that LeIF had very
similar properties to yeast eIF4A. However, this provi-
ded only circumstantial evidence that LeIF is a transla-
tion initiation factor. Consequently, we used genetic
studies in the yeast S. cerevisiae to understand the
potential role of LeIF in the translation initiation pro-
cess. In order to test whether the LeIF gene can com-
plement the deletion of the essential TIF1 and TIF2
genes in yeast, which encode eIF4A, we subcloned the
LeIF gene into both low and high copy number yeast
plasmids, p415-PL-ADH and p424-PL-ADH, respect-
ively, containing strong, constitutively expressed, ADH
promoters [49]. We also cloned the LeIF gene in an
equivalent plasmid containing a galactose-inducible
promoter p424-PL-GAL. As a control, the yeast eIF4A
gene was cloned into the same vectors.
The various constructs were transformed into the
yeast strain SS13-3A, where both chromosomal copies
of the essential eIF4A genes were deleted and eIF4A
was expressed off the YCplac33-TIF1 (CEN-URA3)
plasmid [49]. Because this plasmid contained a URA3
marker we could selectively eliminate it from trans-
formed cells by plating them on 5-fluoro-orotic acid
(5-FOA)-containing medium. Thus, the protein enco-
ded by the transforming plasmid could ensure growth
of the yeast only if it had the ability to complement
for the missing function. Protein expression was veri-
fied by western blot analysis of cell extracts separated
on 12% SDS Laemmli gels and revealed with anti-HA
IgG (data not shown). None of the LeIF-containing

plasmids were able to support yeast growth at any
temperature tested (18 °C, 30 °C, and 36 °C). These
data showed that LeIF could not substitute for the
yeast eIF4A. Likewise, purified LeIF protein did not
support translation in an in vitro reconstitution assay
using rabbit reticulocytes (M Altmann, University of
Bern, Switzerland, unpublished data).
In experiments similar to those previously described,
we also transformed a yeast strain deleted for the
FAL1 gene, encoding the Fal1 protein, which has a
clearly different function from eIF4A, with the various
LeIF constructs. None of them supported growth on
5-FOA-containing medium (data not shown). Thus,
LeIF cannot substitute for the Fal1 protein.
LeIF protein inhibits cells growth
While our in vivo complementation assays failed to
reveal a role for the LeIF protein, we did notice that
cells expressing the protein were less vigorous after
transformation. It is possible that LeIF was interfering
with the cellular machinery by interacting with, and
sequestering, yeast factors involved in translation. We
tested this by transforming the various LeIF constructs
into the yeast SS3 strain that has the TIF2 gene
replaced by a cassette carrying the URA3 gene and a
second TIF1 gene under the control of the CYC1-
C
0
20
40
60

80
100
15
30
60
0
5
15
30
60
0
5
15
30
60
0
5
15
30
60
0
5
1 mM ATP
no ATP
%Free
Time(min)
LeIF eIF4A
LeIF eIF4A
3 Duplex
5 Duplex

A
Duplex
Olgo
0
5
15
30
60
LeIF
0
5
15
30
60
eIF4A
0
5
15
30
60
15
30
60
LeIF
0
5
eIF4A
5 Duplex 3 Duplex
B
Fig. 4. Unwinding activity of LeIF. (A) The same 5¢ [

32
P] end-labeled
DNA oligonucleotide was hybridized to two RNA transcripts that
yielded 3¢ and 5¢ duplexes. (B) Time course for ATP-dependent
unwinding of 3¢ and 5¢ duplexes by LeIF protein. Briefly, 50 n
M of
duplex were incubated with 1 l
M protein with or without 1 mM
ATP, at 30 °C, for the times indicated in minutes. To prevent rean-
nealing of the displaced [
32
P]-labeled oligonucleotide, 1 lM cold
DNA oligonucleotide was added as a competitor. Products were
separated on a 15% polyacrylamide gel, which was then subject to
autoradiography and quantification. (C) Comparison of the relative
helicase activities of LeIF to yeast eIF4A.
M. Barhoumi et al. Leishmania LeIF is an eIF4A-like RNA helicase
FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5091
GAL promoter. Because the expression of the TIF1
gene under its own promoter is several-folds lower
than that of the TIF2 gene [54], this strain produces
less eIF4A protein on glucose-containing medium than
a normal strain, but it can be induced for higher
eIF4A production on galactose-containing medium.
This strain was previously used to see dominant-negat-
ive phenotypes of eIF4A mutations [54]. Cells expres-
sing the full-length LeIF showed strongly reduced
growth on glucose-containing medium compared to
the cells transformed with the vector alone or with the
plasmid carrying the TIF1 gene (Fig. 5). The difference

in growth however, was not observed on galactose-
containing medium (data not shown). Cells constitu-
tively expressing yeast eIF4A also showed slightly
reduced growth relative to cells with the plasmid alone,
but not nearly as strongly as with LeIF (Fig. 5). This
presumably reflected the altered stoichiometry of the
translation initiation factors that caused inefficient
assembly of the initiation complex.
The first 25 amino terminal residues interfere
with translation machinery in yeast
In order to identify the part of LeIF protein that is
implicated in this inhibition, we cloned a construct of
LeIF that was missing the first 25 amino terminal resi-
dues (D25LeIF). This construct was made because the
amino termini showed the most differences between
proteins (Table 1) and because a similar construct of
yeast eIF4A could complement growth (NK Tanner,
unpublished data).
As shown in Fig. 5, expression of the D25LeIF pro-
tein showed the same growth profile as overexpression
of eIF4A. Thus these amino terminal residues
enhanced the ability of LeIF to interfere with the cellu-
lar machinery.
We verified this result by measuring the doubling
time of cells expressing the various constructs in liquid
culture containing glucose. Cells were grown at 30 °C
with continuous shaking in minimal medium lacking
tryptophan [synthetic dextrose (SD)-Trp]. The absence
of revertants or loss of plasmids was verified at the
end of the incubation by streaking culture aliquots on

SD-Trp plates. Three independent cultures were made
for full-length LeIF and two independent cultures were
made for the other constructs. The cells expressing
full-length LeIF grew about 50% less rapidly than the
cells transformed with the plasmid alone, with a doub-
ling time of 5.0 h versus 2.5 h, respectively. Overex-
pression of eIF4A showed a slight inhibitory effect
(3.0 h) as did the D25LeIF (3.3 h). To rule out the
possibility that the deletion of the amino terminus
affected the expression or stability of the protein, total
cellular proteins were extracted from exponentially
growing cells (D
600
¼ 0.8), separated on an SDS
Laemmli gel, transferred to nitrocellulose membrane
and analyzed by a western blot analysis using anti-HA
and anti-LeIF IgG. The results showed that the recom-
binant HA-tagged D25LeIF protein had a stable
expression comparable to the HA-tagged LeIF protein
(data not shown).
Interaction between LeIF protein and GST-eIF4G
in vitro
The dominant-negative phenotype that we observed
with the LeIF protein suggested that it was capable of
interacting nonproductively with the yeast translation
initiation factors, which resulted in translation inhibi-
tion. However, a more trivial explanation was that
expression of the LeIF protein had a general toxic
effect on the cells that was unrelated to translation per
se. This possibility was unlikely because increased

expression of yeast eIF4A largely reversed the effect.
Nevertheless, we decided to verify that LeIF could
interact with components of the eIF4F complex. Previ-
ous studies in yeast have shown that the 542–883 frag-
ment of eIF4G interacts with eIF4A in vitro [55]. We
purified this fragment, which was expressed in E. coli
as a glutathione S-transferase (GST) fusion protein
(Fig. 2) and used it to generate a glutathione-sepharose
affinity column. The LeIF recombinant proteins [wild-
LeIF
25LeIF
eIF4A
Control
1
100 000
10 000
1000
100
10
Fig. 5. Dominant-negative phenotype of the LeIF gene. Yeast SS3
cells were transformed with the plasmids containing the LeIF gene,
the D25LeIF gene, yeast TIF1 (eIF4A) or the p424-PL plasmid alone
(control). Cells were grown in liquid minimum (SD) medium lacking
tryptophan to the same density, serially diluted and 5 lL of each
dilution was spotted onto SD minus Trp-containing plates. The
plates were incubated at 30 °C. The numbers refer to the amount
of dilution.
Leishmania LeIF is an eIF4A-like RNA helicase M. Barhoumi et al.
5092 FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS
type (wt) and D25LeIF] were then loaded onto col-

umns with the bound eIF4G and washed. The retained
proteins were eluted with reduced glutathione, separ-
ated on an SDS Laemmli gel, transferred to a nitrocel-
lulose membrane and then subjected to western blot
analysis using anti-GST, anti-LeIF and anti-His-tag
IgGs. As a control, we carried out the same experi-
ment with recombinant yeast eIF4A.
The results showed that recombinant LeIF and
D25LeIF were capable of binding to the column with
the yeast GST-eIF4G fusion, but not to GST alone
(Fig. 6). Similarly, the yeast eIF4A was retained on
the GST-eIF4G column. Interestingly, a minor degra-
dation product of LeIF was preferentially retained on
the column by the GST-eIF4G in some experiments,
probably as a result of protease cleavage while bound
to the matrix. The visible contaminants on the Coo-
massie blue-stained gel were extracted and sequenced
with a MALDI-TOF mass spectrometer; the 23 kDa
fragment corresponds to the carboxyl terminal region
consisting of domain 2 and residues just amino ter-
minal to motif III. Although previous studies showed
it is the amino terminal domain of eIF4A that binds
to eIF4G [56], recent NMR studies indicate that,
although both domains 1 and 2 interact with the
middle domain of eIF4G, it is the carboxy terminal
domain 2 that forms the main interactions [52]. The
result that the LeIF carboxyl terminal domain was
selectively retained in some experiments would imply
that the LeIF interactions with eIF4G are similar to
those of eIF4A. Regardless, these results show that

LeIF protein can interact with yeast eIF4G in vitro,
and they suggest that a similar interaction could occur
in vivo.
We used the purified eIF4G to determine whether it
would enhance the ATPase activity of LeIF as previ-
ously observed with eIF4A [56]. The eIF4G elution
buffer, probably the glutathione, was strongly inhibi-
tory in the ATPase assay, and the eIF4G required
extensive dialysis against the binding buffer. We found
up to a 50% enhancement of the ATPase of eIF4A
and a smaller enhancement with LeIF. However, the
primary effect of eIF4G is to enhance the affinity of
eIF4A for the RNA [56], and our conditions may not
have been optimized to see this. More extensive kinetic
analyses are needed, but these preliminary experiments
show a small eIF4G-dependent enhancement of the
ATPase activity of both eIF4A and LeIF.
Discussion
The antigenic properties of Leishmania LeIF protein
are well characterized. Indeed all studies highlight the
peculiar and unique characteristics of this protein that
lead researchers to consider it as a Th1-type natural
adjuvant and as an immunotherapeutic molecule
against intracellular pathogens. However, little is
known about its biological role. The sequence homol-
ogy with eIF4A implies a role as a translation initi-
ation factor [10,11] although other sequence analysis
shows a more distant relationship [18]. The Leishmania
genome encodes for two genes annotated as eIF4A
( These identical isoforms,

borne by chromosome 1, are identified in L. infantum
as LinEIF4A1 (LinJ01.0780 and LinJ01.0790), which
encode for LeIF protein. Another gene, LinEIF4A2
(LinJ28.1600) on chromosome 28, encodes for a sim-
ilar protein that has only 49% identity with LeIF, and
it is predicted to be 14 amino acids shorter. This work
was undertaken to characterize the biochemical prop-
erties of the LeIF protein and to compare its bio-
chemical and genetic properties with its counterpart in
yeast, eIF4A.
The in vitro biochemical studies show that LeIF pro-
tein is an RNA-dependent ATPase that has the ability
to unwind RNA ⁄ DNA heteroduplexes in an ATP-
dependent manner. As is true of the other DEAD box
proteins characterized, nucleotide binding and hydro-
124 K
80.0K
49.0K
34.8K
28.9K
Load
+eIF4G
Control
Load
+eIF4G
Load
+eIF4G
25
LeIF LeIF eIF4A
Fig. 6. Interaction between recombinant His6-LeIF, His6-D25LeIF

or His6-eIF4A with GST-eIF4G in vitro. Five micrograms of GST-
eIF4G (+ eIF4G) or buffer alone (Control + GST) were incubated
with GSH-Sepharose beads and 5 lg of LeIF, D25LeIF or eIF4A as
described in Experimental procedures. Proteins retained by the
matrix were eluted with glutathione and resolved by SDS ⁄ PAGE.
The blot was then probed with anti-His-tag (shown), anti-LeIF, anti-
eIF4A, and anti-GST IgG. Lanes Load correspond to the purified
proteins loaded onto the matrix, + eIF4G correspond to proteins
bound to eIF4G and subsequently eluted with glutathione, and Con-
trol is LeIF protein eluted from the matrix without GST-eIF4G. The
positions of marker proteins (in kDa) are indicated at the left.
M. Barhoumi et al. Leishmania LeIF is an eIF4A-like RNA helicase
FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5093
lysis activity of LeIF is dependent on the presence
of RNA, and it is specific to ATP and dATP
[21,22,24,34]. This ATPase activity can be abolished by
a mutation of the conserved lysine (K76A) in motif I,
which is consistent with studies of other helicases, such
as eIF4A [50] and yeast Has1 [57]; this confirms the
importance of this motif in nucleotide binding. Indeed,
crystallographic analyses of yeast eIF4A [32] and viral
NS3 [58] have shown that this residue contacts the a,
b and sometimes c phosphates of the bound NTP.
The LeIF protein has a K
m
for ATP binding around
350 lm, which is similar to that reported for other
DEAD box proteins such as human p68 [59], yeast
eIF4A ([30,52] and this study), yeast Has1 [57] and
E. coli DbpA [60]. This value, which is below the cellu-

lar concentration of ATP (5–10 mm), indicates that
LeIF can bind and hydrolyze ATP in the cell cyto-
plasm. The k
cat
measured for ATP hydrolysis by LeIF,
1.2 min
)1
, is in the range of k
cat
values for eIF4A
(1 min
)1
for the mammalian factor [61] and 0.65 min
)1
for the yeast factor; this study), E. coli SrmB
(1.2 min
)1
[62]) and RNA helicase II (1.9 min
)1
[63])
but is much lower than that of yeast Ded1 (300 min
)1
[28]), yeast Prp22p (400 min
)1
[31]) and E. coli DbpA
(600 min
)1
[60]). This relatively weak ATPase activity
measured in vitro could reflect low intrinsic catalytic
activity. Alternatively, the lack of post-translational

modifications in the recombinant protein or the
absence of specific substrates may contribute to the
low activity. Of the DEAD box proteins that have
been studied biochemically, only DbpA from E. coli
shows a strong RNA substrate specificity [60,64]. It
also may be due to the absence of protein cofactors;
the ATPase and helicase activities of eIF4A purified
from rabbit reticulocyte lysates are increased in the
presence of eIF4F, eIF4B and eIF4H [30,53]. Recently,
it was shown that cpc
3
– the central domain of eIF4G
that binds eIF4A – stimulates the ATPase activity by
about 40-fold by lowering the K
RNA
m
by 10-fold and by
raising the k
cat
by 4-fold [56]. We see only a slight
eIF4G-specific enhancement of the ATPase activity
with eIF4A and LeIF, but our assay conditions were
probably not optimized. Nevertheless, our results are
consistent with the published data, which implies a
functional interaction between eIF4A and LeIF with
eIF4G.
The recombinant LeIF protein exhibits poor ATP-
dependent duplex unwinding activity in vitro as shown
previously for eIF4A [30]. The unwinding in the
absence of ATP is found significant, which is consis-

tent with an intrinsic (ATP-independent) affinity of the
protein for RNA. We demonstrate that LeIF protein
can exert its activity in a bidirectional way and unwind
RNA ⁄ DNA heteroduplexes that have either a 3¢
duplex relative to the loading strand or a 5¢ duplex.
This suggests that LeIF acts nonprocessively, and it is
only capable of unwinding short RNA duplexes. The
majority of RNA helicases studied so far are thought
to have directional unwinding. Nevertheless, Ded1,
eIF4A and p68 were reported to unwind duplexes in
both directions in vitro [49,51,59]. Although LeIF has
similar biochemical properties to the eIF4A proteins
from other organisms, there are some differences
between LeIF and the yeast eIF4A that include a
wider range for the optimum magnesium concentra-
tion, a similar affinity for ATP and ADP, and a higher
affinity for RNA. These differences could reflect
fundamental differences in the dynamics of the interac-
tion of the protein within the eIF4F complex or within
the translation machinery. In this regard, the eIF4B
protein has not been described so far and was not
uncovered by the Leishmania or Trypanosoma sp. gen-
ome projects ( />Translation initiation in mammals and yeast is well
studied; it involves many RNA–RNA, protein–RNA,
and protein–protein interactions. In contrast, know-
ledge about the process of protein synthesis in Trypan-
osomatidae protozoans is inferred by indirect evidence,
such as sequence similarities between individual trans-
lation factors with homologues from higher eukaryo-
tes. Recently, Dhalia et al. [17] reported the in silico

identification of multiple potential homologues of the
three eIF4F components, eIF4E, eIF4A, and eIF4G.
These putative eIF4F components are expressed at
similar levels and relative stoichiometry as those des-
cribed for yeast and other eukaryote systems [17]. In
particular, the L. major LmEIF4A1, which shows
100% identity with LeIF, is readily detected in the
promastigote as a very abundant protein, which also is
true for eIF4A from mammals and yeast [65,66]. Nev-
ertheless, our results show that LeIF cannot substitute
for the yeast eIF4A in spite of the high sequence iden-
tity between the two proteins. Moreover, it does not
support translation in vitro in reconstitution assays
(M Altmann, unpublished data). However, these results
are not surprising because the mammalian proteins do
not support growth in yeast either [67].
Expression of LeIF in genetically engineered yeast
strains where endogenous eIF4A is expressed off only
one its two encoding genes results in severe growth
inhibition. Our experimental results exclude the possi-
bility of a general toxic effect, or a difference in the
expression levels or stability of LeIF in yeast; this sug-
gests that LeIF can interact with the endogenous yeast
factors within the translation initiation complex. Inter-
estingly, our results also emphasized the role of the
Leishmania LeIF is an eIF4A-like RNA helicase M. Barhoumi et al.
5094 FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS
25 amino terminal residues of LeIF in its interactions
with the cellular machinery. Deletion of this part
(D25LeIF), which is the part most divergent from

eIF4A, abolishes the severe dominant-negative pheno-
type of LeIF. However, this variant also did not
complement the eIF4A double-deletion strain on
5-FOA plates. The simplest explanation for our results
is that LeIF protein can assemble with the yeast pro-
teins to form stable, but nonproductive, interactions
that inhibit translation initiation. The stability or
severity of these interactions are correlated with the
25 amino terminal residues because deletion of them
gives a slight dominant-negative phenotype that is
comparable to that obtained with overexpression of
the yeast eIF4A on the same ADH promoter. Thus,
both D25LeIF and the excess eIF4A sequester the
translation initiation factors in a more transient, or
less inhibitory, fashion. This implies that full-length
LeIF also could act as a translational inhibitor of the
mammalian host cells.
In higher eukaryotes, eIF4A is assumed to be recrui-
ted to the mRNA through its interaction with eIF4G,
which acts as a molecular adapter that coordinates all
steps in translation initiation [68]. It was also shown
that interactions between this fragment and eIF4A are
important for translation initiation and cell growth in
yeast [55]. Our in vitro binding assay demonstrated
that LeIF can interact with the central domain of yeast
eIF4G, preferentially through its carboxy terminal
domain, as has been previously noted for eIF4A [52].
It is likely that this interaction occurs in vivo as well
and that this is, at least partially, the cause of the
dominant-negative phenotype. This is further suppor-

ted by data showing that Leishmania LmEIF4G pro-
tein can bind both LmEIF4A1 and human eIF4A
in vitro [17]. The role of the 25 amino terminal residues
is unclear, but they may form interactions with other
factors such as eIF4E.
In our sequence comparisons, LeIF shows the clo-
sest similarity with DDX48. However, with the excep-
tion of two to four spliced genes, the vast majority of
trypanosomatid mRNA processing involves trans-spli-
cing; no exon junction complex (EJC) has been identi-
fied [69,70]. Nonsense-mediated mRNA decay, which
is associated with the very early steps of translation,
has been described in yeast to humans [71], but it is
unknown so far in trypanosomatids [69]. Furthermore,
a recent study indicates that TbEIF4AIII in T. brucei,
which is similar to LmEIF4A2 in Leishmania, is the
closest orthologue to eIF4AIII [72]. Taken together, it
is unlikely that LeIF plays the same role as DDX48
within the promastigotes and amastigotes of Leishma-
nia. Yeast too lacks an EJC, although the downstream
sequence element probably serves a similar role in non-
sense-mediated decay [71]. Although there is evidence
that DDX48 is more closely related to Fal1 than to
eIF4A in yeast [18], it is unlikely that they play the
same roles because Fal1 is located predominantly in
the nucleolus, and it is thought to be involved in ribo-
some biogenesis [48]. Thus, a DDX48-like function
probably does not exist in yeast either. It is therefore
intriguing that it is the amino terminus that shows the
highest sequence divergence among these proteins

(LeIF, DDX48, eIF4A and Fal1; Fig. 1 and data not
shown). Because it is the amino terminus of LeIF that
confers the strong dominant-negative phenotype in
yeast, it is possible that this short sequence modifies
the function of the RecA domains or alters their inter-
actions with other factors.
Our results provide evidence for the potential
involvement of LeIF in the translation machine in
Leishmania. This is further supported by data recently
published that used RNAsi in T. brucei [72]. The high
identity scores of Leishmania sp. LeIF with proteins
from other Trypanosomatidae species, such as T. bru-
cei and T. cruzi ( which are
pathogens responsible for human African trypanosom-
iasis and Chagas disease, respectively, provides evi-
dence that LeIF could be functional homologue of
eIF4A, and that they all use similar mechanisms for
translation initiation. This is supported by the similar
biochemical properties of LeIF and yeast eIF4A. Nev-
ertheless, definitive evidence must wait for the develop-
ment of an in vitro translation system for Leishmania.
However, the potential interactions of these proteins
with the host systems in the particular context of each
infectious process also will need to be defined. Anti-
genic properties of LeIF, a cytosolic protein, could
result from the infectious process when macrophages
are lysed and the amastigotes, and the contents of the
parasitophorous vacuoles, are released and scavenged
by macrophages. LeIF could also be involved in direct
interactions with the host cell and thereby constitute a

virulence factor. It will be important to see if LeIF
expression affects translation in mammalian cells as it
does in yeast, and whether it has cytotoxic effects
because of its sequence similarity to eIF4AIII.
In this regard, it is interesting that Leishmania EF-
1a, which is another ubiquitous protein with antigenic
properties [73], is able to diffuse into the cytosol of
L. donovani infected macrophages and inactivate them
[74]. EF-1a plays an important role in eukaryotic pro-
tein biosynthesis by binding aminoacyl-tRNAs and
positioning them in the A site of ribosomes. However,
the cytoplamic Leishmania EF-1a binds the host’s Scr-
homology-2-containing tyrosine phosphatase (SHP-1)
M. Barhoumi et al. Leishmania LeIF is an eIF4A-like RNA helicase
FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5095
and thereby activates it; this leads to macrophage
deactivation [74]. It also is interesting to note that
some of the proposed Leishmania pathoantigens are
conserved proteins that are organized into multimolec-
ular complexes to form subcellular particles; homo-
logues of some of them are involved in autoimmune
diseases [75]. Finally, it is interesting that DDX48 was
shown to be an autoantigen in pancreatic cancers [76].
Clearly, additional work will be needed to clarify the
role of LeIF in Leishmania infections. To conclude,
our results support using LeIF as a potential drug
target.
Experimental procedures
Cloning and mutagenesis
The entire LeIF gene, and the sequence coding for the pro-

tein deleted for the first 25 amino terminal residues, were
amplified from genomic DNA of L. infantum parasite by
PCR using 5¢ oligonucleotides containing SpeI and NdeI
sites and a 3¢ oligonucleotide containing an XhoI site. The
sequences of oligonucleotides used for PCR amplification
were as follow: (1) the entire LeIF gene 5¢ oligo (LeIF2_up;
GCGCGACTAGTCATGGCGCAGAATGATAAGATCG)
and 3¢ oligo (LeIF2_low; GCGCGCTCGAGCTC
AC
CAAGGTAGGCAGCGAAG; the underlined nucleotide
was a silent mutation added to disrupt a stable hairpin in
the oligo); (2) the LeIF deletion 5¢ oligo (GCGCGACTAG
TCATATGCCGTCCTTCGAC) and the 3¢ oligo as above.
A mutation in motif I (K76 fi A) of LeIF was made using
the fusion PCR technique [77]. In brief, the 5¢ and 3¢
regions flanking the site of mutation were independently
PCR amplified with oligonucleotides containing the muta-
tion and the oligonucleotides specific to the 5¢ or 3¢ ends of
the ORF (LeIF2_up & LeIF2_low). The two PCR frag-
ments were purified on a 0.9% agarose gel, and a second
PCR reaction was done with an aliquot of each fragment
and the 5¢ and 3¢ flanking oligonucleotides. The PCR prod-
ucts were purified on 0.9% agarose gel and cloned into a
Bluescript plasmid (Stratagene, La Jolla, CA, USA) cut
with SpeI and XhoI. Sequences were confirmed by DNA
sequencing.
Protein expression and purification
LeIF variants were subcloned into a pET-22b vector (Nov-
agen, San Diego, CA, USA) cut with NdeI and XhoI, and
they were expressed in the Origami E. coli strain (Nov-

agen). Cultures were inoculated with single colony and
grown overnight in Luria-Bertani (LB) medium containing
ampicillin (100 lgÆmL
)1
). Five hundred millilitres of fresh
medium was then inoculated with 10 mL of the overnight
culture and incubated at 30 °C with shaking. The bacterial
cultures were induced with 0.4 mm isopropyl thio-b-d-gal-
actoside at D
600
of 0.4 and incubated for an additional
three hours. Cells were harvested by centrifugation. The
pellet was then resuspended in 5 mL of lysis buffer (20 mm
Tris-base pH 8.0, 300 mm NaCl and 10 mm imidazole) con-
taining 2 mm phenylmethanesulfonyl fluoride. Cells were
lysed by adding lysozyme to a final concentration of
10 mgÆmL
)1
and the solution was incubated on ice for
30 min with occasional mixing. The lysed cells were sonicat-
ed (4 · 20 s) to reduce viscosity, and then centrifuged for
30 min at 15 000 r.p.m. in a SS34 rotor (Sorvall, Boston,
MA, USA) at 4 °C. The supernatant was loaded onto a
2 mL nickel-nitrilotriacetic acid-agarose column (Ni-nitrilo-
triacetic acid; Qiagen, Hilden, Germany) equilibrated with
lysis buffer. The column was washed with 20 mL of lysis
buffer containing 20 mm imidazole and the protein was
eluted with lysis buffer containing 100 mm imidazole. The
eluted protein was stored until needed in 50% glycerol at
)80 °C. Protein concentration was determined by the Bio-

Rad (Hercules, CA, USA) Protein Assay with BSA as the
standard. Purity and concentrations were verified on a 12%
Coomassie-stained SDS polyacrylamide gel. Yeast eIF4A
expression and purification were as previously described
[49].
ATPase assays and analysis
We used a colorimetric assay based on molybdate-Malachite
Green as described previously [49,51]. Buffer conditions
were optimized for LeIF protein (50 mm potassium acetate,
20 mm Mes pH 6.0, 5 mm magnesium acetate, 100 lgÆmL
)1
BSA, and 2 mm dithiothreitol) or for eIF4A (same as for
LeIF except with 1 mm magnesium acetate). Reactions were
in 50 lL volume containing 25 ngÆlL
)1
of protein, 1 mm
ATP and 500 ngÆlL
)1
of total yeast RNA (type III Sigma;
Sigma-Aldrich, St Louis, MO, USA; phenol-chloroform
extracted). Reactions were incubated at 30 °C for various
times, stopped by adding 5 lL of 0.5 m EDTA, pH 8.0, and
pipetted into 96 well microtiter plate to which 150 lLof
molybdate-Malachite Green was added. Absorbance was
measured at 630 nm. The phosphate concentration was
determined from a dilution series of known phosphate con-
centration (0–60 lm) measured at the same time. The back-
ground signal was determined by measuring the reactions in
the absence of protein, in the absence of RNA substrate or
in the absence of ATP. Data were analyzed using kaleida-

graph 3.6 (Synergy, Reading, PA, USA).
Unwinding assay
Preparations of substrates were similar to those described
previously [49,51]. Briefly, to prepare RNA ⁄ DNA hetero-
duplexes, a 44 nucleotide long R01 RNA (5¢-GGGCG
AAUUCAAAACAAAACAAAAC
UAGCACCGUAAAGC
Leishmania LeIF is an eIF4A-like RNA helicase M. Barhoumi et al.
5096 FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS
AAGCU-3¢) was transcribed off a HindIII-cut pGEM-3Z
using T7 RNA polymerase. The RNA transcribed was
annealed to a 5¢ [
32
P]-labeled DNA oligonucleotide (5¢-ATC
GTGGCATTTCGTT-3¢), complementary to the underlined
RNA sequence. This substrate is called 3¢ duplex because it
has the double-stranded region at the 3¢ end of the RNA
transcript. Another HindIII-cut plasmid was used to
make a 45 nucleotide long K06 RNA (5¢-GGGC
UAGC
ACCGUAAAGCAAGUUAAUUCAAAACAAAAGCU-3¢).
It was hybridized to the same 5¢ [
32
P]-labeled DNA oligo-
nucleotide at the sequence underlined. This substrate is
called 5¢ duplex. Unwinding assays of LeIF were carried
out in the presence of a 25-fold excess of unlabeled DNA
oligonucleotide (trap DNA) because the oligonucleotide
would efficiently reanneal under our reaction conditions.
Reactions were in 10 lL volumes consisting of 50 nm

duplex, 12.5 lm unlabeled oligonucleotide, 20 mm Mes,
pH 6.0, 50 mm potassium acetate, 5 mm magnesium acet-
ate, 10 mm dithiothreitol, 0.1 mgÆmL
)1
BSA, 1 UÆlL
)1
RNasin (Promega, Madison, WI, USA), various concentra-
tions of protein and 1 mm ATP were used. Assays with
eIF4A were the same except 1 mm magnesium acetate was
used. Reactions were incubated at 37 °C for various times
and then quenched by placing them on ice. A 5 lL solution
of 40% glycerol, 10 mm EDTA, 0.025% Bromophenol Blue
and 0.025% Xylene Cyanole was added and the sample
was loaded onto a 0.75 mm thick 15% polyacrylamide gel
(29 : 1). The gel was subjected to electrophoresis in a Mini-
Protean apparatus (Bio-Rad) at 4 °C for 1 h at 16 W with
100 mm Tris-base, 90 mm boric acid and 1 mm EDTA run-
ning buffer. The radioactive bands within the gel were
detected with a Cyclone phosphoimager (Packard [Perkin-
Elmer], Wellesley, MA, USA) and quantified using the op-
tiquant software (Packard).
Yeast strains, vectors and genetic manipulation
Yeast manipulations, including media preparations, growth
conditions, and 5-fluoro-orotic acid (5-FOA) selection, were
carried out according to standard techniques [78]. The LeIF
gene cloned into the Bluescript vector was subcloned into
p415-PL and p424-PL vectors containing two HA tags, and
SpeI, NdeI, and XhoI restriction sites [49]. Complementa-
tion was tested by transforming the eIF4A-deletion strain,
SS13-3A (tif1::HIS3 tif2::ADE2), containing the YC-

plac33TIF1 (CEN-URA3) plasmid [49]. We also trans-
formed a strain (DFAL1 YDK1-1C) deleted for the Fal1
gene (fal1::KANMX4 with FAL1-pRSA416) [48]. To assay
for dominant negativity of LeIF we used strain SS3
(tif2::URA3-CYC1-GAL-TIF1) [54].
In vitro binding assays
We obtained a plasmid (pGEX-6P1-542–883) encoding for
residues 542–883 of yeast eIF4G fused to the carboxyl
terminus of GST as a kind gift of M Altmann [55]. The
protein was expressed in E. coli and extracted as described
above. The protein was then loaded on a Glutathione
Sepharose 4B column according to the manufactor’s recom-
mendations (Amersham-Pharmacia, Uppsala, Sweden). The
protein was eluted with glutathione and assayed for purity
on an SDS Laemmli gel (Fig. 2). About 5 lg of recombin-
ant GST-eIF4G was immobilized on approximately 75 lL
of glutathione-sepharose 4B resin that was suspended in
300 lL of binding buffer (20 mm Tris-base, 150 mm NaCl.
This material was incubated with approximately 5 lgof
LeIF or eIF4A in a final volume of 500 lL binding buffer
for 2 h at 4 °C. Following four washing steps with 1 mL of
binding buffer, bound proteins were eluted with 30 mm
glutathione in 50 mm Tris-base, pH 8.0 and resolved by
SDS ⁄ PAGE. The retained proteins were eluted, separated
on an SDS Laemmli gel, transferred to nitrocellulose mem-
brane and then subjected to western blot analysis with rab-
bit anti-LeIF primary polyclonal antibodies (1 : 1000
dilution), anti-HA IgG (1 : 5000), anti-His-tag (1 : 2000,
Cell Signaling, Danvers, MA, USA) and with rabbit
anti-GST (1 : 15000 dilution; a kind gift of O Deloche,

University of Geneva, Switzerland). Antigen–antibody com-
plexes were revealed using peroxydase-coupled secondary
antibodies and diamino-benzidine.
Acknowledgements
We thank Michael Altmann for providing us with
pGEX-6P1-eIF4G and Gerhard Wagner for sending us
a preprint of his paper. We thank Sayda Kamoun for
help with preparation of rabbit anti-LeIF, Olivier
Deloche for the anti-GST IgG and Monique Doe
`
re for
excellent technical help. We are grateful to Olivier
Cordin for technical help, advice, and fruitful discus-
sions. This study received financial support from the
UNICEF ⁄ UNDP ⁄ World Bank ⁄ WHO special pro-
gramme for research and training in tropical diseases,
TDR (ID: A30134), from the Tunisian Ministry of
Scientific Research, Technology and Development of
Competencies (Contrat programme 2004-08 grant to
IG) and by a Swiss National Science Foundation grant
to PL.
References
1 de Almeida MC, Vilhena V, Barral A & Barral-Netto
M (2003) Leishmanial infection: analysis of its first
steps. A review. Mem Inst Oswaldo Cruz 98, 861–870.
2 Herwaldt BL (1999) Leishmaniasis. Lancet 354, 1191–
1199.
3 Echeverria P, Dran G, Pereda G, Rico AI, Requena
JM, Alonso C, Guarnera E & Angel SO (2001)
Analysis of the adjuvant effect of recombinant

M. Barhoumi et al. Leishmania LeIF is an eIF4A-like RNA helicase
FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5097
Leishmania infantum Hsp83 protein as a tool for vacci-
nation. Immunol Lett 76, 107–110.
4 Handman E, Button LL & McMaster RW (1990) Leish-
mania major: production of recombinant gp63, its anti-
genicity and immunogenicity in mice. Exp Parasitol 70,
427–435.
5 Handman E, Symons FM, Baldwin TM, Curtis JM &
Scheerlinck JP (1995) Protective vaccination with pro-
mastigote surface antigen 2 from Leishmania major is
mediated by a TH1 type of immune response. Infect
Immun 63, 4261–4267.
6 Masina SMMG, Demotz SO & Fasel NJ (2003) Protec-
tion against cutaneous leishmaniasis in outbred vervet
monkeys using a recombinant histone H1 antigen.
J Infect Dis 188, 1250–1257.
7 Mougneau E, Altare F, Wakil AE, Zheng S, Coppola
T, Wang ZE, Waldmann R, Locksley RM & Glaichen-
haus (1995) Expression cloning of a protective Leishma-
nia antigen. Science 268, 563–566.
8 Probst P, Skeiky YA, Steeves M, Gervassi A, Grabstein
KH & Reed SG (1997) A Leishmania protein that mod-
ulates interleukin (IL)-12, IL-10 and tumor necrosis fac-
tor-alpha production and expression of B7–1 in human
monocyte-derived antigen-presenting cells. Eur J Immu-
nol 27, 2634–2642.
9 Ramiro MJ, Zarate JJ, Hanke T, Rodriguez D,
Rodriguez JR, Esteban M, Lucientes J, Castillo JA &
Larraga V (2003) Protection in dogs against visceral

leishmaniasis caused by Leishmania infantum is achieved
by immunization with a heterologous prime-boost
regime using DNA and vaccinia recombinant vectors
expressing LACK. Vaccine 21, 2474–2484.
10 Skeiky YA, Guderian JA, Benson DR, Bacelar O,
Carvalho EM, Kubin M, Badaro R, Trinchieri G &
Reed SG (1995) A recombinant Leishmania antigen that
stimulates human peripheral blood mononuclear cells to
express a Th1-type cytokine profile and to produce
interleukin 12. J Exp Med 181, 1527–1537.
11 Skeiky YA, Kennedy M, Kaufman D, Borges MM,
Guderian JA, Scholler JK, Ovendale PJ, Picha KS,
Morrissey PJ, Grabstein KH et al. (1998) LeIF: a recom-
binant Leishmania protein that induces an IL-12-medi-
ated Th1 cytokine profile. J Immunol 161, 6171–6179.
12 Tonui WK, Mejia JS, Hochberg L, Mbow ML, Ryan
JR, Chan AS, Martin SK & Titus RG (2004) Immuni-
zation with Leishmania major exogenous antigens pro-
tects susceptible BALB ⁄ c mice against challenge
infection with L. major. Infect Immun 72, 5654–5661.
13 Webb JR, Kaufmann D, Campos-Neto A & Reed SG
(1996) Molecular cloning of a novel protein antigen of
Leishmania major that elicits a potent immune response
in experimental murine leishmaniasis. J Immunol 157,
5034–5041.
14 Borges MM, Campos-Neto A, Sleath P, Grabstein KH,
Morrissey PJ, Skeiky YA & Reed SG (2001) Potent
stimulation of the innate immune system by a Leishmania
brasiliensis recombinant protein. Infect Immun
69, 5270–

5277.
15 Skeiky YA, Coler RN, Brannon M, Stromberg E,
Greeson K, Crane RT, Webb JR, Campos-Neto A &
Reed SG (2002) Protective efficacy of a tandemly
linked, multi-subunit recombinant leishmanial vaccine
(Leish-111f) formulated in MPL adjuvant. Vaccine 20,
3292–3303.
16 Badaro R, Lobo I, Nakatani M, Muinos A, Netto EM,
Coler RN & Reed SG (2001) Successful use of a defined
antigen ⁄ GM-CSF adjuvant vaccine to treat mucosal
Leishmaniasis refractory to antimony: a case report.
Braz J Infect Dis 5, 223–232.
17 Dhalia R, Reis CR, Freire ER, Rocha PO, Katz R,
Muniz JR, Standart N & de Melo Neto OP (2005)
Translation initiation in Leishmania major: characterisa-
tion of multiple eIF4F subunit homologues. Mol Bio-
chem Parasitol 140, 23–41.
18 Linder P (2003) Yeast RNA helicases of the DEAD-box
family involved in translation initiation. Biol Cell 95,
157–167.
19 Linder P, Lasko PF, Ashburner M, Leroy P, Nielsen
PJ, Nishi K, Schnier J & Slonimski PP (1989) Birth of
the D-E-A-D box. Nature 337, 121–122.
20 Gorbalenya AE & Koonin EV (1993) Helicases: amino
acid sequence comparisons and structure-function rela-
tionships. Curr Opin Struct Biol 3, 419–429.
21 Cordin O, Banroques J, Tanner NK & Linder P (2006)
The DEAD-box protein family of RNA helicases. Gene
367, 17–37.
22 Rocak S & Linder P (2004) DEAD-box proteins: the

driving forces behind RNA metabolism. Nat Rev Mol
Cell Biol 5, 232–241.
23 Silverman E, Edwalds-Gilbert G & Lin RJ (2003)
DExD ⁄ H-box proteins and their partners: helping RNA
helicases unwind. Gene 312, 1–16.
24 Tanner NK & Linder P (2001) DExD ⁄ H box RNA heli-
cases: from generic motors to specific dissociation func-
tions. Mol Cell 8, 251–262.
25 de la Cruz J, Kressler D & Linder P (1999) Unwinding
RNA in Saccharomyces cerevisiae: DEAD-box proteins
and related families. Trends Biochem Sci 24, 192–198.
26 Fuller-Pace FV (1994) RNA helicases: modulators of
RNA structure. Trends Cell Biol 4, 271–274.
27 Schmid SR & Linder P (1992) D-E-A-D protein family
of putative RNA helicases. Mol Microbiol 6, 283–291.
28 Iost I, Dreyfus M & Linder P (1999) Ded1p, a DEAD-
box protein required for translation initiation in Sac-
charomyces cerevisiae, is an RNA helicase. J Biol Chem
274, 17677–17683.
29 Okanami M, Meshi T & Iwabuchi M (1998) Characteri-
zation of a DEAD box ATPase ⁄ RNA helicase protein
of Arabidopsis thaliana. Nucleic Acids Res 26, 2638–
2643.
Leishmania LeIF is an eIF4A-like RNA helicase M. Barhoumi et al.
5098 FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS
30 Rogers GW Jr, Richter NJ & Merrick WC (1999) Bio-
chemical and kinetic characterization of the RNA heli-
case activity of eukaryotic initiation factor 4A. J Biol
Chem 274, 12236–12244.
31 Wagner JD, Jankowsky E, Company M, Pyle AM &

Abelson JN (1998) The DEAH-box protein PRP22 is
an ATPase that mediates ATP-dependent mRNA
release from the spliceosome and unwinds RNA
duplexes. EMBO J 17, 2926–29237.
32 Benz J, Trachsel H & Baumann U (1999) Crystal struc-
ture of the ATPase domain of translation initiation fac-
tor 4A from Saccharomyces cerevisiae – the prototype
of the DEAD box protein family. Structure Fold Des 7,
671–679.
33 Caruthers JM, Johnson ER & McKay DB (2000) Crys-
tal structure of yeast initiation factor 4A, a DEAD-box
RNA helicase. Proc Natl Acad Sci USA 97, 13080–
13085.
34 Caruthers JM & McKay DB (2002) Helicase structure
and mechanism. Curr Opin Struct Biol 12, 123–133.
35 Gingras AC, Raught B & Sonenberg N (1999) eIF4
initiation factors: effectors of mRNA recruitment to
ribosomes and regulators of translation. Annu Rev
Biochem 68, 913–963.
36 Pain VM (1996) Initiation of protein synthesis in euk-
aryotic cells. Eur J Biochem 236, 747–771.
37 Hershey JWB & MW (2000) Pathway and mechanism
of initiation of protein synthesis. In Translational Con-
trol of Gene Expression (Sonenberg N, Hershey JWB &
Mathews M, eds), pp. 33–88 Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY, USA.
38 Rhoads RE (1999) Signal transduction pathways that
regulate eukaryotic protein synthesis. J Biol Chem 274,
30337–30340.
39 Bates EJ, Knuepfer E & Smith DF (2000) Poly(A)-bind-

ing protein I of Leishmania: functional analysis and
localisation in trypanosomatid parasites. Nucleic Acids
Res 28, 1211–1220.
40 Batista JA, Teixeira SM, Donelson JE, de Kirchhoff LV
& CM (1994) Characterization of a Trypanosoma cruzi
poly(A)-binding protein and its genes. Mol Biochem
Parasitol 67, 301–312.
41 Hotchkiss TL, Nerantzakis GE, Dills SC, Shang L &
Read LK (1999) Trypanosoma brucei poly(A) binding
protein I cDNA cloning, expression, and binding to 5
untranslated region sequence elements. Mol Biochem
Parasitol 98, 117–129.
42 Yoffe Y, Zuberek J, Lewdorowicz M, Zeira Z, Keasar
C, Orr-Dahan I, Jankowska-Anyszka M, Stepinski J,
Darzynkiewicz E & Shapira M (2004) Cap-binding
activity of an eIF4E homolog from Leishmania. RNA
10, 1764–1775.
43 Chan CC, Dostie J, Diem MD, Feng W, Mann M, Rapp-
silber J & Dreyfuss G (2004) eIF4A3 is a novel compo-
nent of the exon junction complex. RNA 10, 200–209.
44 Ferraiuolo MA, Lee CS, Ler LW, Hsu JL, Costa-Mattioli
M, Luo MJ, Reed R & Sonenberg N (2004) A nuclear
translation-like factor eIF4AIII is recruited to the mRNA
during splicing and functions in nonsense-mediated
decay. Proc Natl Acad Sci USA 101, 4118–4123.
45 Palacios IM, Gatfield D, St Johnston D & Izaurralde E
(2004) An eIF4AIII-containing complex required for
mRNA localization and nonsense-mediated mRNA
decay. Nature 427
, 753–757.

46 Shibuya T, Tange TO, Sonenberg N & Moore MJ
(2004) eIF4AIII binds spliced mRNA in the exon junc-
tion complex and is essential for nonsense-mediated
decay. Nat Struct Mol Biol 11, 346–351.
47 Li Q, Imataka H, Morino S, Rogers GW Jr,
Richter-Cook NJ, Merrick WC & Sonenberg N (1999)
Eukaryotic translation initiation factor 4AIII (eIF4AIII)
is functionally distinct from eIF4AI and eIF4AII. Mol
Cell Biol 19, 7336–7346.
48 Kressler D, de la Cruz J, Rojo M & Linder P (1997)
Fal1p is an essential DEAD-box protein involved in
40S-ribosomal-subunit biogenesis in Saccharomyces
cerevisiae. Mol Cell Biol 17, 7283–7294.
49 Tanner NK, Cordin O, Banroques J, Doere M & Linder
P (2003) The Q motif: a newly identified motif in
DEAD box helicases may regulate ATP binding and
hydrolysis. Mol Cell 11, 127–138.
50 Rozen F, Edery I, Meerovitch K, Dever TE, Merrick
WC & Sonenberg N (1990) Bidirectional RNA helicase
activity of eucaryotic translation initiation factors 4A
and 4F. Mol Cell Biol 10, 1134–1144.
51 Cordin O, Tanner NK, Doere M, Linder P & Banro-
ques J (2004) The newly discovered Q motif of DEAD-
box RNA helicases regulates RNA-binding and helicase
activity. EMBO J 23, 2478–2487.
52 Oberer M, Marintchev A & Wagner G (2005) Structural
basis for the enhancement of eIF4A helicase activity by
eIF4G. Genes Dev 19, 2212–2223.
53 Rogers GW Jr, Richter NJ, Lima WF & Merrick WC
(2001) Modulation of the helicase activity of eIF4A

by eIF4B, eIF4H, and eIF4F. J Biol Chem 276, 30914–
30922.
54 Schmid SR, Buser P, Coppolecchia R, Fischli A &
Linder P (1993) Analysis of the genes encoding eIF-4A
from yeast. In Protein Synthesis and Targeting in Yeast
(Brown AJP, Tuite MF & McCarthy JEG, eds), pp.
131–142. Springer-Verlag, Berlin.
55 Dominguez D, Altmann M, Benz J, Baumann U &
Trachsel H (1999) Interaction of translation initiation
factor eIF4G with eIF4A in the yeast Saccharomyces
cerevisiae. J Biol Chem 274, 26720–26726.
56 Korneeva NL, First EA, Benoit CA & Rhoads RE
(2005) Interaction between the NH2-terminal domain of
eIF4A and the central domain of eIF4G modulates
RNA-stimulated ATPase activity. J Biol Chem 280,
1872–1881.
M. Barhoumi et al. Leishmania LeIF is an eIF4A-like RNA helicase
FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS 5099
57 Rocak S, Emery B, Tanner NK & Linder P (2005)
Characterization of the ATPase and unwinding activities
of the yeast DEAD-box protein Has1p and the analysis
of the roles of the conserved motifs. Nucleic Acids Res
33, 999–1009.
58 Yao N, Hesson T, Cable M, Hong Z, Kwong AD, Le
HV & Weber PC (1997) Structure of the hepatitis C
virus RNA helicase domain. Nat Struct Biol 4, 463–467.
59 Hirling H, Scheffner M, Restle T & Stahl H (1989)
RNA helicase activity associated with the human p68
protein. Nature 339, 562–564.
60 Tsu CA & Uhlenbeck OC (1998) Kinetic analysis of the

RNA-dependent adenosinetriphosphatase activity of
DbpA, an Escherichia coli DEAD protein specific for
23S ribosomal RNA. Biochemistry 37, 16989–16996.
61 Lorsch JR & Herschlag D (1998) The DEAD box pro-
tein eIF4A. 1. A minimal kinetic and thermodynamic
framework reveals coupled binding of RNA and nucleo-
tide. Biochemistry 37, 2180–2193.
62 Nishi K, Morel-Deville F, Hershey JW, Leighton T &
Schnier J (1988) An eIF-4A-like protein is a suppressor
of an Escherichia coli mutant defective in 50S ribosomal
subunit assembly. Nature 336, 496–498.
63 Flores-Rozas H & Hurwitz J (1993) Characterization of
a new RNA helicase from nuclear extracts of HeLa cells
which translocates in the 5¢-to 3¢ direction. J Biol Chem
268, 21372–21383.
64 Fuller-Pace FV, Nicol SM, Reid AD & Lane DP (1993)
DbpA: a DEAD box protein specifically activated by
23s rRNA. EMBO J 12, 3619–3626.
65 Duncan R, Milburn SC & Hershey JW (1987) Regu-
lated phosphorylation and low abundance of HeLa cell
initiation factor eIF-4F suggest a role in translational
control. Heat shock effects on eIF-4F. J Biol Chem 262,
380–388.
66 von der Haar T & McCarthy JE (2002) Intracellular
translation initiation factor levels in Saccharomyces cer-
evisiae and their role in cap-complex function. Mol
Microbiol 46, 531–544.
67 Prat A, Schmid SR, Buser P, Blum S, Trachsel H,
Nielsen PJ & Linder P (1990) Expression of translation
initiation factor 4A from yeast and mouse in Saccharo-

myces cerevisiae. Biochim Biophys Acta 1050, 140–145.
68 Hentze MW (1997) eIF4G: a multipurpose ribosome
adapter? Science 275, 500–501.
69 Ivens AC, Peacock CS, Worthey EA, Murphy L,
Aggarwal G, Berriman M, Sisk E, Rajandream MA,
Adlem E, Aert R et al. (2005) The genome of the kineto-
plastid parasite, Leishmania major. Science 309, 436–442.
70 Mayer MG & Floeter-Winter LM (2005) Pre-mRNA
trans-splicing: from kinetoplastids to mammals, an easy
language for life diversity. Mem Inst Oswaldo Cruz 100,
501–513.
71 Conti E & Izaurralde E (2005) Nonsense-mediated
mRNA decay: molecular insights and mechanistic varia-
tions across species. Curr Opin Cell Biol 17, 316–325.
72 Dhalia R, Marinsek N, Reis CR, Katz R, Muniz JR,
Standart N, Carrington M & de Melo Neto OP (2006)
The two eIF4A helicases in Trypanosoma brucei are
functionally distinct. Nucleic Acids Res 34, 2495–2507.
73 Kamoun-Essghaier S, Guizani I, Strub JM, Van Dors-
selaer A, Mabrouk K, Ouelhazi L & Dellagi K (2005)
Proteomic approach for characterization of immunodo-
minant membrane-associated 30- to 36-kiloDalton frac-
tion antigens of Leishmania infantum promastigotes,
reacting with sera from Mediterranean visceral leishma-
niasis patients. Clin Diagn Lab Immunol 12, 310–320.
74 Nandan D & Reiner NE (2005) Leishmania donovani
engages in regulatory interference by targeting macro-
phage protein tyrosine phosphatase SHP-1. Clin Immu-
nol 114, 266–277.
75 Chang KP & McGwire BS (2002) Molecular determi-

nants and regulation of Leishmania virulence. Kineto-
plastid Biol Dis 1, 1–7.
76 Xia Q, Kong XT, Zhang GA, Hou XJ, Qiang H &
Zhong RQ (2005) Proteomics-based identification of
DEAD-box protein 48 as a novel autoantigen, a pro-
spective serum marker for pancreatic cancer. Biochem
Biophys Res Commun 330, 526–532.
77 Karreman C (1998) Fusion PCR, a one-step variant of
the ‘megaprimer’ method of mutagenesis. Biotechniques
24, 736,740,742.
78 Guthrie C & Fink GR (1991) Guide to Yeast Genetics
and Molecular Biology. In Methods in Enzymology
(Abelson JN & Simon MI, series eds) 194, Academic
Press, San Diego.
Leishmania LeIF is an eIF4A-like RNA helicase M. Barhoumi et al.
5100 FEBS Journal 273 (2006) 5086–5100 ª 2006 The Authors Journal compilation ª 2006 FEBS