Báo cáo khóa học: Metal-binding stoichiometry and selectivity of the copper chaperone CopZ from Enterococcus hirae pot

Metal-binding stoichiometry and selectivity of the copper chaperone
CopZ from
Enterococcus hirae
Agathe Urvoas
1
, Mireille Moutiez
1
, Cle
´
ment Estienne
1
, Joe¨ l Couprie
1
, Elisabeth Mintz
2
and Loı¨c Le Clainche
1
1
De
´
partement d’Inge
´
nierie et d’Etudes des Prote
´
ines, Direction des Sciences du Vivant, CEA Saclay, Gif sur Yvette, France;
2
Laboratoire de Biophysique Mole
´
culaire et Cellulaire, UMR 5090, CFA-CNRS, Universite Joseph Fourier, Direction des
Sciences du Vivant, CEA Grenoble, France
We studied the interaction of several metal ions with the

copper chaperone from Enterococcus hirae (EhCopZ). We
show that the stoichiometry of the protein–metal complex
varies with the experimental conditions used. At high con-
centration of the protein in a noncoordinating buffer, a
dimer, (EhCopZ)
2
–metal, was formed. The presence of a
potentially coordinating molecule L in the solution leads to
the formation of a monomeric ternary complex, EhCopZ–
Cu–L, where L can be a buffer or a coordinating mole-
cule (glutathione, tris(2-carboxyethyl)phosphine). This was
demonstrated in the presence of glutathione by electrospray
ionization MS. The presence of a tyrosine close to the metal-
binding site allowed us to follow the binding of cadmium to
EhCopZ by fluorescence spectroscopy and to determine the
corresponding dissociation constant (K
d
¼ 30 n
M
). Com-
petition experiments were performed with mercury, copper
and cobalt, and the corresponding dissociation constants
were calculated. A high preference for copper was found,
with an upper limit for the dissociation constant of 10
)12
M
.
These results confirm the capacity of EhCopZ to bind cop-
per at very low concentrations in living cells and may provide
new clues in the determination of the mechanism of the

uptake and transport of copper by the chaperone EhCopZ.
Keywords: copper transport; CopZ; metal binding; metal-
lochaperone; selectivity.
Copper is a first-row transition metal, which plays a
fundamental role in living organisms. Although it is
involved in the catalytic active site of several enzymes [1],
its redox properties can also generate highly toxic hydroxy
radicals in cells [2]. Therefore, its intracellular concentration
has to be tightly regulated. Copper chaperones have recently
been reported to be key proteins in the uptake and transport
of copper in cells, and in the transfer of the metal ion
to appropriate partners [3–5]. Many recent studies have
provided data on their biological function, and an increas-
ing number of 3D structures have been resolved for many
members of this family both in the apo and metal-
loaded state (vide infra).
In this study, we focused on the protein CopZ, which
has been reported to be involved in copper homoeostasis
in Enterococcus hirae (hereafter referred to as EhCopZ)
[6,7]. It belongs to the cop operon, which also encodes
two copper ATPases, CopA and CopB, and a repressor
CopY. EhCopZ has been shown to transfer two copper
ions to CopY [8,9], thereby controlling the expression of
the cop operon. The 3D NMR structure of apo EhCopZ
has been resolved [10]. EhCopZ exhibits a ferredoxin-like
fold (babbab) in which the four b-strands and the two
a-helices are connected by loop regions exposed to the
solvent. The metal-binding site is located at the C-terminal
extremity of the first loop and on the first turn of helix a1
(Fig. 1). Its sequence is highly conserved in the family and

consists of a consensus motif MXCXXC. The binding of
the metal ion is mainly accomplished via the two sulfur
atoms of the side chain of the two cysteine residues Cys11
and Cys14. Surprisingly, various stoichiometries have been
reported so far for metal–chaperone complexes (Table 1).
Monomeric compounds have been found in the case of
BsCopZ–Cu (CopZ from Bacillus subtilis) [11] and with
the homologous proteins MerP–Hg [12], Atx1–Cu [13]
and Atx1–Hg [14], whereas dimers have been reported in
the case of EhCopZ–Cu [10] and BsCopZ–Cu [15,16] and
with the homologous protein HAH1 loaded with Cu, Cd
or Hg [17]. Therefore, it would be interesting to determine
the stoichiometry in solution of copper-loaded EhCopZ
as it may offer a molecular basis for the copper-transfer
mechanism from the copper chaperone to the target
protein.
Another relevant question is the selectivity of these
metallochaperones for different metals. As it is well known
that the MXCXXC motif can bind various metals [18], the
determinants of the selectivity of these proteins for a specific
ion remain poorly understood. For example, in vitro studies
have shown that MNKr2, a copper-binding subdomain of
the Menkes ATPase, is able to bind Ag(I) or Cu(I) but
Correspondence to L. Le Clainche, De
´
partement d’Inge
´
nierie et
d’Etudes des Prote
´

ines, Direction des Sciences du Vivant,
CEA Saclay, 91191 Gif sur Yvette Cedex, France.
Fax: + 33 0169089071, Tel.: + 33 0169084215,
E-mail:
Abbreviations: EhCopZ, copper chaperone from Enterococcus hirae;
BsCopZ, copper chaperone from Bacillus subtilis;TCEP,
Tris(2-carboxyethyl)phosphine.
(Received 27 November 2003, revised 15 January 2004,
accepted 19 January 2004)
Eur. J. Biochem. 271, 993–1003 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04001.x
cannot bind a larger ion such as Cd(II), as is the case for the
protein HAH1 [19–21]. However, the metal-binding affinit-
ies of any copper chaperone for metal ions have not been
reported so far. Therefore, a study of the strength of
interaction of EhCopZ with different metals and a com-
parison with other proteins could provide a better under-
standing of this selectivity.
Here we describe a study of the binding of several metal
ions to the protein EhCopZ. The stoichiometry of the metal-
loaded chaperone was found to depend on the experimental
conditions used, especially the concentration of the protein
and the presence of an exogenous coordinating molecule.
The dissociation constants for cadmium, mercury and
cobalt were determined using fluorescence spectroscopy,
and the upper limit of the dissociation constant for copper
was also determined.
Materials and methods
Primer design for the synthetic gene
Ehcopz
Oligonucleotides (60-mer) were designed from the sequence

of the gene Ehcopz (E. hirae copZ) with optimized codons
for Escherichia coli; they were synthesized and purified by
MWG-Biotech. The six oligonucleotides used for the syn-
thetic gene construction were: copz-p1, (5¢-GGGCCGGC
GGCCATGGCTAAACAGGAATTCTCGGTTAAAGG
TATGTCTTGCAAC-3¢); copz-ap2, (5¢-GATACGACC
AACAGCTTCTTCGATACGAGCAACGCAGTGGT
TGCAAGACATACCTTTAAC-3¢); copz-p3, (5¢-GAA
GCTGTTGGTCGTATCTCTGGTGTTAAAAAAGTT
AAAGTTCAGCTGAAGAAAGAAAAG-3¢); copz-ap4,
(5¢-GGTAGCCTGAACGTTAGCTTCGTCGAATTTAA
CAACAGCCTTTTCTTTCTTCAGCTGAAC-3¢); copz-
p5, (5¢-GAAGCTAACGTTCAGGCTACCGAAATCTG
CCAGGCTATCAACGAACTGGGTTACCAGGCT-3¢);
copz-ap6, (5¢-GGGCCGGCGCGGTTAGATCTAAGCT
TAGATAACTTCAGCCTGGTAACCCAGTTCGTT-3¢).
Primers 1, 3 and 5 corresponded to the coding strand,
respectively, for positions1–54, 76–135, 154–213. Primers 2, 4
and 6 corresponded to the complementary strand, respect-
ively, for positions 34–93, 115–174, 193–220 of the coding
strand. Each primer overlapped the following one by 27
bases. Restriction sites for NcoIandBglII were introduced,
respectively, in the N-terminal primer copz-p1 and in the
C-terminal primer copz-ap6.
Fig. 1. 3D NMR structure of apo-EhCopZ (PDB ID: 1CPZ) and Cu(I)-loaded BsCopZ (PDB 10: 1K0V). apo-EhCopZ (right) BsCopZ (left).
Hydrogens have been omitted for clarity, and only one of the multiple structures is represented for both proteins. Selected bond (A
˚
)andangles(°):
S
C13

–Cu 2.16, S
C16
–Cu 2.17, S
C13
–Cu–S
C16
, 115.31.
Table 1. Conditions used and observed stoichiometries for different metal–chaperone complexes. DTT, dithiothreitol, ICP-AES, inductively coupled
plasma-atomic emission spectrometry.
Protein
[Protein]
(l
M
) Metal Buffer used Reducing agent
Stoichiometry
(metal:protein) Analytical method Reference
EhCopZ 5, 10 Cu, Cd Mops No 0.5 Fluorescence, CD, UV This work
EhCopZ 5, 10 Cu, Cd Mops TCEP 1 Fluorescence, CD, UV This work
EhCopz 0.5 Cd, Cu, Co, Hg Mops No 1 Fluorescence This work
EhCopZ 10 Cu Phosphate No 1 UV 9
BsCopZ 2000 Cu Phosphate DTT 0.77 ICP-AES 11
BsCopZ 300 Cu Mops No 0.5 Gel filtration 15
BsCopz 300 Cu Mops DTT 1 Gel filtration 15
MerP 1000 Hg Phosphate No 1 ICP-AES 12
yAtx1 2400 Cu, Hg Phosphate, Mes DTT removed 0.6–0.8 ICP-AES 25
yAtx1 100–400 Cu Tris/Mes
phosphate
No, DTT, GSH 1 ICP-AES 26
HAH1 500–1300 Cu, Cd, Hg Mes No 0.2–0.5 ICP-AES, X-Ray 17
994 A. Urvoas et al.(Eur. J. Biochem. 271) Ó FEBS 2004

Construction of the synthetic gene
Ehcopz
and
expression vector PQE-
cop
The six oligonucleotides were assembled in a first PCR step.
The reaction was carried out in 25 lL, using 3 pmol of each
oligonucleotide, 0.2 m
M
each dNTP, 1· Pfu buffer and
1.75 U Pfu turbo (Stratagene). The assembling PCR was
performed in an MWG-Biotech Primus thermocycler with
the following program: 94 °Cfor60 s;94 °Cfor45s,47°C
for 30 s, 72 °C for 15 s (55 times); and 72 °C for 5 min. The
assembled fragment was amplified by a second PCR step.
The reaction was performed in 25 lL, using 7 pmol of
the N-terminal and C-terminal oligonucleotides (1 and 6),
0.2 m
M
each dNTP, 1· Pfu buffer, 1.75 U Pfu turbo
(Stratagene) and 1 lL of the previous PCR product. The
PCR program was: 94 °C for 60 s; 94 °C for 45 s, 47 °Cfor
30 s, 72 °C for 35 s (30 times); and 72 °Cfor5min.After
analysis of the PCR product on a 1.6% (w/v) agarose gel in
a TAE buffer (40 m
M
Tris, 20 m
M
sodium acetate, 1 m
M

EDTA, pH 8.3), the 220-bp fragment of interest was
digested with NcoIandBglII, purified using a Nucleospin
extraction kit (Macherey Nagel) and ligated into PQE60
(Qiagen) digested with NcoIandBglII. The final construct
PQE-cop was verified by DNA sequencing. E. coli XL1 blue
(Stratagene) was used as the host strain for plasmid
propagation. The expected molecular mass calculated by
MassLynx from this sequence is thus 7592.9 Da. It is in
good agreement with the experimental molecular mass
found of 7592.3 ± 0.6 Da. It should be noted that the
calculated mass of Eh-CopZ in the NCBI database (acces-
sion No. 1361370) is 7521.8 Da. The 71-Da difference
between this value and the experimental mass is due to the
insertion of an N-terminal alanine during the primer design
for the plasmid construction.
Expression and purification of recombinant EhCopZ
E. coli M15 (Qiagen) was used as the host strain for the
expression of EhCopZ. The cells were grown at 37 °Cin
Luria–Bertani medium containing 200 mgÆL
)1
ampicillin
and 25 mgÆL
)1
kanamycin to an absorbance of 0.6 at
600 nm. Protein expression was induced by the addition of
isopropyl b-
D
-thiogalactoside to a final concentration of
200 l
M

, and the cells were further incubated for 4 h. The
cells were harvested, resuspended in 50 m
M
sodium phos-
phate, pH 7.2, containing 5% glycerol, 2 m
M
EDTA, 5 m
M
dithiothreitol, and lysed by Eaton pressure cell. The cell
extract was incubated for 1 h at 4 °Cwith1m
M
phenyl-
methanesulfonyl fluoride, DNase I and RNase. After
filtration on a 0.45-l
M
nitrocellulose membrane, it was
loaded on to a 3 · 10 cm S15 Sepharose fast flow column
(Pharmacia) equilibrated in buffer A (50 m
M
sodium
phosphate, pH 7.2). EhCopZ was eluted with a linear
gradient (0–1
M
) of NaCl in buffer A. The EhCopZ
fractions were pooled and concentrated to less than 5 mL
with an Amicon YM3 membrane, and stored at )20 °C
after the addition of 2 m
M
dithiothreitol. The purity was
checked by SDS/PAGE on 20% (w/v) polyacrylamide

gels after silver staining. Gel filtration was performed to
exchange the buffer before functional characterization of
the protein.
Protein and metal quantification for titration
experiments
Ameane
280
of 2000
M
)1
Æcm
)1
was determined by amino-
acid quantification for EhCopZ in buffer C (20 m
M
Mops, 150 m
M
NaCl, pH 7.2) used for fluorescence
experiments. Protein concentration was then measured
using the UV absorbance at 280 nm for all titration
experiments. All metal solutions were prepared in water
except for Cu(I)Cl which was prepared as a 4 m
M
solution in acetonitrile or 0.1
M
HCl/1
M
NaCl [22].
Tris(2-carboxyethyl)phosphine (TCEP) was prepared in
the buffer used for the titration.

Metal titration by fluorescence
Fluorescence measurements were performed with a Cary
Eclipse spectrofluorimeter (Varian) in a thermostatically
controlled cell holder, using a 1-cm-path-length quartz cell.
All the experiments were carried out under argon. The
spectra were recorded with a bandwidth of 5 nm for both
excitation and emission beams at a scan rate of 250 nmÆ-
min
)1
. Intrinsic protein fluorescence measurements were
recorded at 22 °C between 260 and 400 nm using an
excitation wavelength of 278 nm. The protein was reduced
in 5 m
M
dithiothreitol and desalted by gel filtration on
Superdex 75 (Pharmacia) in buffer C (20 m
M
Mops,
150 m
M
NaCl, pH 7.2) or in the appropriate buffer for
further functional characterization (NaHCO
3
). The fluor-
escence emission spectrum of EhCopZ exhibited a maxi-
mum at 305 nm, which is consistent with its single tyrosine
Tyr63. Typically 500 lLof5l
M
,0.5l
M

or 50 n
M
EhCopZ
in buffer C was titrated with additions of 0.5–1 lLCdCl
2
at
the appropriate concentration. In some experiments, TCEP
was added as a reducing agent. As no effect of CuCl, HgCl
2
or CoCl
2
was detected with direct fluorescence measure-
ments, the titration of these metals was performed by
competition in the presence of Cd. Equilibrium was
established within 2 min of the addition of the metal.
The data corresponding to the titration of EhCopZ with
cadmium were fitted using either the binding isotherm or a
Scatchard plot. In the first case, the isotherm corresponds to
the equilibrium: CopZ + Cd « CopZ–Cd. At equilib-
rium, the law of mass action gives:
K
d
¼ð½CopZ½CdÞ=½CopZÀ Cdð1Þ
The fluorescence intensity of the protein can be written as:
I ¼ I
max
½CopZÀCd=½CopZ
0
ð2Þ
where [CopZ]

0
is the initial protein concentration and I
max
is
maximum intensity corresponding to 100% of the complex
in solution. At equilibrium, the concentrations in solution
can be expressed as:
½CopZ¼½CopZ
0
À½CopZÀCd;
½Cd¼½Cd
i
À½CopZÀCd
ð3Þ
where [Cd]
i
is the concentration of added cadmium in
solution. Inserting Eqn (3) into Eqn (1) leads to the
equation:
Ó FEBS 2004 EhCopZ metal binding and selectivity (Eur. J. Biochem. 271) 995
½CopZÀCd
2
Àð½CopZ
0
þ½Cd
i
þ K
d
Þ½CopZÀCd
þ½CopZ

0
½Cd
i
¼ 0
which can be combined with Eqn (2) to give:
I ¼ð1=2½CopZ
0
ÞI
max
 ðð½CopZ
0
þ½Cd
i
þ K
d
Þ
À fð½CopZ
0
þ½Cd
i
þ K
d
Þ
2
À 4½CopZ
0
½Cd
i
g
1=2

Þ
A Scatchard plot is obtained by calculating the free and
bound cadmium concentration at equilibrium with the
following expressions:
½Cd
free
¼½Cd
I
À½CopZ
0
ÂðI À I
0
Þ=ðI
max
À I
0
Þ;
½Cd
bound
¼½CopZ
0
ÂðI À I
0
Þ=ðI
max
À I
0
Þ
where I
0

and I
max
are, respectively, the initial and maximal
fluorescence intensities.
CD spectroscopy measurements
CD measurements of EhCopZ were recorded on a JS 810
spectropolarimeter (Jasco). The scans were recorded using a
bandwidth of 2 nm and an integration time of 1 s at a scan
rate of 100 nmÆmin
)1
. For near-UV measurements between
250 nm and 310 nm, a 1-cm-path-length quartz cell con-
taining 2 mL protein sample was used. A total of 20 scans
were recorded and averaged for each sample. All resultant
spectra were baseline subtracted. Aliquots of volume
200 lL of these protein sample solutions were used for
far-UV measurements between 190 nm and 250 nm in a
1-mm-path-length quartz cell. A total of 10 scans were
recorded and averaged for each sample.
Protein samples of concentration 20 l
M
were prepared in
an anaerobic atmosphere in 40 m
M
Mops/10 m
M
NaCl,
pH 7.0. CD spectra were recorded after each addition of
1 lL metal aliquots. The total volume added to the 2 mL-
buffered protein solution was less than 20 lLofthemetal

stock solution. The titration experiment was performed
under argon. The pH and ionic strength of the reaction
mixture remained unchanged throughout the titration.
UV-vis absorption spectra
UV-vis absorption spectra were recorded on a Lambda 35
spectrophotometer (Perkin–Elmer) using a 1-cm-path-
length quartz cell. Protein samples of 10 l
M
or 20 l
M
apo-EhCopZ were prepared in buffer C. Optical spectra
were recorded from 190 to 700 nm after each TCEP, GSH
or metal addition. Corrected spectra were obtained after
baseline subtraction.
Sample preparation for electrospray ionization (ESI)-MS
analysis
For functional ESI-MS analysis under nondenaturing
conditions, the protein samples were thawed on ice, reduced
with 5 m
M
dithiothreitolanddesaltedbygelfiltrationona
Superdex 75 column (Pharmacia) equilibrated in freshly
prepared 20 m
M
NH
4
HCO
3
, pH 8.0. The fractions collec-
ted were freeze-dried and stored under argon at 4 °Cbefore

use. The protein was suspended in MS buffer (4 m
M
NH
4
HCO
3
, pH 8.0), centrifuged (7200 g) and quantified.
For the functional ESI-MS study, the samples were
prepared as 50 lL aliquots of 15 l
M
EhCopZ in 4 m
M
NH
4
HCO
3
(pH 8.0)/15% methanol with the appropriate
metal or GSH concentrations.
ESI-MS measurements
ESI mass spectra were acquired using a Micromass
Q-TOFII instrument under control of the MassLynx 3.5
data acquisition and analysis software (Micromass Ltd,
Manchester, UK). The MS buffer was used as the
electrospray carrier solvent. Samples were introduced into
the ion source at a flow rate of 10 lLÆmin
)1
,andmass
spectra were acquired from m/z 400–2200 in positive
ionization mode with a scan time of 5 s. External calibration
of the mass scale was performed with horse heart myoglobin

(Sigma). The spectra were analyzed with
MASSLYNX
3.5.
Light-scattering measurements
Dynamic light-scattering data were obtained with the
DynaPro-801 instrument (Protein Solutions Inc, High
Wycombe, Bucks, UK) using a 30 mW, 833 nm wave-
length argon laser at 22 °C and equipped with a solid-state
avalanche photodiode. During illumination, the photons
scattered by proteins were collected at 90 °Cona10s
acquisition time and were fitted with the analysis software,
DYNAMICS
. Intensity fluctuations of the scattered light
resulting from Brownian motion of particles were analyzed
with an autocorrelator to fit an exponential decay function
and then measuring a translational diffusion coefficient D.
For polydisperse particles, the autocorrelation function was
fitted as the sum of contributions from the various size
particles using the regularization analysis algorithm. D is
converted into a hydrodynamic radius R through the
Stokes–Einstein equation (R ¼ k
B
T/6pgD where g repre-
sents the solvent viscosity, k
B
the Boltzmann constant, and
T the temperature). R is defined as the radius of a
hypothetical hard sphere that diffuses with the same speed
as the particle under examination. However, the particle
may be nonspherical and solvated. Therefore, the molecular

mass M of a macromolecule is estimated using M vs. R
calibration curves developed from standards of known
molecular mass and size. Thus, the estimated mass of a
given particle is subjected to error if it deviates from the
shape and solvation of the molecules used as standards
(globular proteins). The molecular mass for a protein is
estimated from the curve that fits the equation
M ¼ (1.68 · R)
2.3398
as implemented in the
DYNAPRO
software.
Results
The analysis of the 3D structure of EhCopZ shows that
Cys11 and Cys14 were at 5.73 A
˚
Ca–Ca distance. This
value is within the range of the average Ca–Ca distance of
bridged cysteine residues generally found in proteins [23].
The spatial proximity between the two cysteine residues
could make the protein very sensitive to oxidation. While
these two residues are involved in the metal-binding site, it is
crucial that the protein remains reduced throughout the
experiment. A control experiment was performed under
996 A. Urvoas et al.(Eur. J. Biochem. 271) Ó FEBS 2004
conditions favorable to oxidation: an apoprotein sample
was left under aerobic conditions for 2 h and the free-thiol
quantification using Ellman’s reagent showed that less than
8% of the protein was oxidized. Consequently, all the
experiments described hereafter were performed within 2 h

under argon to further minimize CopZ oxidation.
Interaction between copper and EhCopZ
In a first set of experiments the binding of copper to the
chaperone was studied using CD and UV-vis spectroscopy.
To a 20 l
M
solution of apo-EhCopZ in 40 m
M
Mops/
10 m
M
NaCl, pH 7, were added aliquots of a solution of
Cu(I), stabilized using 0.1
M
HCl, under anaerobic condi-
tions [22]. The far-UV region of the CD spectrum displayed
no significant modification on the addition of the metal,
indicating that the global fold of the protein was preserved
throughout the titration. The dichroic signal at 265 nm
increased with the concentration of copper, as could be
expected with a change in the hydrophobicity of the local
environment of Tyr63 and/or a contribution of the binding
of the copper to the thiolates of the protein. A plot of the
intensity of the signal at 265 nm against the concentration
of added copper showed that a plateau was reached when
0.5 equivalents of copper had been added, compatible with
a 2 : 1 EhCopZ–Cu complex (Fig. 2). The UV-vis spectrum
of the reaction mixture in the presence of the metal ion
exhibited strong absorption at 260 nm compatible with a
metal to ligand charge transfer band (data not shown). The

intensity of this band increased with the concentration of
added copper in solution, and the plot of A
260
vs. concen-
tration of copper indicated in this case also a 2 : 1 EhCopZ/
Cu ratio.
This result is in contrast with the 1 : 1 stoichiometry
reported for a similar UV-vis experiment described previ-
ously [9]. Several hypotheses were explored to explain this
difference. As mentioned above, experiments were per-
formed under conditions in which the oxidation of EhCopZ
is not significant. Partial oxidation of the protein can
thereforebeexcludedtoexplainthe2:1proteintometal
stoichiometry.
Although precautions were taken to avoid any oxidation
of the metal, a change in the oxidation state of the metal
may be responsible for this unexpected stoichiometry. The
CD experiment described above with Cu(I) was therefore
repeated with Cu(II) in order to study the influence of the
oxidation state of copper on the complex stoichiometry. The
spectra showed an increase in the signal of the tyrosine at
265 nm with increasing concentrations of copper up to a
plateau reached for 0.5 molar equivalents of Cu(II) added
per protein. A similar experiment was described by Kihlken
et al. [15] with BsCopZ. It was shown that Cu(II) was
reduced to Cu(I) on coordination to the protein. A similar
process cannot be excluded in our case. However, no
difference in stoichiometry in the complex was detected
using either Cu(I) or Cu(II). SDS/PAGE analysis of
EhCopZ was performed under nondenaturing conditions

for the protein in the presence of increasing copper
equivalents. A band corresponding to the molecular mass
expected for a dimer appeared in the presence of the metal,
confirming the dimeric nature of the EhCopZ–Cu (Fig. 3).
Lastly, in previous studies [11,15,24–26], reducing mole-
cules such as dithiothreitol or TCEP were added in the
solution of copper chaperone to prevent the formation
of the disulfide bridge. The interaction of such a small
organic molecule present in the solution with the metal
center could greatly influence the stoichiometry by changing
the form of the complex. As these compounds can compete
with the protein to bind the metal ion, their influence on the
stoichiometry of the complex EhCopZ–metal was studied.
Cadmium was substituted for copper to avoid any redox
reaction involving the metal ion. Although Cd(II) is not a
usual substitute for Cu(I), the available 3D structures of a
homologous protein, HAH1, show that the copper-loaded
and cadmium-loaded structures of the chaperone are very
similar (PDB ID: 1FEE and 1FE0, respectively [17]).
Moreover, the single tyrosine Tyr63 located on loop 5
at the beginning of the last strand b4 is close to the
Fig. 2. CD titration of EhCopZ against Cu(I). CD spectra of EhCopZ
(20 l
M
;40m
M
Mops/10 m
M
NaCl, pH 7) in the presence of Cu(I)
(from top to bottom) at 0, 2, 4, 6, 8, 10, 12, 16, 20 l

M
. The insert shows
the plot of the intensity of the dichroic signal at 265 nm vs. the con-
centration of introduced copper.
Fig. 3. SDS/PAGE analysis of the protein EhCopZ in the presence of
various concentrations of copper. Left lane, MultiMarkÒ Multi-
Colored standard (Invitrogen); lane 1, apo-EhCopZ; lane 2, in the
presence of 1 equivalents CuCl
2
; lane 3, in the presence of 4 equiva-
lents CuCl
2
. Experiments were performed with a solution of 25 l
M
EhCopZ in 20 m
M
Mops/150 m
M
NaCl,pH 7.2.The6· sample buffer
was:glycerol50%,BromophenolBlue0.5%,MopspH7.Samples
containing 3 lg protein were loaded on a 4–12% NuPAGEÒ Bis/Tris
gel (Invitrogen). The electrophoresis was performed with a Mes run-
ning buffer (Invitrogen).
Ó FEBS 2004 EhCopZ metal binding and selectivity (Eur. J. Biochem. 271) 997
metal-binding cysteine Cys14 (distance OH
Tyr63
–S
c
Cys14
¼

3.6 A
˚
). Preliminary experiments showed that excitation of a
solution of EhCopZ at k
excit
¼ 278 nm led to a maximum
in the fluorescence emission at 305 nm, which increased on
addition of Cd(II) whereas no change was detected on
addition of copper. Therefore, the fluorescence of Tyr63
was used as a probe to monitor the binding of metal ions to
the protein.
Study of the binding of Cd(II) to EhCopZ by fluorescence
spectroscopy, dynamic light scattering and ESI-MS
spectroscopy
In the first experiment, a spectrofluorimetric titration of
EhCopZ (5 l
M
solution in 20 m
M
Mops/150 m
M
NaCl,
pH 7.2) against an aqueous acidic solution of Cd(II) was
performed at room temperature. With a 278 nm excitation
wavelength, the emitted fluorescence of the tyrosine in
position 63 was observed. Its intensity was found to increase
on addition of the metal up to a limit corresponding to
0.5 ± 0.1 equivalents cadmium added (Fig. 4). The change
in the intensity of the tyrosine fluorescence may be
attributed to the formation of a dimer in solution, as was

the case with copper. To test the hypothesis of potentially
coordinating exogenous ligands, a similar experiment was
carried out in the presence of 5 molar equivalents TCEP,
and the plateau was reached when 0.9 ± 0.1 equivalents
Cd were added (Fig. 4). TCEP is often used as a reducing
agent instead of dithiothreitol, and bears three carboxylate
functions instead of thiols. If the change in the stoichiometry
is due to the coordination of a molecule of TCEP to the
metal ion via the phosphorous atom [26] or a carboxylate
function [27], the use of a potentially coordinating buffer
should provide the same result. Therefore, the Mops buffer
was replaced by a sodium hydrogenocarbonate buffer. The
carbonate function is well known as a coordinating group
for which a great number of binding modes have been
described [28]. In contrast, the sulfonate function of Mops is
known as a poor ligand for transition metals and has
recently been described as noncoordinating for copper [29].
The corresponding fluorimetric titration of EhCopZ (5 l
M
in 20 m
M
NaHCO
3
/150 m
M
NaCl, pH 7.2) was achieved in
the absence of TCEP, and a 1 : 1 stoichiometry was also
found in this case (Fig. 4).
To confirm the nature of the oligomeric EhCopZ–Cd
complex, dynamic light-scattering experiments were carried

out on EhCopZ/cadmium solutions in the absence and
presence of TCEP. Apparent molecular masses were found
to be 13.6 ± 2 kDa (hydrodynamic radius R ¼ 18.5 ±
0.9 A
˚
) in the case of the apoprotein in the absence and
presence of 5 molar equivalents TCEP. On addition of
cadmium to apo-EhCopZ, the apparent molecular mass
increased to 23.7 ± 2.5 kDa (R ¼ 23.4±1.1A
˚
). This
increase is in the range that could be expected from
dimerization and consistent with the results obtained by
Wimmer et al. [10] for the complex EhCopZ–Cu. When
cadmium was added to apo-EhCopZ in the presence of
TCEP, the apparent molecular mass was 16.5 ± 2 kDa
(R ¼ 20.0 ± 1.1 A
˚
) close to the value obtained for the
apoprotein and hence consistent with the formation of a
monomeric complex in these conditions.
Complementary studies of the interaction between
EhCopZ and metal ions were performed using MS. High-
quality ESI mass spectra of proteins can be obtained in a
4m
M
ammonium carbonate buffer, pH 8.0, in the presence
of 15% (v/v) methanol [30]. In these conditions, EhCopZ
retains its structure (CD data not shown) and is desorbed
in the gas phase as multiply charged ions corresponding

predominantly to the charge states +5 and +6. This charge
distribution indicates a folded protein with fewer basic
residues available for protonation [31]. The protein was
incubated in the presence of increasing concentrations of
cadmium, copper, mercury and cobalt, and a set of spectra
were recorded for each metal ion. In each case, the spectrum
displayed peaks with charge states of +5 and +6, only
compatible with a 1 : 1 monomeric EhCopZ–metal com-
plex (Fig. 5) [32]. Taken together, these results are compat-
Fig. 4. Fluorimetric titration of EhCopZ against Cd(II) in the presence
and the absence of TCEP. Normalized fluorescence intensities at
305 nm of EhCopZ (5 l
M
) with increasing concentrations of Cd(II) in
20 m
M
Mops/150 m
M
NaCl,pH7,intheabsenceofTCEP(d), in
20 m
M
Mops/150 m
M
NaCl, pH 7, in the presence of 25 l
M
TCEP
(m)andin20m
M
NaHCO
3

/150 m
M
NaCl,pH7,intheabsenceof
TCEP (j).
Fig. 5. MS of the EhCopZ–metal complexes. ESI-MS spectra of 15 l
M
EhCopZ in 4 m
M
NH
4
HCO
3
(pH 8.0)/15% methanol in the pre-
sence of 0.75 equivalents (11.25 l
M
) metal ions. (A) Apo-EhCopZ;
(B) Cu(I)Cl; (C) Hg(II)Cl
2
; (D) Cd(II)Cl
2
; (E) Co(II)Cl
2
.
998 A. Urvoas et al.(Eur. J. Biochem. 271) Ó FEBS 2004
ible with the formation of ternary complexes corresponding
to the formula EhCopZ–Cd–L where L is an exogenous
coordinating molecule (dithiothreitol, TCEP, buffer anion).
On dilution of the reaction mixture in the absence of
TCEP, the monomer/dimer equilibrium is expected to be
displaced in favor of the monomeric species. The titration of

a0.5l
M
solution of EhCopZ in 20 m
M
Mops/150 m
M
NaCl, pH 7.2, by a solution of Cd(II) led indeed to the
detection of a 1 : 1 EhCopZ to Cd stoichiometry. A fit of
the data by the binding isotherm led to a dissociation
constant of 65 n
M
. To ensure that the monomer/dimer
equilibrium is displaced to close to 100% monomer in
solution, the concentration of the protein was decreased by
another order of magnitude. Therefore, a new titration was
carried out using a 50 n
M
protein solution. A Hill plot
yielded a straight line with a slope n ¼ 1.05 confirming the
formation of an adduct with a 1 : 1 stoichiometry. The
corresponding Scatchard plot led to a dissociation constant
of K
d
¼ 30 ± 5 n
M
(Fig. 6).
Interaction of EhCopZ with Co, Hg, Cu and determination
of the apparent dissociation constants
Of the metal ions tested, a change in fluorescence intensity
of Tyr63 was only detected with Cd(II). Therefore compe-

tition experiments were run to determine the dissociation
constants of the metal–protein complexes with cobalt,
mercury and copper. In a typical experiment, the mono-
meric EhCopZ–Cd complex was formed (0.5 l
M
protein in
20 m
M
Mops/150 m
M
NaCl, pH 7.2) before the addition of
the competing metal M. The concentration range of the
protein was increased to 500 n
M
in order to have nearly
100% of the EhCopZ–Cd complex with the minimum
amount of cadmium (‡ 1.5 equivalents vs. protein). The
decrease in the fluorescence intensity of the cadmium
complex was followed, and the dissociation constants were
determined at half fluorescence intensity.
In each case, the following reaction takes place in the
solution:
Cop ZÀCd þ M $ CopZÀM þ Cd(II)
The corresponding reaction constant is:
K
R
¼ K
d
ðCdÞ=K
d

ðMÞ
¼ð½EhCopZÀM½Cd(II)Þ=ð½EhCopZÀCd½MÞ
Starting from an initial intensity I
0
and an initial protein
concentration C
0
, the concentrations of the compounds
present in solution can be determined at I
0
) [(I
0
) I
min
)/2],
where I
min
is the intensity at high [M]. At this point, the
concentrations of free species in solution are:
½EhCopZÀCd¼C
0
=2; ½M¼C
0
ðN
M
À 0:5Þ;
½Cd¼C
0
ðN
Cd

À 0:5Þ; ½EhCopZÀCd¼C
0
=2
A new form of the reaction constant can be written as
follows:
K
d
½M¼K
d
ðCdÞ
ðN
M
À 0:5Þ
ðN
Cd
À 0:5Þ
in which N
M
is the number of equivalents of the competing
metal M introduced at I ¼ I
0
) [(I
0
) I
min
)/2], and N
Cd
is the number of equivalents of cadmium in solution. This
concentration of cadmium in solution is chosen as a
function of the affinity of the competing metal for EhCopZ

to obtain a value for N
M
different from 0.5 equivalents
(Table 2). The competition curves obtained for Hg are
shown in Fig. 7. The dissociation constant for mercury was
K
d
(Hg) ¼ 2±0.5n
M
. In the case of cobalt, no significant
change in the intensity of the tyrosine was detected up to
500 molar equiv. cobalt added. As EhCopZ precipitates at
higher cobalt concentrations, the dissociation constant
could therefore be estimated to be greater than 15 l
M
.This
is in good agreement with the value of K
d
¼ 20 l
M
obtained from ESI-MS titration previously described [32].
In the case of copper, the affinity appeared to be so high that
the value found for N
Cu
(0.52) in the presence of 1000
equivalents of cadmium was still very close to 0.5 equiv. and
could only lead to an estimation of a maximum value of
the dissociation constant for copper of 10
)12
M

.Ahigher
initial concentration of cadmium led to precipitation of the
protein.
The fact that copper binds to the protein with higher
affinity than cobalt or cadmium could be predicted from
thermodynamic data. However, it was more surprising that
mercury had a weaker affinity than copper. A confirmation
Fig. 6. Fluorimetric titration of EhCopZ with Cd(II) at low concentra-
tion. Fluorescence spectra of EhCopZ (50 n
M
in 20 m
M
Mops/150 m
M
NaCl, pH 7.2; k
excit
¼ 278 nm) in the presence of increasing concen-
trations of Cd(II) ions (from bottom to top: 0, 10, 20, 30, 40, 50, 75,
100, 150, 200, 400 n
M
). The insert shows the corresponding Scatchard
plot.
Table 2. Dissociation constants between metal ions and CopZ. The K
d
values were calculated at half-intensity using competition fluorescence
experiments between cadmium and other metal ions. For each
experiment, the concentration of the protein CopZ was 0.5 l
M
. N
M

is
the amount of competing metal at half-intensity.
Competing
metal ion
[Cd(II]
(l
M
) N
M
Estimated K
d
Hg(II) 2.5 0.8 2 ± 0.5 n
M
Co(II) 0.75 >500 >15 l
M
Cu(I) 500 0.52 £ 10
)12
M
Ó FEBS 2004 EhCopZ metal binding and selectivity (Eur. J. Biochem. 271) 999
of this result was obtained using ESI-MS competition
experiments. As it reported previously [32] cadmium can
easily be displaced by copper and mercury but not by
cobalt. Moreover, mercury can be displaced by copper
leading to the order of affinity Cu > Hg > Cd > Co
which is the same as we obtained in the fluorescence
experiments.
The coordination of an exogenous thiol to the EhCopZ–
Cu complex was also studied by ESI-MS. Given the high
concentration of glutathione in cells [33] and its ability to
bind Cu(I) [34], it is a good candidate to act as the third ligand

for the Cu(I) ion in the complex. The ESI-MS experiments
were carried out in the ammonium carbonate buffer (15 l
M
EhCopZ, pH ¼ 8). The spectrum of apo-EhCopZ exhibits
apeakatm/z ¼ 1519.2 corresponding to the +5 charged
state of EhCopZ which shifts to m/z ¼ 1531.9 on addition of
a stoichiometric amount of Cu(I). Subsequent addition of
aliquots of glutathione to the reaction mixture led to the
appearance of a new peak at m/z ¼ 1593.7 compatible with
the formation of a ternary adduct of formula EhCopZ–Cu–
GSH. Moreover, a mixture of Cu(I) with 2 molar equiv.
glutathione exhibits a spectrum with peaks at m/z ¼ 613.1,
674.0 and 676.0 which correspond, respectively, to the
oxidized glutathione dimer (GS)
2
and to both isotopes of
the oxidized copper complex Cu(I)(GS)
2
. On addition of
1 equivalents EhCopZ in this solution, the peak at 674.0
disappears and new peaks at m/z ¼ 308.4, 1531.8 and 1592.9
are detected, corresponding, respectively, to free glutathione,
EhCopZ–Cu and EhCopZ–Cu–GSH.
Discussion
Our understanding of copper trafficking within the cell
took a great step forward with the discovery of
metallochaperones. In the presence of an extremely low
free copper concentration in cells under normal growth
concentration ([Cu]
free

<10
)17
M
), copper chaperones
have been shown to be key partners in the delivery of the
metal ion to their target proteins [35]. These proteins have
been studied extensively over the past few years. However,
several characteristics remain to be determined. Among
these is the metal-loaded form of the chaperone in vivo
which is a key element to further understanding the
mechanism of the metal transfer from a metallochaperone
to its target protein. Another point of interest is the
selectivity of the chaperone for one type of metal ion. We
here present results from in vitro experiments in these two
fields of interest using the protein EhCopZ.
Our experiments show that, of the metals tested, EhCopZ
has a high preference for copper; the following order of
affinity was found: Cu(I) ) Hg(II) > Cd(II) ) Co(II).
These results can be compared with those reported for the
homologous protein MerP from CD analysis [36]. MerP
shares the same consensus binding motif and a similar 3D
structure. The higher affinity was found for Hg with a
dissociation constant of 2.8 l
M
, and similar affinities were
reported for Cu and Cd (respectively 5 and 20 l
M
). The
striking difference between these values and our results on
EhCopZ may be due to the experimental conditions used by

Veglia et al. [36]. All the measurements were made in the
presence of 100 l
M
dithiothreitol, which can compete for
the metal ions [37]. Surprisingly, whereas the metal-binding
affinities of MerP follow the order found for inorganic
thiolates (Hg > Cu > Cd > Co), this is not true for
EhCopZ. As these two proteins share the same structural
binding motif C-X-X-C (first co-ordination sphere), our
results suggest that the molecular determinants for the
preference for copper may lie in the second co-ordination
sphere of the metal. The presence of different amino-acid
side chains near the metal-binding site may play a major role
in the discrimination between metal ions, as it would be a
source of different local electrostatic properties. In parti-
cular, several basic residues lie close to the metal-binding site
of CopZ whereas there are none in this area in the 3D
structure of MerP. As Hg(II) and Cu(I) differ by one charge,
a small difference in the electrostatic potential generated by
the nearby residues could generate a significant change in
the affinity for the two ions. The molecular mechanism by
which these different residues discriminate among metals
requires further experiments, which are in progress in our
laboratory.
So far, metallochaperones have been reported to bind
Cu(I) in different types of complex: monomers (protein–
Cu), in which the copper ion is either two or three
coordinated [11–14]; dimers, in which the metal ion is
coordinated by the four cysteine residues of two protein
molecules [15,17]. In this study we show that two distinct

types of complex can be stabilized in solution, and that they
are highly sensitive to the experimental conditions used.
In the experiments performed in the absence of any
coordinating molecule and at high concentration of protein
(> 10
)6
M
), the titration curves showed a saturation at
0.5 equiv. metal added per protein monomer. Along with
the change in intensity of the fluorescence of Tyr63 in the
presence of cadmium and dynamic light-scattering analysis,
these observations are consistent with the formation in this
case of a homodimer. Such a ÔsandwichÕ complex has been
reported in the crystal structure of the homologous protein
Fig. 7. Binding competition experiment between Cd(II) and Hg(II) to
EhCopZ. Fluorescence spectra of a mixture of EhCopZ (0.5 l
M
in
20 m
M
Mops/150 m
M
NaCl, pH 7.2; k
excit
¼ 278 nm) and 2.5 l
M
CdCl
2
in the presence of increasing concentrations of Hg(II) ions (from
top to bottom: 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 1, 1.2, 1.5, 2,

2.5 l
M
). The insert shows the plot of the emission of fluorescence at
305 nm vs. the concentration of added Hg(II).
1000 A. Urvoas et al.(Eur. J. Biochem. 271) Ó FEBS 2004
HAH1 loaded with Cd, Cu or Hg [17]. In contrast, a recent
study has reported the formation of a monomeric complex
between BsCopZ and its metal cargo in the presence of the
reducing agent dithiothreitol [15]. To avoid any competi-
tion between the thiols of the protein and the thiol of
dithiothreitol, we chose to use TCEP as the reducing agent.
In its presence, the titration curves showed saturation at
1 equiv. metal per protein corresponding to a monomeric
protein complex, as shown by dynamic light-scattering
experiments. These data suggest a probable interaction of
such an exogenous molecule with the metal center which
would therefore be coordinated by the thiols of Cys11 and
Cys14 and by the phosphine of TCEP, as recently shown in
the case of the homologous protein HAH1 [26]. The
presence of a third ligand on the metal ion is also in agree-
ment with the X-ray absorption fine structure (EXAFS)
experiments recently reported by Cobine et al.[9],who
showed that the copper ion is coordinated in a trigonal
geometry by three atoms with an average distance of
2.241 A
˚
. Moreover, the substitution of Mops buffer by a
more coordinating buffer molecule such as carbonate also
led to the formation of a monomeric species. Banci et al.
[38] have recently described an effect of the buffer on the

coordinating geometry of a copper ion in a copper
chaperone complex. Our results are in agreement with a
complex in which the buffer molecule acts as a weak and
labile ligand for the metallic center. When the protein
concentration is lowered to 500 n
M
or less, the protein to
metal stoichiometry is always 1 : 1. In this case, the copper
ion may be bis-coordinated to the two sulfur atoms of the
cysteine residues in a linear geometry. It may also be three-
coordinated in a trigonal planar geometry, a water molecule
completing the coordination sphere as a weak and labile
ligand. This hypothesis is in good agreement with the 3D
structures obtained for the copper complex of BsCopZ in
the presence of dithiothreitol [11] and for the copper
complex of the homologous protein Atx1 [13]. In these
complexes, EXAFS studies have shown that the Cu(I) lies in
a trigonal geometry [24,38]. In the 3D structure of Atx1-Cu,
the Cu(I) is coordinated to the two thiols of the cysteine
residues with an S
c
Cys15
–Cu–S
c
Cys18
of 120°. This angle is what
would be expected for a perfect plane trigonal geometry of a
three-coordinated copper with a buffer or solvent molecule
as the third ligand.
In yeast cells, the concentration of free copper is very low

(<10
)17
M
), and the concentration of the chaperone is
thought to range from 0.1 to 1 l
M
[2]. Assuming that this
copper concentration is similar in other cells and that there
is also a high concentration of free thiol, a EhCopZ–Cu–SG
ternary complex could be the species present in vivo. Indeed,
the ESI-MS results show the ability of the copper chaperone
to extract copper from a Cu(GS)
2
complex which could be
formed in cells and demonstrate the formation of such a
ternary complex with glutathione. The origin of the metal
supply to a chaperone is a question of great interest. A
recent study on the copper chaperone Atx1 from Synecho-
cystis PCC 6803 has shown that Atx1 acquires copper from
another protein CtaA, but can also scavenge the metal from
other sources [39]. Such a Cu(GS)
2
complex could be one of
these sources.
Taken together, these results suggest a mechanism for the
transfer of copper to the protein CopY. In the presence of
glutathione, EhCopZ may form a ternary complex with
copper of formula EhCopZ–Cu–GSH. Transfer of the
metal ion to CopY would then probably be achieved via a
multiple ligand exchange with the cysteine residues of CopY

helped by the geometry of the CopY active site and its
higher affinity for copper, as proposed recently [9,40].
The very high affinities of EhCopZ, and consequently
CopY, for copper are consistent with the recent studies of
cadmium-regulatory and zinc-regulatory proteins (CadC
[41],SmtB[42]andZntR[43]).Indeed,inthepresenceofa
cellular overcapacity for binding of transition metals, high
affinities for such metal-regulatory proteins appear to be
critical for specific trafficking pathways in vivo [35].
Conclusion
We have here described a study of the binding of several
metal ions to the metallochaperone EhCopZ. In the
presence of a metal ion, EhCopZ is able to form
monomeric or dimeric compounds, and we have shown
that the experimental conditions can be controlled to
obtain either one form or the other. Under physiological
conditions, the presence of potentially coordinating mole-
cules probably leads to the formation of a monomeric
ternary copper complex, EhCopZ–Cu–L. L is an exogen-
ous molecule that may be glutathione or a phosphate or
carbonate ion. The dissociation constant found for the
protein–copper complex shows that the protein has a very
high affinity for copper and may take up its copper ion
from a potential intracellular Cu(GS)
2
species. These
results suggest the possibility that, in vivo,thetransferof
copper from EhCopZ to the target protein CopY could be
achieved through a multiple ligand exchange mechanism
between the glutathione molecule and the cysteine residues

of the two proteins involved. A comparison between
EhCopZ and MerP suggests that the determinants for the
metal-binding selectivity do not reside only in the struc-
tural binding motif, but the environment surrounding the
metal-binding site has to be taken into account. We are
currently extending this study to other metallochaperones
to identify further molecular determinants of this metal-
binding selectivity.
Acknowledgements
This work was supported by the Commissariat a
`
l’Energie Atomique
(CEA),whichprovidedaPh.D.fellowshiptoA.U.Wewouldliketo
thank Dr V. Forge for giving us access to the spectropolarimeter and
for helpful discussions, Dr S. Bressane for giving us access to light-
scattering facilities, Dr B. Amekraz and Dr C. Moulin for giving us
access to the Q-TOF mass spectrometer, Dr F. Rollin-Genetet for
invaluable advice, and Professor A. Me
´
nez, Dr R. Sto
¨
cklin and Dr
E. Que
´
me
´
neur for continuous support.
References
1. Holm, R.H., Kennepohl, P. & Solomon, E.I. (1996) Reviews of
Bioinorganic enzymology. Chem. Rev. 96, 2237–3042.

2. Lippard, S.J. (1999) Free copper ions in the cell? Science 284,748–
749.
3. Harrison, M.D., Jones, C.E., Solioz, M. & Dameron, C.T. (2000)
Intracellular copper routing: the role of copper chaperones. Trends
Biochem. Sci. 25, 29–32.
Ó FEBS 2004 EhCopZ metal binding and selectivity (Eur. J. Biochem. 271) 1001
4. O’Halloran, T.V. & Culotta, V.C. (2000) Metallochaperones, an
intracellular shuttle service for metal ions. J. Biol. Chem. 275,
25057–25060.
5. Rosenzweig, A.C. (2001) Copper delivery by metallochaperone
proteins. Acc. Chem. Res. 34, 119–128.
6. Lu, Z.H., Cobine, P., Dameron, C.T. & Solioz, M. (1999) How
cells handle copper: a view from microbes. J. Trace Elem. Exp.
Med. 347–360.
7. Wunderli, YeH. & Solioz, M. (1999) Copper homeostasis in
Enterococcus hirae. Adv. Exp. Med. Biol. 448, 255–264.
8. Cobine, P., Wickramasinghe, W.A., Harrison, M.D., Weber, T.,
Solioz, M. & Dameron, C.T. (1999) The Enterococcus hirae copper
chaperone CopZ delivers copper (I) to the CopY repressor. FEBS
Lett. 445, 27–30.
9. Cobine, P.A., George, G.N., Jones, C.E., Wickramasinghe, W.A.,
Solioz, M. & Dameron, C.T. (2002) Copper transfer from the
Cu(I) chaperone, CopZ, to the repressor, Zn(II) CopY: metal
coordination environments and protein interactions. Biochemistry
41, 5822–5829.
10. Wimmer, R., Herrmann, T., Solioz, M. & Wuthrich, K. (1999)
NMR structure and metal interactions of the CopZ copper cha-
perone. J. Biol. Chem. 274, 22597–22603.
11. Banci, L., Bertini, I., Del Conte, R., Markey, J. & Ruiz-Duenas,
F.J. (2001) Copper trafficking: the solution structure of Bacillus

subtilis CopZ. Biochemistry 40, 15660–15668.
12. Steele, R.A. & Opella, S.J. (1997) Structures of the reduced and
mercury-bound forms of MerP, the periplasmic protein from the
bacterial mercury detoxification system. Biochemistry 36, 6885–
6895.
13. Arnesano, F., Banci, L., Bertini, I., Huffman, D.L. & O’Halloran,
T.V. (2001) Solution structure of the Cu(I) and apo forms of the
yeast metallochaperone, Atx1. Biochemistry 40, 1528–1539.
14. Rosenzweig, A.C., Huffman, D.L., Hou, M.Y., Wernimont, A.K.,
Pufahl, R.A. & O’Halloran, T.V. (1999) Crystal structure of the
Atx1 metallochaperone protein at 1.02 A
˚
resolution. Struct. Fold.
Des. 7, 605–617.
15. Kihlken, M.A., Leech, A.P. & Le Brun, N.E. (2002) Copper-
mediated dimerization of CopZ, a predicted copper chaperone
from Bacillus subtilis. Biochem. J. 368, 729–739.
16.Banci,L.,Bertini,I.,DelConte,R.,Mangani,S.&Meyer-
Klaucke, W. (2003) X-ray absorption and NMR spectroscopic
studies of CopZ, a copper chaperone in Bacillus subtilis:the
coordination properties of the copper ion. Biochemistry 42, 2467–
2474.
17. Wernimont,A.K.,Huffman,D.L.,Lamb,A.L.,O’Halloran,T.V.
& Rosenzweig, A.C. (2000) Structural basis for copper transfer by
the metallochaperone for the Menkes/Wilson disease proteins.
Nat. Struct. Biol. 7, 766–771.
18. Silver, S., Nucifora, G., Chu, L. & Misra, T.K. (1989) Bacterial
resistance ATPases: primary pumps for exporting toxic cations
and anions. Trends Biochem. Sci. 14, 76–80.
19. Smith, K. & Novick, R.P. (1972) Genetic studies on plasmid-

linked cadmium resistance in Staphylococcus aureus. J. Bacteriol.
112, 761–772.
20. Lutsenko, S., Petrukhin, K., Cooper, M.J., Gilliam, C.T. &
Kaplan, J.H. (1997) N-Terminal domains of human copper-
transporting adenosine triphosphatases (the Wilson’s and Menkes
disease proteins) bind copper selectively in vivo and in vitro with
stoichiometry of one copper per metal-binding repeat. J. Biol.
Chem. 272, 18939–18944.
21. Harrison, M.D., Meier, S. & Dameron, C.T. (1999) Character-
ization of copper-binding to the second sub-domain of the
Menkes protein ATPase (MNKr2). Biochim. Biophys. Acta 1453,
254–260.
22. Cobine, P.A., George, G.N., Winzor, D.J., Harrison, M.D.,
Mogahaddas, S. & Dameron, C.T. (2000) Stoichiometry of
complex formation between Copper (I) and the N-terminal
domain of the Menkes protein. Biochemistry 39, 6857–6863.
23. Richardson, J.S. (1981) The anatomy and taxonomy of protein
structure. Adv. Protein. Chem. 34, 167–339.
24. Pufahl, R.A., Singer, C.P., Peariso, K.L., Lin, S.J., Schmidt, P.J.,
Fahrni, C.J., Cizewski, CulottaV., Penner-Hahn, J.E. & O’Hal-
loran, T.V. (1997) Metal ion chaperone function of the soluble
Cu(I) receptor Atx1. Science 278, 853–856.
25. Huffman, D.L. & O’Halloran, T.V. (2000) Energetics of copper
trafficking between the Atx1 metallochaperone and the intracel-
lular copper transporter, Ccc2. J. Biol. Chem. 275, 18611–18614.
26. Ralle, M., Lutsenko, S. & Blackburn, N.J. (2003) X-Ray
absorption spectroscopy of the copper chaperone HAH1 reveals a
linear 2-coordinate Cu(I) center capable of adduct formation with
exogenous thiols and phosphines. J. Biol. Chem. 278, 23163–
23170.

27. Krezel, A., Latajka, R., Bujacz, G.D. & Bal, W. (2003)
Coordination properties of tris(2-carboxyethyl)phosphine, a
newly introduced thiol reductant, and its oxide. Inorg. Chem. 42,
1994–2003.
28. Cotton, F.A. & Wilkinson, G. (1988) Advanced Inorganic Chem-
istry 5th edn. Wiley Interscience, New York.
29. Mash, H.E., Chin, Y.P., Sigg, L., Hari, R. & Xue, H. (2003)
Complexation of copper by zwitterionic aminosulfonic (good)
buffers. Anal. Chem. 75, 671–677.
30. Chazin, W. & Veenstra, T.D. (1999) Determination of the metal-
binding cooperativity of wild-type and mutant calbindin D9K by
electrospray ionization mass spectrometry. Rapid Commun. Mass
Spectrom. 13, 548–555.
31. Dobo, A. & Kaltashov, I.A. (2001) Detection of multiple protein
conformational ensembles in solution via deconvolution of
charge-state distributions in ESI MS. Anal. Chem. 73, 4763–4773.
32. Urvoas, A., Amekraz, B., Moulin, C., Le Clainche, L., Sto
¨
cklin,
R. & Moutiez, M. (2003) Analysis of the metal-binding selectivity
of the metallochaperone CopZ from Enterococcus hirae by elec-
trospray ionisation mass spectrometry. Rapid Commun. Mass
Spectrom. 17, 1889–1896.
33. Tietze, F. (1969) Enzymic method for quantitative determination
of nanogram amounts of total and oxidized glutathione: appli-
cations to mammalian blood and other tissues. Anal. Biochem. 27,
502–522.
34. Corazza, A., Harvey, I. & Sadler, P.J. (1996)
1
H,

13
C-NMR and
X-ray absorption studies of copper (I) glutathione complexes. Eur.
J. Biochem. 236, 697–705.
35. Rae, T.D., Schmidt, P.J., Pufahl, R.A., Culotta, V.C. & O’Hal-
loran, T.V. (1999) Undetectable intracellular free copper: the
requirement of a copper chaperone for superoxide dismutase.
Science 284, 805–808.
36. Veglia, G., Porcelli, F., DeSilva, T., Prantner, A. & Opella, S.J.
(2000) The structure of the metal-binding motif GMTCAAC is
similar in an 18-residue linear peptide and the mercury binding
protein MerP. J. Am. Chem. Soc. 122, 2389–2390.
37.Krezel,A.,Lesniak,W.,Jezowska-Bojczuk,M.,Mlynarz,P.,
Brasun, J., Kozlowski, H. & Bal, W. (2001) Coordination of heavy
metals by dithiothreitol, a commonly used thiol group protectant.
J. Inorg. Biochem. 84, 77–88.
38. Banci, L., Bertini, I., Ciofi-Baffoni, S., D’Onofrio, M., Gonnelli,
L., Marhuenda-Egea, F.C. & Ruiz-Duenas, F.J. (2002) Solution
structure of the N-terminal domain of a potential copper-trans-
locating P-type ATPase from Bacillus subtilis in the apo and Cu(I)-
loaded states. J. Mol. Biol. 317, 415–429.
39. Tottey, S., Rondet, S.A.M., Borrelly, G.P.M., Robinson, P.J.,
Rich, P.R. & Robinson, N.J. (2003) A copper metallochaperone
for photosynthesis and respiration reveals metal-specific targets,
interaction with an importer, and alternative sites for copper
acquisition. J. Biol. Chem. 277, 5490–5497.
1002 A. Urvoas et al.(Eur. J. Biochem. 271) Ó FEBS 2004
40. Harrison, M.D., Jones, C.E. & Dameron, C.T. (1999) Copper
chaperones: function, structure and copper-binding properties.
J. Biol. Inorg. Chem. 4, 145–153.

41. Busenlehner, L.S., Cosper, N.J., Scott, R.A., Rosen, B.P., Wong,
M.D. & Giedroc, D.P. (2001) Spectroscopic properties of the
metalloregulatory Cd(II) and Pb(II) sites of S. aureus pI258 CadC.
Biochemistry 40, 4426–4436.
42. VanZile, M.L., Cosper, N.J., Scott, R.A. & Giedroc, D.P. (2000)
The zinc metalloregulatory protein Synechococcus PCC7942 SmtB
binds a single zinc ion per monomer with high affinity in a tetra-
hedral coordination geometry. Biochemistry 39, 11818–11829.
43. Hitomi, Y., Outten, C.E. & O’Halloran, T.V. (2001) Extreme zinc-
binding thermodynamics of the metal sensor/regulator protein,
ZntR. J. Am. Chem. Soc. 123, 8614–8615.
Supplementary material
The following material is available from http://blackwell
publishing.com/products/journals/suppmat/EJB/EJB4001/
EJB4001sm.htm
Ó FEBS 2004 EhCopZ metal binding and selectivity (Eur. J. Biochem. 271) 1003