Báo cáo khoa học: N-terminal deletion of the c subunit affects the stabilization and activity of chloroplast ATP synthase doc

N-terminal deletion of the c subunit affects the
stabilization and activity of chloroplast ATP synthase
Zhang-Lin Ni, Hui Dong and Jia-Mian Wei
Shanghai Institute of Plant Physiology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China
ATP synthase occurs ubiquitously on energy-transduc-
ing membranes such as chloroplast thylakoid mem-
branes, mitochondrial inner membranes, and bacterial
plasma membranes. This enzyme catalyzes ATP syn-
thesis by a proton motive force across the membrane
formed by the respiratory chain or photosynthetic elec-
tron transport (ATPase in Escherichia coli recently
reviewed in [1,2], and ATP synthase in chloroplasts in
[3,4]). The general structural features of the enzyme
are highly conserved among different organisms. The
enzyme in chloroplasts consists of two parts: CF
0
and
CF
1
.CF
0
, a membrane-spanning complex, conducts
proton flux through the thylakoid membrane and pro-
vides affinity sites for the CF
1
complex. CF
1
, extrinsic
to the membrane, contains the nucleotide-binding and
catalytic sites, and can hydrolyze ATP at high rates
after appropriate treatment [4,5]. The CF

1
complex
consists of five types of subunit with the stoichiometry
a
3
b
3
cde.
The first high-resolution X-ray structure of ATP
synthase was of bovine mitochondrial F
1
in 1994 [6].
The structure is essentially unchanged in X-ray studies
of bovine F
1
inhibited by N,N¢-dicyclohexylcarbodi-
imide (Fig. 1) [7]. Nucleotide bound to all three cata-
lytic sites in the aluminum fluoride-inhibited form of
bovine F
1
[8]. The X-ray structures show that the a
and b subunits alternate with each other to form a
hexamer surrounding a central cavity, where a coiled-
coil structure formed by the N-terminal and C-ter-
minal helices of the c subunit penetrates. The three
catalytic sites of F
1
are located on the b subunits,
where the sites interface subunit a in three different
conformational states. The importance of the c subunit

in the catalytic cycle has been demonstrated previ-
ously, showing that it is probably related to the
sequential conformational changes in the ab pairs in
addition to being responsible for the generation of a
high-affinity nucleotide-binding site on the b subunits
Keywords
ATP synthase; chloroplast; glutathione
S-transferase pull-down assay; abc
assembly; c subunit
Correspondence
J M. Wei, Shanghai Institute of Plant
Physiology, Shanghai Institutes for Biological
Sciences, Chinese Academy of Sciences,
300 Fenglin Road, Shanghai 200032, China
Fax: +86 21 54924015
Tel: +86 21 54924230
E-mail:
(Received 25 November 2004, revised 22
December 2004, accepted 17 January 2005)
doi:10.1111/j.1742-4658.2005.04570.x
Five truncation mutants of chloroplast ATP synthase c subunit from spin-
ach (Spinacia oleracea) lacking 8, 12, 16, 20 or 60 N-terminal amino acids
were generated by PCR by a mutagenesis method. The recombinant c
genes were overexpressed in Escherichia coli and assembled with ab sub-
units into a native complex. The wild-type (WT) abc assembly i.e. abcWT
exhibited high Mg
2+
-dependent and Ca
2+
-dependent ATP hydrolytic

activity. Deletions of eight residues of the c subunit N-terminus caused a
decrease in rates of ATP hydrolysis to 30% of that of the abWT assembly.
Furthermore, only  6% of ATP hydrolytic activity was retained with the
sequential deletions of c subunit up to 20 residues compared with the activ-
ity of the abWT assembly. The inhibitory effect of the e subunit on ATP
hydrolysis of these abc assemblies varied to a large extent. These observa-
tions indicate that the N-terminus of the c subunit is very important,
together with other regions of the c subunit, in stabilization of the enzyme
complex or during cooperative catalysis. In addition, the in vitro binding
assay showed that the c subunit N-terminus is not a crucial region in bind-
ing of the e subunit.
Abbreviations
CF
0
, the hydrophobic portion of chloroplast ATP synthase; CF
1
, coupling factor one; GST, glutathione S-transferase; WT, wild-type.
FEBS Journal 272 (2005) 1379–1385 ª 2005 FEBS 1379
by its rotation within the a
3
b
3
core [1–4,6–8]. In F
1
,
rotation of the c subunit coupled with ATP hydrolysis
was confirmed by its direct observation in the move-
ment of a fluorescence-labeled actin filament, which
was attached to the c subunit of the thermophilic bac-
terial F

1
subcomplex, a
3
b
3
c [9], e subunit F
1
[10,11]
and CF
1
[12].
The catalytic core of the enzyme is a
3
b
3
c, despite ab
exhibiting lower rates of ATP hydrolysis [13]. It is
generally accepted that ATP synthase generates coup-
ling between cooperative catalysis and proton translo-
cation during hydrolysis ⁄ synthesis processes. However,
the precise catalytic mechanism of F
1
-ATPase is still
unknown [1,14]. With respect to CF
1
, it is also pro-
posed that isolated CF
1
operates through a full 360°
rotation, like other F

1
-ATPases [12]
.
CF
1
is unique in
that thiol modulation, the structural basis of which is
an insert of about 20 amino acids including a regula-
tory disulfide bond, is reversibly oxidized and reduced.
The N-terminus and C-terminus of c subunits from dif-
ferent organisms are highly conserved [15]. Deletion of
the 20 amino acids in the C-terminus of the c subunit
resulted in an active chloroplast enzyme [16]. Crystal
structures (Fig. 1) reveal that the N-terminal domain
of the c subunit makes contact with the b
E
sub-
unit C-terminal domain containing the conserved
DELSEED motif, which is thought to be important
for energy-coupling rotation of the c subunit by steric
interaction. This indicates the possible importance in
the c N-terminal domain during catalytic cooperativity
[4,7,8]. cSer8 substitution with a Cys residue resulted
in it being cross-linked with a different b region in the
presence of Mg
2+
-ADP or Mg
2+
-ATP [17]. cMet23
substitution caused ATPase uncoupling [18], which

was suppressed by amino-acid replacements between
269 and 280 in the C-terminal domain [19]. It has been
demonstrated by fluorescence mapping [20] and cross-
linking [21] that the e subunit is in close proximity to
the c subunit. The e subunit interacts directly with the
c subunit [22–24], but does so with a higher affinity
when the c subunit is assembled with the a
3
b
3
core
[25, 26]. The hybrid enzyme from the a,b subunits of a
thermophilic bacterium and the mutant CF
1
c subunit
(D194–230) was insensitive to added e subunit [25].
Studies by Gao et al. [26], who developed an in vitro
reconstitution system by assembling the ab complex
with an isolated c subunit, showed that this complex
was able to obtain the reconstituted core enzyme com-
plex as effectively as the native a
3
b
3
c. Recently, a hybrid
F
1
-ATPase from Rhodospirillum rubrum or chloroplast
subunits was used to study the mechanism of photosyn-
thetic F

1
-ATPase [27,28]. In the present study, we exam-
ined the importance of the CF
1
N-terminus of the
c subunit during hydrolytic turnover using this reconsti-
tution system and the binding of e to c through a gluta-
thione S-transferase (GST) pull-down assay. To do this,
we selectively deleted 8, 12, 16, 20 or 60 residues from
the N-terminus of the c subunit. The reconstituted abc
assemblies were tested for ATP hydrolytic activity. The
results show that the c subunit’s N-terminus is very
important for stabilization of the enzyme complex.
Results
Overexpression and assembly of the c truncated
mutants
All the plasmids listed in Table 1 were transformed
into the expression strain E. coli BL21 (DE3) ⁄ pLysS.
The spinach chloroplast atpC gene constructed in the
pET11b expression vector had a high expression level
in E. coli. More than 100 mg recombinant c protein
was obtained per litre of culture medium. Overexpres-
sion of the cloned polypeptides in E. coli resulted in
the accumulation of insoluble inclusion bodies. The
inclusion bodies were solubilized in 4 m urea and
recovered by slow dialysis as described previously [16].
Like the wild-type and native c subunits [16], all the c
mutants tended to aggregate during dialysis when pro-
tein concentration was high. On SDS ⁄ PAGE, wild-
type c protein and the truncated polypeptides migrated

for distances consistent with the extent of truncation
Fig. 1. Schematic representation of the bovine heart mitochondria
F
1
produced from pdb file 1e79 using DEEPVIEW [37]. Subunit a is on
the left, and subunit b is on the right. The N-terminal 20 residues
of subunit c are depicted in gray.
N-Terminal deletion of the c subunit Z L. Ni et al.
1380 FEBS Journal 272 (2005) 1379–1385 ª 2005 FEBS
(Fig. 2A). Each of the c constructs reacted with c anti-
serum on immunoblots (data not shown). The trun-
cated polypeptides were designated cDN8 to cDN60
according to the number of amino-acid residues dele-
ted from the c subunit N-terminus. The N-terminus
amino-acid sequence of c subunit from chloroplasts is
shown in Table 1.
ATP hydrolytic activity of the mutant assemblies
We tested ATP hydrolytic activity of the reconstituted
assemblies. Incubation of the native c protein from
chloroplasts with isolated ab subunits (Fig. 2B) resul-
ted in their assembly into a stable, highly active abc
complex under optimal conditions. The cloned c poly-
peptide was identical with the native c subunit in its
ability to form a fully active core enzyme complex
[16,26]. Mg
2+
-ATPase activity was measured in the
presence of sodium sulfite, a strong stimulator of ATP
hydrolysis [16]. The relative rates of ATP hydrolysis
of these reconstituted assemblies in the presence of

either Ca
2+
or Mg
2+
as the bivalent cation substrate
were compared (Fig. 3). The wild-type assembly
exhibited the maximum activity [14.4 lmol P
i
Æ(mg pro-
tein)
)1
Æmin
)1
), consistent with previous results showing
that assembling the cloned c polypeptide with the iso-
lated ab subunits resulted in a fully active core enzyme
complex [26], although there were some differences
among the hydrolytic rates. Deletion of eight residues
from the c subunit N-terminus impaired the ATP
hydrolytic ability, despite differences between Mg
2+
-
ATPase and Ca
2+
-ATPase. The deletion of 12 residues
resulted in a greater decrease in Ca
2+
-ATPase activity.
About 6% of ATP hydrolytic activity retained on dele-
tion of 20 residues. When 60 residues were deleted, the

rate of ATP hydrolysis of the reconstituted assembly
was similar to the ab complex containing no c subunit.
Interaction of subunits c and e in vitro
GST pull-down assays were used to detect c–e interac-
tion. The full-length cDNA encoding the e subunit was
fused to the C-terminus of the GST gene in the expres-
sion plasmid, and the GST-fusion protein was over-
expressed in E. coli. As shown in Fig. 4, GST alone
did not bind to the wild-type c subunit ( cWT); in con-
trast, GST–e was able to bind directly to all the c con-
structs. It was also able to bind to the cDN8, cDN12
Table 1. Amino-acid and primer sequences of truncated mutants. Listed below are the amino-acid sequences and PCR primers of truncation
mutants (D)ofthec subunit of spinach chloroplast ATP synthase. The numbers in the plasmids indicate the numbers of residues deleted fol-
lowed by N designating N-terminus truncation, respectively. The truncations begin with deletion of eight residues with successive deletion
of four residues up to 20 residues from the N-terminus, and N-terminal mutants with deletion of 60 residues (cDN60).
Plasmid Amino-acid sequences Forward primers (5¢-3¢) Reverse primers (5¢-3¢)
pET11-cWT ANLRELRDRIGSVKNTQKITEAMKLVAAAK-31 TTTGTCATATGGCAAACCTCCGTGAGC
pET11-cDN8 …8RIGSVKNTQKITEAMKLVAAAK-31 GGCCATATGCGGATCGGATCAGTCAAA ATTCCGGAC
pET11-cDN12 …12VKNTQKITEAMKLVAAAK-31 TCGGCCATATGGTCAAAAACACGCAGAAG ACGGATCCA
pET11-cDN16 …16QKITEAMKLVAAAK-31 TTGGCCATATGCAGAAGATCACCGAAGCA ATTAATCTC
pET11-cDN20 …
20 EAMKLVAAAK-31 TCCGGCATATGGAAGCAATGAAGCTCGTC
pET11-cDN60 …60 TE-62 TCGCGCATATGACTGAGGATGTTGATGTT
AB
Fig. 2. Gel electrophoresis profiles of prepa-
rations of inclusion bodies and the purified
ab complex. Preparations were analyzed by
SDS ⁄ PAGE on 15% polyacrylamide gels,
and the proteins were stained with Coomas-
sie Brilliant Blue R250. Each lane contained

6 lg protein. (A) Lane 1, CF
1
; lanes 2–7,
inclusion body preparations of cWT, DcN8,
DcN12, DcN16, DcN20 and DcN60, respect-
ively. (B) Lane 1, CF
1
(–de); lane 2, isolated
ab complex.
Z L. Ni et al. N-Terminal deletion of the c subunit
FEBS Journal 272 (2005) 1379–1385 ª 2005 FEBS 1381
and cDN16 molecules with similar affinity to cWT.
Deletion of 20 residues resulted in slight impairment of
the binding activity.
Inhibitory effects of the e subunit
Given that the N-terminal deletions of the c subunit
barely inhibited the interaction between c and e, fur-
ther studies were performed to confirm the responses
of the mutant assemblies to the inhibitory e subunit.
The inhibitory responses of the Ca
2+
-ATPase activity
of the different mutant assemblies were examined after
the addition of the e subunit (Fig. 5). The abcWT
assembly that exhibited the highest Ca
2+
-ATPase
activity was inhibited by 84%. The inhibitory effects
of the e subunits on hydrolytic rates in the mutant
(cDN8, cDN12, cDN16 and cDN20) assemblies varied

greatly, ranging from 35% to 63% reduction in hydro-
lysis.
Discussion
The studies presented here focused on the importance
of the N-terminus of the c subunit during ATP hydro-
lysis in addition to examining the role of binding and
inhibition of the e subunit. A schematic representation
of bovine heart mitochondria F
1
is shown in Fig. 1.
The conserved N-terminal region of the c subunit
forms an antiparallel left-handed coiled coil with the
C-terminal part, which penetrates into a cavity formed
by the a
3
b
3
hexamer
.
The c subunit’s N-terminus
makes contact with the C-terminal domain of the b
E
subunit, which contains the conserved DELSEED
motif [7,8]. It is generally accepted that the c subunit
confers the asymmetric properties of the catalytic sites
by interacting with the a and b subunits, resulting in
catalytic cooperativity. The permanent asymmetry of
Fig. 3. Relative ATPase activity of reconstituted abc assemblies.
Mg
2+

-ATPase (black columns) and Ca
2+
-ATPase (gray columns)
activities were analyzed as described in Experimental procedures.
The ATPase activities [lmol P
i
Æ(mg protein)
)1
Æmin
)1
]ofthecWT
assembly (100%) were: Mg
2+
-ATPase, 13.8; Ca
2+
-ATPase, 14.4.
The activities of both the ab complex and the abDcN60 assemble
were about 0.3.
Fig. 4. Interactions of wild-type c and the engineered c with e
in vitro. GST pull-down assays were performed as described in
Experimental procedures. GST or GST–e fusion proteins were
bound to glutathione–Sepharose 4B beads. 6 lg of each of the c
construct proteins were incubated with 20 lL of the beads bound
to GST–e. After extensive washing, proteins eluted from the beads
were subjected to Western-blot analysis with c antiserum. GST
alone was used as a negative control by incubating 20 lL of the
beads bound to GST with 6 lg of the wild-type c recombinant.
Fig. 5. Inhibition of the Ca
2+
-ATPase of the reconstituted abc

assemblies by addition of e subunit. Ca
2+
-ATPase activities were
analyzed as described in Experimental procedures. Assemblies
were incubated with the e subunit at the molar ratio 10e:1ab.The
inset shows the Ca
2+
-ATPase activities [lmol P
i
Æ(mg pro-
tein)
)1
Æmin
)1
] in the absence of e subunit, which are set as 100%.
N-Terminal deletion of the c subunit Z L. Ni et al.
1382 FEBS Journal 272 (2005) 1379–1385 ª 2005 FEBS
isolated CF
1
was found in labeling experiments with
Lucifer Yellow [29], which possibly indicated that the
N-terminal part of subunit c remains in contact with
the a
E
and b
E
subunits during the complete catalytic
turnover without a full 360° rotation [4]. However,
direct observation of the movement of subunit c in iso-
lated CF

1
was also determined recently to resemble
that of E. coli F
1
or thermophilic bacterial F
1
subcom-
plex, thereby favoring multisite catalysis with a full
360° rotation.
The data presented here reveal that deletion of 60
residues eliminated almost all hydrolytic activity of
the reconstituted assembly; moreover, the removal of
eight residues abolished most of the activity. When
up to 20 residues were deleted, very low ATP hydro-
lytic activity was retained (Fig. 3). There are two
possible explanations for the above results. (a) The
deletions impaired the stability of the reconstituted
assemblies and the efficient assembly of the ab com-
plex with recombinant c constructs; or (b) the struc-
tural change in the truncated c construct altered the
asymmetry conformation of a
3
b
3
c, thereby affecting
transmission of conformational signals between cata-
lytic sites, which resulted in impaired normal catalytic
cooperativity. These observations indicate that the
N-terminal part of subunit c is indispensable and
functions with other regions of c during stabilization

of the abc complex and rotational catalysis. Consis-
tent with previous studies, we also found that Ca
2+
-
dependent and Mg
2+
-dependent ATP hydrolytic
activities were different, indicating different catalytic
mechanisms [28].
It is well established that the e subunit, a regulatory
protein of ATPase, binds to c directly and rotates with
the c and c (homologous to CF
0
-III in chloroplasts)
subunits as a part of a rotor (cec
10
) [1,2]. The inter-
action of c and e increases when c penetrates into a
a
3
b
3
hexamer [26]. The e subunit binds to CF
1
with an
apparent dissociation constant of < 10
)10
m [20]. In
the e subunit, the sites of c interaction with e were
mapped to between R49 and R70, and the C-terminal

part beyond K199 [24]. The regulatory c regions of
CF
1
seem to be very important for e subunit binding
[30]. Our results also show that the e subunit stably
binds to c, which is consistent with earlier studies
[23–25]. Deletion of 20 residues from the N-terminal
region did not markedly decrease the binding affinity
between the c and e subunits in vitro (Fig. 4).
The engineered c subunit bound to the e subunit
with almost identical affinity, although the inhibitory
effects of e subunit varied with the number of resi-
dues removed. The high binding affinity of a
3
b
3
c for
the e subunit is essential for inhibition of ATPase
catalysis, which is much higher than that of binding
e to individual c [26]. The truncation seemed not to
change the binding affinity between c and e (Fig. 5),
but the altered asymmetrical conformation of a
3
b
3
c
resulting from deletions in c is enough to decrease
the binding of e to a
3
b

3
c. Meanwhile, impaired cata-
lytic cooperativity may not be efficiently inhibited
by the e subunit. Both of the above may partially
explain the varied inhibitory effect of e on ATP
hydrolysis.
Taken together, we have shown that the N-terminal
region of the c subunit is important for stabilization of
a
3
b
3
c or cooperative catalysis of isolated CF
1.
The
N-terminal region of subunit c in CF
1
is not crucial
for binding of subunit e in vitro. Further studies are
needed to determine candidate residues participating in
transmission of conformation signals and efficient
energy coupling of the c subunit N-terminus.
Experimental procedures
Materials
Restriction endonucleases, T4 DNA ligase, Klenow frag-
ment, and Pfu and Taq DNA polymerase were purchased
from Takara (Dalian, China) and Promega (Shanghai,
China). Sephadex G-50 was purchased from Pharmacia
(Uppsala, Sweden). DEAE-cellulose was obtained from
Whatmann (Uppsala, Sweden) and hydroxyapatite from

Bio-Rad (Hercules, CA, USA). Other reagents were all
standard AR grade.
Generation of c truncation mutants and
GST-fusion protein
Plasmid pJLA503-pchlc, a gift from S. Engelbrecht (Uni-
versity of Osnabruck, Germany), contains the atpC genes
encoding the ATP synthase c subunit [31]. The wild-type c
fragment was PCR amplified from pJLA503-pchlc, and five
truncation mutants were PCR generated with the mutagen-
esis primers (Table 1). The PCR products were digested
with NdeI and BamHI, and subsequently subcloned into
the pET11b expression vector. The resulting plasmids were
confirmed by DNA sequencing. For construction of the
GST–e fusion protein, full-length cDNA encoding the
e subunit was amplified by PCR using pJLA-eWT [23] as
a template with the following primers: 5 ¢-GACGGATCC
CCATGACCTTAAATCTTTGT-3¢ as the 5¢ primer and
5¢-ATAGTCGACCTGGTTACGAAGAAATCG-3¢ as the
3¢ primer. The PCR products were cleaved with BamHI
and EcoRI, and cloned into plasmid pGEX-5X-1 (Amer-
sham-Pharmacia Biotech, Shanghai, China). The resulting
plasmid pGEX-5X-e was confirmed to be inframe with the
GST cassette by DNA sequencing.
Z L. Ni et al. N-Terminal deletion of the c subunit
FEBS Journal 272 (2005) 1379–1385 ª 2005 FEBS 1383
Solubilization and folding of overexpressed
c mutants and GST-fusion protein
The resulting pET11b plasmids containing the atpC gene
were transformed into the expression strain E. coli
BL21(DE3) ⁄ pLysS. The resulting E. coli cells were grown

at 37 °C in Luria–Bertani medium containing l-ampicillin.
Cells were induced with 0.4 mm isopropyl thio-b-d-galacto-
side in mid-exponential phase, incubated for 7 h, and har-
vested as described previously [32]. Solubilization and
folding of the insoluble c polypeptide were performed
according as described previously [16]. Overexpression and
collection of GST or GST–e fusion protein in E. coli were
carried out as previously described [23].
Preparation and reconstitution of an ab complex
and c mutants
An ab complex was isolated from CF
1
(– de) as described
previously [26]. Reconstitution of the complex and
c mutants was carried out as described previously [26]. The
incubated mixture was assayed directly for ATP hydrolytic
activity.
In vitro binding assays of e with c subunit and
immunoblotting analysis
Equal amounts of GST or GST–e fusion proteins were
bound to glutathione–Sepharose 4B beads in binding buffer
[50 mm Tris ⁄ HCl, 100 mm NaCl, 1 mm EDTA, 1% (v ⁄ v)
Triton X-100, 1 mm phenylmethanesulfonyl fluoride and
10% (v ⁄ v) glycerol, pH 8.0] at 4 °C for 2 h. The bound
glutathione–Sepharose 4B beads were washed three times
with binding buffer to remove unbound fusion proteins.
These beads were incubated with equal amounts of the
c constructs for 4 h at 4 °C in binding buffer and washed
four times with binding buffer to remove unbound proteins.
Subsequently, the beads were suspended in 2· SDS loading

buffer and boiled for 3 min. Proteins released from the
beads were analyzed by SDS ⁄ PAGE (15% polyacrylamide
gel) [23], transferred to nitrocellulose membrane, and detec-
ted by western immunoblot analysis using an ECL Western
Blotting Detection System (Amersham) and c antiserum.
CF
1
and CF
1
(–de) preparation and measurement
of ATPase activity
CF
1
and CF
1
(–d) were prepared from fresh market spinach
as described previously [33,34]. Before use, the proteins
were desalted on Sephadex G-50 centrifuge columns [35].
ATPase activities were determined by measuring phosphate
release for 5–10 min at 37 °C. The assay was performed
in 1 mL volumes of assay mixture containing 50 mm
Tricine ⁄ NaOH, pH 8.0, and 5 mm ATP. Ca
2+
-ATPase was
carried out in the presence of 5 mm CaCl
2
, and Mg
2+
-
ATPase in the presence of 2 mm MgCl

2
and 20 mm
Na
2
SO
3.
The reaction was stopped by adding 200 lL 20%
trichloroacetic acid. c Antiserum was raised by subcuta-
neous injections into rabbits. Inclusion bodies containing
recombinant c polypeptide were subjected to SDS ⁄ PAGE.
Proteins were recovered from Coomassie Brilliant Blue
R250-stained gel bands and used for the immunization of
rabbits. Protein concentration was measured by the method
of Bradford [36].
Acknowledgements
This work was supported by the National Natural Sci-
ence Foundation of China (30170078) and State Key
Basic Research and Development Plan (G1998010100).
References
1 Senior AE, Nadanaciva S & Weber J (2002) The mole-
cular mechanism of ATP synthesis by F
1
F
0
-ATP
synthase. Biochim Biophys Acta 1553, 188–211.
2 Weber J & Senior AE (2003) ATP synthesis driven by
proton transport in F
1
F

0
-ATP synthase. FEBS Lett 545,
61–70.
3 McCarty RE, Evron Y & Johnson EA (2000) The chloro-
plast ATP synthase: a rotary enzyme? Annu Rev Plant
Physiol Plant Mol Biol 51, 83–109.
4 Richter ML, Hein R & Huchzermeyer B (2000) Impor-
tant subunit interactions in the chloroplast ATP
synthase. Biochim Biophys Acta 1458, 326–342.
5 Richter ML, Patrie WJ & McCarty RE (1984) Prepara-
tion of the e subunit and e subunit-deficient chloroplast
coupling factor 1 in reconstitutively active forms. J Biol
Chem 259, 7371–7373.
6 Abrahams JP, Leslie AGW, Lutter R & Walker J
(1994) Structure at 2.8 A
˚
resolution of F
1
-ATPase from
bovine heart mitochondria. Nature 370, 621–628.
7 Gibbons C, Montgomery MG, Leslie AG & Walker JE
(2000) The structure of the central stalk in bovine
F
1
-ATPase at 2.4 A
˚
resolution. Nat Struct Biol 7 , 1055–
1061.
8 Menz RI, Walker JE & Leslie AG (2001) Structure of
bovine mitochondrial F

1
-ATPase with nucleotide bound
to all three catalytic sites: implications for the mechan-
ism of rotary catalysis. Cell 106, 331–341.
9 Noji H, Yasuda R, Yoshida M & Kinosita K Jr (1997)
Direct observation of the rotation of F
1
-ATPase. Nature
386, 299–302.
10 Noji H, Hasler K, Junge W, Kinosita K Jr, Yoshida M &
Engelbrecht S (1999) Rotation of Escherichia coli F
1
-
ATPase. Biochem Biophys Res Commun 260, 597–599.
11 Omote H, Sambonmatsu N, Saito K, Sambongi Y,
Iwamoto-Kihara A, Yanagida T, Wada Y & Futai M
N-Terminal deletion of the c subunit Z L. Ni et al.
1384 FEBS Journal 272 (2005) 1379–1385 ª 2005 FEBS
(1999) The c subunit rotation and torque generation in
F
1
-ATPase from wild-type or uncoupled mutant Escheri-
chia coli. Proc Natl Acad Sci USA 96, 7780–7784.
12 Hisabori T, Kondoh A & Yoshida M (1999) The c sub-
unit in chloroplast F
1
-ATPase can rotate in a unidirec-
tional and counter-clockwise manner. FEBS Lett 463 ,
35–38.
13 Matsui T & Yoshida M (1995) Expression of the wild-

type and the Cys- ⁄ Trp-less a
3
b
3
c complex of thermophi-
lic F
1
-ATPase in Escherichia coli. Biochim Biophys Acta
1231, 139–146.
14 Ren H & Allison WS (2000) On what makes the c sub-
unit spin during ATP hydrolysis by F
1
. Biochim Biophys
Acta 1458, 221–233.
15 Miki J, Maeda M, Mukohata Y & Futai M (1988) The
c-subunit of ATP synthase from spinach chloroplasts.
Primary structure deduced from the cloned cDNA
sequence. FEBS Lett 232, 221–226.
16 Sokolov M, Lu L, Tucker W, Gao F, Gegenheimer PA
& Richter ML (1999) The 20 C-terminal amino acid
residues of the chloroplast ATP synthase c subunit are
not essential for activity. J Biol Chem 274, 13824–13829.
17 Aggeler R, Cai SX, Keana JF, Koike T & Capaldi RA
(1993) The c subunit of the Escherichia coli F
1
-ATPase
can be cross-linked near the glycine-rich loop region of
a b subunit when ADP + Mg
2+
occupies catalytic sites

but not when ATP + Mg
2+
is bound. J Biol Chem 268,
20831–20837.
18 Nakamoto RK, Maeda M & Futai M (1993) The c sub-
unit of the Escherichia coli ATP synthase. Mutations in
the carboxyl-terminal region restore energy coupling to
the amino-terminal mutant c Met-23 fi Lys. J Biol
Chem 268, 867–872.
19 Nakamoto RK, al-Shawi MK & Futai M (1995) The
ATP synthase c subunit. Suppressor mutagenesis reveals
three helical regions involved in energy coupling. J Biol
Chem 270, 14042–14046.
20 Snyder B & Hammes GG (1985) Structural organization
of chloroplast coupling factor. Biochemistry 24, 2324–
2331.
21 Schulenberg B, Wellmer F, Lill H, Junge W &
Engelbrecht S (1997) Cross-linking of chloroplast
F
0
F
1
-ATPase subunit e to c without effect on activity.
e and c are parts of the rotor. Eur J Biochem 249, 134–
141.
22 Dunn SD (1982) The isolated c subunit of Escherichia
coli F
1
ATPase binds the e subunit. J Biol Chem 257,
7354–7359.

23 Shi XB, Wei JM & Shen YG (2001) Effects of sequen-
tial deletions of residues from the N- or C-terminus on
the functions of e subunit of the chloroplast ATP syn-
thase. Biochemistry 40, 10825–10831.
24 Dunn SD (1997) e-binding regions of the c subunit of
Escherichia coli ATP synthase. Biochim Biophys Acta
1319, 177–184.
25 Tang C & Capaldi RA (1996) Characterization of the
interface between a and e subunits of Escherichia coli
F
1
-ATPase. J Biol Chem 271, 3018–3024.
26 Gao F, Lipscomb B, Wu I & Richter ML (1995)
In vitro assembly of the core catalytic complex of the
chloroplast ATP synthase. J Biol Chem 270,
9763–9769.
27 Tucker WC, Du Z, Hein R, Richter ML & Gromet-Elha-
nan Z (2000) Hybrid Rhodospirillum rubrum F
0
F
1
ATP
synthases containing spinach chloroplast F
1
b or a and b
subunits reveal the essential role of the a subunit in ATP
synthesis and tentoxin sensitivity. J Biol Chem 275, 906–
912.
28 Du Z, Tucker WC, Richter ML & Gromet-Elhanan Z
(2001) Assembled F

1
-(ab) and Hybrid F
1
-a
3
b
3
c-ATPases
from Rhodospirillum rubrum a, wild type or mutant b,
and chloroplast c subunits. Demonstration of Mg
2+
versus Ca
2+
-induced differences in catalytic site struc-
ture and function. J Biol Chem 276, 11517–11523.
29 Nalin CM, Snyder B & McCarty RE (1985) Selective
modification of an a subunit of chloroplast coupling
factor 1. Biochemistry 24, 2318–2324.
30 Hisabori T, Motohashi K, Kroth P, Strotmann H &
Amano T (1998) The formation or the reduction of a
disulfide bridge on the c subunit of chloroplast ATP
synthase affects the inhibitory effect of the e subunit.
J Biol Chem 273, 15901–15905.
31 Lill H, Burkovski A, Altendorf K, Junge W &
Engelbrecht S (1993) Complementation of Escherichia
coli unc mutant strains by chloroplast and cyanobacter-
ial F
1
-ATPase subunits. Biochim Biophys Acta 1144,
278–284.

32 Ni ZL, Wang DF & Wei JM (2002) Substitutions of the
conserved Thr42 increased the roles of the e subunit of
maize CF
1
as CF
1
inhibitor and proton gate. Photosyn-
thetica 40, 517–522.
33 Jagendorf AT (1982) Isolation of chloroplast coupling
factor (CF
1
) and of its subunits. In Methods in Chloro-
plast Molecular Biology (Edelman M, Hallick RB &
Chua N-H, eds), pp. 881–897. Elsevier Biomedical
Press, Amsterdam.
34 Richter ML, Snyder B, McCarty RE & Hammes GG
(1985) Binding stoichiometry and structural mapping of
the e polypeptide of chloroplast coupling factor 1.
Biochemistry 24, 5755–5763.
35 Penefsky HS (1977) Reversible binding of P
i
by beef
heart mitochondrial adenosine triphosphatase. J Biol
Chem 252, 2891–2899.
36 Bradford MM (1976) A rapid and sensitive method for
the quantitation of microgram quantities of protein util-
izing the principle of protein-dye binding. Anal Biochem
72, 248–254.
37 Schwede T, Kopp J, Guex N & Peitsch MC (2003)
SWISS-MODEL: an automated protein homology-

modeling server. Nucleic Acids Res 31, 3381–3385.
Z L. Ni et al. N-Terminal deletion of the c subunit
FEBS Journal 272 (2005) 1379–1385 ª 2005 FEBS 1385