Báo cáo khoa học: Quantitative interdependence of coeffectors, CcpA and cre in carbon catabolite regulation of Bacillus subtilis pot

Quantitative interdependence of coeffectors, CcpA and
cre in carbon catabolite regulation of Bacillus subtilis
Gerald Seidel, Marco Diel, Norbert Fuchsbauer and Wolfgang Hillen
Lehrstuhl fu
¨
r Mikrobiologie, Institut fu
¨
r Mikrobiologie, Biochemie und Genetik der Friedrich-Alexander Universita
¨
t Erlangen-Nu
¨
rnberg,
Germany
Carbon catabolite regulation (CCR) in Gram-positive
bacteria with low GC content is one of the most ver-
satile regulatory processes known in bacteria. In
Bacillus subtilis, the central regulator of CCR, called
CcpA, represses or activates more than 300 genes
involved in carbon and nitrogen utilization [1–4] and is
active in the exponential but also in the stationary
growth phases [5–8]. Therefore, the probably multifac-
eted regulatory mechanism of CcpA-mediated CCR is
of considerable interest. CcpA is a member of the
LacI ⁄ GalR family of bacterial regulators and binds to
catabolite responsive elements (cre) in dependence of
different effectors. While members of the LacI ⁄ GalR
family usually respond to low molecular weight
compounds, the main effectors for CcpA are the Ser46
phosphorylated histidine-containing protein (HPrSerP)
and the Ser46 phosphorylated catabolite repression
HPr (CrhP) [3]. HPr can also be phosphorylated at

histidine 15 acting as a phosphotransferase in the
phosphoenolpyruvate:sugar phosphotransferase system
(PTS). In contrast, Crh residue 15 is a glutamine,
which cannot be phosphorylated by the PTS. Mutation
of the respective genes, ptsH and crh, results in
complete loss of CCR [9–13]. HPr and Crh are phos-
phorylated at Ser46 by the ATP-dependent HPr
kinase ⁄ phosphorylase (HPrK ⁄ P) in response to high
glycolytic activity [9]. There is increasing evidence that
HPrSerP and CrhP can lead to different responses.
Keywords
carbon catabolite regulation; CrhP; HPrSerP;
fluorescence spectroscopy; surface plasmon
resonance
Correspondence
W. Hillen, Lehrstuhl fu
¨
r Mikrobiologie,
Institut fu
¨
r Mikrobiologie, Biochemie und
Genetik der Friedrich-Alexander Universita
¨
t
Erlangen-Nu
¨
rnberg, Staudtstr. 5, 91058,
Erlangen, Germany
Fax: +49 9131 8528082
Tel: + 49 9131 8528081

E-mail:
(Received 28 January 2005, revised 16
March 2005, accepted 23 March 2005)
doi:10.1111/j.1742-4658.2005.04682.x
The phosphoproteins HPrSerP and CrhP are the main effectors for
CcpA-mediated carbon catabolite regulation (CCR) in Bacillus subtilis.
Complexes of CcpA with HPrSerP or CrhP regulate genes by binding to
the catabolite responsive elements (cre). We present a quantitative analysis
of HPrSerP and CrhP interaction with CcpA by surface plasmon resonance
(SPR) revealing small and similar equilibrium constants of 4.8 ± 0.4 lm
for HPrSerP–CcpA and 19.1 ± 2.5 lm for CrhP–CcpA complex dissoci-
ation. Forty millimolar fructose-1,6-bisphosphate (FBP) or glucose-6-phos-
phate (Glc6-P) increases the affinity of HPrSerP to CcpA at least twofold,
but have no effect on CrhP–CcpA binding. Saturation of binding of CcpA
to cre as studied by fluorescence and SPR is dependent on 50 lm of
HPrSerP or > 200 lm CrhP. The rate constants of HPrSerP–CcpA–
cre complex formation are k
a
¼ 3±1· 10
6
m
)1
Æs
)1
and k
d
¼ 2.0 ±
0.4 · 10
)3
Æs

)1
, resulting in a K
D
of 0.6 ± 0.3 nm. FBP and Glc6-P stimu-
late CcpA–HPrSerP but not CcpA-CrhP binding to cre. Maximal HPr-
SerP-CcpA–cre complex formation in the presence of 10 mm FBP requires
about 10-fold less HPrSerP. These data suggest a specific role for FBP and
Glc6-P in enhancing only HPrSerP-mediated CCR.
Abbreviations
CcpA, catabolite control protein A; CCR, carbon catabolite regulation; cre, catabolite responsive elements; CrhP, catabolite repression HPr
phosphorylated at serine 46; F-6-P, fructose-6-phosphate; FBP, fructose-1,6-bisphosphate; Glc1-P, glucose-1-phosphate; Glc6-P, glucose-6-
phosphate; HPrK ⁄ P, HPr kinase ⁄ phosphorylase; HPrSerP, histidine containing protein phosphorylated at serine 46; PTS, phosphotransferase
system; RU, response units; SPR, surface plasmon resonance.
2566 FEBS Journal 272 (2005) 2566–2577 ª 2005 FEBS
The ptsH1 mutant encoding HPr46A shows reduced
CCR at many genes because CrhP substitutes only
partially for HPrSerP. crh mutants, on the other hand,
do not exhibit reduced CCR [14]. The properties of
both effectors in CCR can depend on the growth con-
ditions: The B. subtilis hut operon responds only to
HPrSerP in Luria–Bertani medium, but to HPrSerP
and CrhP in minimal medium [15]. CrhP is the sole
effector for CCR of citM in minimal medium with suc-
cinate [16]. These observations may be related to the
recently observed carbon source-dependent difference
in crh and ptsH expression: the PTS sugars mannitol,
fructose, sucrose and glucose lead to an increase of
ptsH expression, whereas succinate or citrate increase
crh expression [17]. CCR of some promoters, e.g.
ctaBCDEF and cre

up
dependent regulation of the gnt
operon, is not affected by the ptsH1 mutation, but no
data regarding the participation of CrhP are available
[8,18]. No difference is observed to HPr-kinase cata-
lysed in vitro phosphorylation of HPr and Crh [9] but
the stimulatory effect of HPrSerP on CcpA binding to
cre is stronger than that of CrhP [11,12]. Structural
differences were revealed by NMR and X-ray indi-
cating dimerization of Crh, but not of HPr [19–21].
Low molecular mass effectors, which would be
typical inducers for members of the LacI ⁄ GalR fam-
ily, are discussed controversially as effectors for
CcpA. Fructose-1,6-bisphosphate (FBP) and glucose-
6-phosphate (Glc6-P) enhance HPrSerP binding to
CcpA [22], and FBP and NADP showed cooperative
stimulation of CcpA binding to amyO in the pres-
ence of HPrSerP [23]. Glc6-P also stimulated CcpA
binding to cre in the absence of HPrSerP [18,24].
Taken together, there are many observations of dif-
ferential CcpA-mediated CCR, involving two phos-
phoproteins and several low molecular weight
effectors. In an attempt to quantitatively describe the
binding of HPrSerP and CrhP to CcpA, the effects
of FBP and Glc6-P and their stimulation of cre
binding we used surface plasmon resonance (SPR)
and fluorescence to observe formation of these com-
plexes. We describe a new role for FBP and Glc6-P
in CCR because they enhance HPrSerP-mediated
binding of CcpA to cre, but have no effect on

CcpA–CrhP–cre interaction.
Results
HPrSerP and CrhP binding to CcpA
SPR analyses of the protein–protein interactions of
HPr, Crh and their serine phosphorylated forms with
CcpA from B. subtilis have been carried out on Bia-
core CM5 chips, to which CcpA was covalently cou-
pled in flowcell 2. TetR was used as control in
flowcell 1 and showed no affinity for any of these
proteins. Increasing concentrations (from 10 to
100 lm) of HPr or Crh did not show any binding of
either protein indicating their weak affinities for
CcpA. In contrast, HPrSerP or CrhP bind to CcpA
under these conditions (Fig. 1). A saturation response
difference of 250–280 reponse units (RU; 1000 RU,
% 1 ng bound ligand) was obtained for concentra-
tions above 100 lm when a chip with 2100 RU of
immobilized CcpA was used. The equilibrium con-
stants of HPrSerP and CrhP binding to CcpA were
determined by titration under steady-state conditions
using 1700–2300 RU of coupled CcpA and a flow
rate of 5 lLÆmin
)1
(Supplementary material, Fig. 1).
Langmuir fits of the results revealed the rather small
dissociation constants of 4.8 ± 0.4 · 10
)6
m for HPr-
SerP and 19.1 ± 2.5 · 10
)6

m for CrhP. We did not
detect any indication for cooperativity in the fit
(Fig. 2). This result is in agreement with the hypo-
thesis that only one form of the phosphoproteins
and one interaction modus are involved in complex
formation of HPrSerP or CrhP with CcpA. Struc-
tural analyses suggested that Crh may exist as a
dimer at high concentrations [19–21], however, we
detected only one band in 7.5% native PAGE indi-
cating that our protein preparation contains only one
form of CrhP (data not shown). Furthermore, native
PAGE of phosphorylated HPrSerP or CrhP did not
show any nonphosphorylated HPr or Crh (data not
shown). In addition, the saturation response for
CrhP is the same as that for HPrSerP bound to the
same CcpA loaded chip. Since the SPR signal corres-
ponds directly to the bound mass, and as both pro-
Fig. 1. Surface plasmon resonance analyses of effector binding to
CcpA. The figure shows the sensorgrams obtained from the inter-
action analysis of CcpA with HPr, HPrSerP, Crh and CrhP. Dilutions
(10 l
M and 100 lM) of each protein were pumped at 5 lLÆmin
)1
over a CM5 chip loaded with TetR (control) in flowcell 1 and CcpA
in flowcell 2. The left diagram shows sensorgrams from injections
of HPr or HPrSerP and the right diagram shows the respective sen-
sorgrams for injections of Crh or CrhP. The concentrations of each
cofactor are shown.
G. Seidel et al. Regulatory differences of HPrSerP and CrhP
FEBS Journal 272 (2005) 2566–2577 ª 2005 FEBS 2567

teins have almost equal molecular weights, this
strongly indicates binding of the same forms of HPr-
SerP and CrhP to CcpA. In conclusion, we assume
that only the monomeric state of CrhP is present
under the conditions of this study.
Effects of FBP and Glc6-P on HPrSerP- and
CrhP–CcpA interaction
The effects of FBP and Glc6-P were determined by
SPR at 1 lm of HPrSerP or 4 lm of CrhP so that
about 20% of the immobilized CcpA is complexed.
The addition of FBP or Glc6-P at millimolar concen-
trations led to increased complex formation of HPr-
SerP (Fig. 3). Titration with rising concentrations of
up to 40 mm of FBP or Glc6-P did not yield satura-
tion (Fig. 3B and D). The stimulation of HPrSerP
binding to CcpA by these two effectors is highly spe-
cific because neither fructose-6-phosphate (F-6-P) nor
glucose-1-phosphate (Glc1-P) showed any influence
on binding (Fig. 3A and C). Titrations of CcpA with
HPrSerP at 40 mm FBP or Glc6-P resulted in a
K
D
(40 mm FBP) of 1.7 ± 0.3 · 10
)6
m and a K
D
(40 mm Glc6-P) of 2.2 ± 0.1 · 10
)6
m, respectively
(data not shown). Therefore, FBP stimulates CcpA–

HPrSerP complex formation at least twofold. The
SPR increase at saturation is about the same for
titrations with or without FBP or Glc6-P indicating
that roughly the same mass binds to CcpA, ruling
out a possible oligomerization of HPrSerP. Addition
of only FBP or Glc6-P to the CcpA chip did not
yield a signal (data not shown).
Fig. 2. Equilibrium titration of CcpA with HPrSerP and CrhP. The
figure shows a plot of the equilibrium responses from each sensor-
gram vs. the corresponding HPrSerP (d) and CrhP (s) concentra-
tions. Equilibrium constants were derived by the displayed
Langmuir fits.
Fig. 3. Effects of low molecular mass coeffectors on HPrSerP and CrhP binding to CcpA. Sensorgrams resulting from running 1 lM of HPr-
SerP or 4 l
M of CrhP over a CM5 chip with TetR in flowcell 1 and CcpA in flowcell 2. In addition, 5–40 mM FBP, F-6-P (A and B), Glc6-P or
Glc1-P (C and D) were added. (A) The left diagram shows sensorgrams from passages of 1 l
M HPrSerP with or without 40 mM FBP or
F-6-P. The right diagram displays sensorgrams resulting from injections of 4 l
M CrhP with or without 40 mM FBP or F-6-P. (B) The left dia-
gram shows a titration of CcpA with mixtures of 1 l
M HPrSerP and increasing concentrations (5–40 mM) of FBP. The right diagram shows
the analogous titration with 4 l
M CrhP instead of HPrSerP. (C) The left diagram shows sensorgrams from passages of 1 lM HPrSerP with or
without 40 m
M Glc6-P or Glc1-P. The right diagram shows passages of 4 lM CrhP with or without 40 mM Glc6-P or Glc1-P. (D) The left part
shows sensorgrams from a titration of CcpA with mixtures of 1 l
M HPrSerP and increasing concentrations (5–40 mM) of Glc6-P. The sensor-
grams in the right diagram show the respective titration with 4 l
M CrhP instead of HPrSerP. Analytes and their concentrations are shown in
the diagrams.

Regulatory differences of HPrSerP and CrhP G. Seidel et al.
2568 FEBS Journal 272 (2005) 2566–2577 ª 2005 FEBS
CrhP binding to CcpA was not affected by FBP,
Glc6-P, F-6-P or Glc1-P (Fig. 3). This result is surpri-
sing and suggests distinct functions of these phospho-
proteins. Since neither nonphosphorylated HPr nor
Crh interacted with CcpA in the presence of FBP,
Glc6-P, F-6-P or Glc1-P in the concentration range
used in these experiments (data not shown), these low
molecular weight coeffectors specifically affect the
HPrSerP–CcpA complex.
Stimulation of CcpA-cre complex formation
by HPrSerP, CrhP, FBP and Glc6-P
The interaction of CcpA with cre was analysed by
fluorescence and SPR. A C-terminally His-tagged
CcpA-1W mutant carrying a single tryptophan residue
at the N terminus was used for the fluorescence meas-
urements. The regulatory activity of this mutant was
determined in B. subtilis WH440 DccpA carrying a
xynP¢::lacZ fusion, transformed with either pWH1533,
pWH1541 or pWH1542 expressing CcpA, His-tagged
CcpA or His-tagged CcpA-1W, respectively (Table 1).
The three strains expressed about the same b-galactosi-
dase activities in dependence of the respective carbon
sources (Table 2). We therefore conclude that CcpA-
1W exhibits the same regulatory properties as the
wild-type. CcpA-1W was prepared to homogeneity and
showed increased fluorescence emission upon addition
of cre DNA and HPrSerP (Fig. 4) or CrhP (data not
shown). No fluorescence change was observed when

HPrSerP or CrhP was added without cre DNA, or in
the presence of an oligonucleotide without cre (data
not shown). Thus, the fluorescence change of CcpA-
1W is indicative for cre binding. No fluorescence
change was observed with HPr instead of HPrSerP
(Fig. 4). Titration of a CcpA-1W ⁄ cre DNA mixture
with either HPrSerP (Supplementary material, Fig. 2)
or CrhP (data not shown) led to increasing fluores-
cence, indicating complex formation of CcpA with cre.
About 2.5-fold more CrhP than HPrSerP was needed
Table 1. Plasmids and strains used in this study.
Strain ⁄ plasmid Characteristics Source of reference
B. subtilis 168 trpC2 Bacillus Genetic Stock Center
B. subtilis QB7144 trpC2, amyE::(xynP ¢-lacZ cat) [11]
B. subtilis WH440 QB7144; DccpA This work
B. megaterium WH419 lac; gdh2U(xylA::lacZ); DccpA [28]
E. coli FT1 ⁄ pLysS BL21 (DE3) DptsHIcrr ⁄ pLysS Cm
R
[41]
pHT304 Ap
R
,Em
R
, ori
colE1
, ori
1030
[40]
pBluescript II SK + Ap
R

,ori
colE1
, lacZ Stratagene
pWH618 pBluescript II SK + ¢aroA-DccpA-ytxD ¢ This work
pWH1533 pHT304 ccpA This work
pWH1541 pHT304 ccpAhis This work
pWH1542 pHT304 ccpA-1Whis This work
pWH1520 Ap
R
,Tc
R
, xylR, xylA¢, ori
pBR
, ori
pBc16
[42]
pWH1537 pWH1520 ccpA This work
pWH1544 pWH1520 ccpA-1Whis This work
p4813 Ap
R
, ptsK [43]
pET3c Ap
R
, ori
pBR
Novagen
pWH1576 pET3c ptsH (B. megaterium) This work
pWH466 pET3c ptsH (B. subtilis) This work
pWH467 pET3c crh (B. subtilis) This work
Table 2. Effect of the ccpA deletion and in trans complementation of the xynP ¢::lacZ fusion with wildtype ccpA and the His-tagged ccpA

mutants.
Strain and (relevant genotype)
b-Galactosidase activity in different media
CSK CSK + xylose CSK + xylose + glucose Glucose repression
QB7144 (WT) 7.2 ± 1.6 500 ± 10 3.1 ± 1.4 160
WH440 pHT304 (DccpA) 14 ± 2 1200 ± 50 1050 ± 30 1.1
WH440 pWH1533 (ccpA) 4.8 ± 0. 4 390 ± 10 2.0 ± 0.3 200
WH440 pWH1541 (ccpAhis) 5.9 ± 0.6 400 ± 16 2.0 ± 0. 2 200
WH440 pWH1542 (ccpA-1Whis) 5.0 ± 1.1 390 ± 11 3.2 ± 0.2 120
G. Seidel et al. Regulatory differences of HPrSerP and CrhP
FEBS Journal 272 (2005) 2566–2577 ª 2005 FEBS 2569
to obtain the same degree of CcpA binding to cre.
This result corresponds to the weaker binding of CrhP
to CcpA described above. We were unable to deter-
mine the binding constant of the CcpA-1W–HPrSerP–
cre complex by fluorescence, since the required low
CcpA-1W concentration is below the detection limit.
The influence of effectors on CcpA binding to cre
were also analysed by SPR. About 1000 RU biotinylat-
ed 48-bp cre DNA were bound to a Biacore SA chip in
flowcell 2 and 48-bp nonspecific DNA in flowcell 1 and
titrated with 100 nm to 75 lm HPrSerP at 10 nm CcpA
or with 100 pm to 10 nm of CcpA at 25 lm HPrSerP.
The results indicated that at least 10 lm of HPrSerP
and nanomolar concentrations of CcpA would have
to be used for quantifications. We did not observe a
steady-state response within a feasible time (data not
shown), and concentrations above 5 lm of HPrSerP
led to nonspecific interactions with the Biacore SA
chip. Nonspecific interaction of HPrSerP or CrhP did

not occur with the Biacore CM5 chip. We have used a
new method to couple aminomodified DNA to that
chip and measured CcpA–cre binding, HPrSerP stimu-
lation of CcpA–cre binding and their reaction rates.
Initial experiments confirmed that CcpA binds weakly
to cre (data not shown) as published previously [25].
Stimulation of xylAcre binding of nanomolar concen-
trations of CcpA occurs only at micromolar concentra-
tions of HPrSerP or CrhP but not with HPr or Crh.
Thus, xylAcre was titrated with HPrSerP or CrhP at a
fixed concentration of 10 nm of CcpA (Fig. 5A and B).
The results demonstrate that 50 lm HPrSerP leads to
complete saturation of cre, while the same concentra-
tion of CrhP yields only partial saturation, resembling
its weaker affinity for CcpA (Fig. 2).
The effects of FBP and Glc6-P on cre binding were
also analysed by fluorescence and SPR. Fluorescence
was observed in mixtures containing 0.075 lm of
CcpA-1W, 0.225 lm cre DNA and 0.3 lm HPrSerP or
0.75lMCrhP. These conditions yielded about 30% of
the maximal fluorescence change, indicating partial
formation of the CcpA–HPrSerP–cre complex. Titra-
tion with FBP (Fig. 6A) or Glc6-P (Supplemental
Fig. 3A) yielded an increased fluorescence until satura-
tion was reached at 2 mm FBP and 10 mm Glc6-P,
repectively. This experiment showed the same fluores-
cence intensity obtained in the titrations with HPrSerP
Fig. 4. Fluorescence analysis of effector stimulated binding of CcpA
to cre. Fluorescence emission spectra of 0.15 l
M CcpA-1 W with

and without HPr or HPrSerP in the presence and absence of cre
are shown as indicated in the figure. Black line, 0.15 l
M CcpA-1 W;
dark green line, 0.15 l
M CcpA-1 W with 1.5 lM HPr; red line,
0.15 l
M CcpA-1 W with 1.5 lM HPrSerP; light green line, 0.15 lM
CcpA-1 W with 1.5 lM HPr and 0.225 lM xylAcre; blue line,
0.15 l
M CcpA-1 W with 1.5 lM HPrSerP and 0.225 lM xylAcre.
Fig. 5. HPrSerP and CrhP concentration dependence of the CcpA–
xylAcre association rate (A) Titration of cre with HPrSerP at 10 n
M
of CcpA. The HPrSerP concentration for each sensorgram is
shown. The baseline responses were found for 10 n
M of CcpA with
or without 50 l
M of HPr. (B) Titration of cre with CrhP in the pres-
ence of 10 n
M CcpA. The baseline response was found for 10 nM
of CcpA with 50 lM of Crh. The CrhP concentration for each sen-
sorgram is shown.
Regulatory differences of HPrSerP and CrhP G. Seidel et al.
2570 FEBS Journal 272 (2005) 2566–2577 ª 2005 FEBS
(Supplemental Fig. 2). We conclude that FBP or Glc6-
P stimulates binding of HPrSerP to CcpA thereby
increasing HPrSerP-CcpA-cre complex formation,
which is monitored by flourescence. In contrast, titra-
tions with F-6-P or Glc1-P did not result in any
change of fluorescence. Replacing HPrSerP by CrhP

in these titrations did not yield any stimulation of
complex formation by FBP (Fig. 6B) or Glc6-P
(Supplemental Fig. 3B), either, whereas the subsequent
increase of the CrhP concentration resulted in com-
plete complex formation. To verify this result by SPR,
experiments using mixtures of 10 nm CcpA and 1 lm
HPrSerP or 5 lm CrhP yielding partial CcpA-HPrSerP
or CcpA-CrhP complex formation with cre on a CM5
chip were titrated with FBP. Fig. 6C shows the sensor-
grams of both titrations. Ten millimolar FBP resulted
in complete HPrSerP–CcpA–cre complex formation. In
contrast, the binding of CrhP–CcpA to cre is not affec-
ted by up to 20 mm FBP. We conclude again that
FBP and Glc6-P stimulate the HPrSerP-dependent
binding of CcpA to cre, but have no effect on CrhP-
dependent binding.
Fig. 6. Fluorescence and SPR analysis of
FBP effects on HPrSerP and CrhP mediated
cre binding by CcpA. (A) Plot of I ⁄ I
0
(I
0
:
CcpA-1 W fluorescence intensity only) vs.
the effector concentrations for titrations of
0.075 l
M CcpA-1 W and 0.225 lM cre (
n
),
or of 0.075 l

M CcpA, 0.225 lM cre and
0.3 l
M HPrSerP (m) with FBP, and the titra-
tion of 0.075 l
M CcpA-1 W, 0.3 lM HPrSerP
and 0.225 l
M cre with F-6-P (d). (B) Fluor-
escence titration of 0.075 l
M CcpA-1 W,
0.75 l
M CrhP and 0.225 lM cre with FBP.
At 12 m
M of FBP the CrhP concentration
was raised to 3.75 l
M and 5.75 lM. Points
after addition of cre and corepressor are
marked by arrows and labels. (C) Sensor-
grams showing the influence of FBP con-
centrations of 2–20 m
M added to 10 nM
CcpA, xylAcre and 1 lM HPrSerP (left dia-
gram) or 5 l
M of CrhP instead of HPrSerP
(right diagram). The baseline sensorgram
results from the analysis of a mixture of
10 n
M CcpA and 10 mM FBP. The FBP con-
centrations are shown at the right side of
each sensorgram.
G. Seidel et al. Regulatory differences of HPrSerP and CrhP

FEBS Journal 272 (2005) 2566–2577 ª 2005 FEBS 2571
Association and dissociation kinetics of the
CcpA–HPrSerP–xylAcre complex
Dissociation of the CcpA–HPrSerP–cre complex is very
fast when buffer is injected. A much slower dissociation
was observed when HPrSerP was included in that buf-
fer (Fig. 7A). Variation of the HPrSerP concentration
yielded a constant dissociation rate above 10 lm (data
not shown). Since the maximal rate of CcpA–HPr-
SerP–cre association occurs at 50 lm of HPrSerP (see
Fig. 5A) we have used this concentration to avoid bulk
effects during the experiment, which are due to nonspe-
cific signal changes caused by differences between sam-
ple composition and the running buffer. We assume
that all CcpA is complexed with HPrSerP under these
conditions. Therefore, the association and dissociation
rate constants of the HPrSerP–CcpA–cre complex were
determined with 50 lm HPrSerP in all buffers and
increasing concentrations from 1 to 30 nm of CcpA.
We fitted the sensorgrams according to the 1 : 1 Lang-
muir binding model implemented in the biaevaluation
3.1 software, assuming association and dissociation of
the CcpA–HPrSerP complex from cre under these
conditions. The respective sensorgrams and fits for the
rate constants are shown in Fig. 7B, yielding a k
a
of
3±1· 10
6
m

)1
Æs
)1
and a k
d
of 2.0 ± 0.4 · 10
)3
s
)1
resulting in an apparent K
D
of 6 ± 3 · 10
)10
m at an
average deviation v
2
ass.
¼ 3–4 and v
2
diss.
¼ 1. The sen-
sorgrams from a titration of cre with increasing con-
centrations of CcpA in the presence of 5 lm HPrSerP
and 10 mm FBP are shown in Fig. 7C. The same fitting
as above assuming association or dissociation of a
CcpA–HPrSerP–FBP complex from cre yields the con-
stants k
a
¼ 2.2 ± 0.5 · 10
6

m
)1
Æs
)1
and k
d
¼ 2.7 ±
0.8 · 10
)3
s
)1
resulting in an apparent K
D
of 1.2 ±
0.4 · 10
)9
m at v
ass
2
¼ 2–3 and v
2
diss:
¼ 1. These con-
stants are very similar to the ones obtained without
FBP at 50 lm HPrSerP suggesting that FBP decreases
the amount of HPrSerP necessary for complete binding
of CcpA to cre.
Discussion
Many qualitative and some quantitative studies of var-
ious effector molecules affecting CcpA–cre interaction

have led to a general mechanism of action for CCR in
B. subtilis [11,12,23,25,26]. However, the current model
does not explain all results, e.g. it is not clear how sim-
ilar PTS sugars such as glucose, fructose or mannitol
lead to quite different extents of CCR, and how carbon
sources like glucitol or succinate lead to ptsH- or crh-
dependent CCR [9,11,16,27,28]. The different roles of
HPr and Crh in CcpA-mediated CCR are particularly
Fig. 7. Kinetic analysis of CcpA-HPrSerP binding to xylAcre by SPR.
(A) Sensorgrams of mixtures containing 10 n
M CcpA and 5 lM HPr-
SerP are shown. In the red sensorgram the dissociation is
observed in running buffer and in the blue sensorgram the dissoci-
ation is observed first in running buffer with and then without 5 l
M
HPrSerP as indicated. (B) The rate constants were obtained from
titrations of xylAcre with mixtures of 1–30 n
M B. subtilis CcpA and
50 l
M HPrSerP (running buffer with 50 lM HPrSerP) or (C) 1–30 nM
B. subtilis CcpA, 5 lM HPrSerP and 10 mM FBP (running buffer
with 5 l
M HPrSerP and 10 mM FBP). The concentrations of the
CcpA–HPrSerP are assumed to be the same as those of CcpA and
are depicted in the respective colour. The fits of the association
phases are drawn as black lines.
Regulatory differences of HPrSerP and CrhP G. Seidel et al.
2572 FEBS Journal 272 (2005) 2566–2577 ª 2005 FEBS
mysterious, since their phosphorylation by HPrK ⁄ Pis
similarly effective [9,29]. CrhP may be specifically active

in CCR brought about by nonsugar compounds as des-
cribed for citM [16]. The approximately fourfold stron-
ger affinity of HPrSerP for CcpA compared to CrhP
found here may contribute to the weaker stimulation of
CrhP for CcpA binding to xylAcre, glpFKcre, ptacre
and xynPcre [11,12,30], but it seems likely that other
factors also contribute to differential regulation. For
example, the K
D
of the B. subtilis HPrSerP–CcpA com-
plex of % 5 lm is almost identical to that determined
for the respective Lactobacillus casei proteins (4 lm),
but despite the fact that B. subtilis- and B. megateri-
um-derived HPrSerP showed the same fivefold lower
K
D
for binding to L. casei CcpA, only the B. subtilis
but not the B. megaterium ccpA mutant can be com-
plemented by L. casei ccpA [26]. This indicates that
CcpA–cre complex formation may be influenced by
more factors than the CcpA–HPrSerP affinity.
Stimulation of HPrSerP–CcpA complex formation by
FBP and Glc6-P has been observed qualitatively before
[22]. Footprinting has indicated that HPrSerP and CrhP
mediated CcpA–cre complex formation are stimulated
by FBP [11,12]. The data presented here establish for the
first time distinct mechanisms for these two effectors as
only HPrSerP binding to CcpA responds to the coeffec-
tors FBP and Glc6-P. Consequently, only the HPrSerP–
CcpA–xylAcre interaction is stimulated by FBP and

Glc6-P, but not CrhP–CcpA–xylAcre complex forma-
tion. The stimulatory concentrations of approximately
10 mm FBP or Glc6-P are within the range of physiolo-
gical variance of these compounds [31,32]. FBP or Glc6-
P reduce the concentration of HPrSerP necessary for
complete occupation of CcpA, and, in turn, 10 mm FBP
leads to an approximately tenfold reduction of the
amount of HPrSerP necessary for complete occupation
of cre by CcpA–HPrSerP. Thus, in the presence of these
mediators at least 40-fold more CrhP compared to HPr-
SerP would be necessary to mediate full repression.
These properties could explain the ptsH-specific CCR in
the presence of glucitol [11] because this non-PTS sugar
is converted to FBP [33]. Furthermore, the stimulatory
effect of Glc6-P could explain the stronger CCR exerted
by glucose as compared to other PTS sugars [9,27,28].
Crh-mediated CCR occurs in the presence of succinate
and glutamate [16]. Since this is a physiological situation
with low intracellular concentrations of Glc6-P and
FBP, there may be yet unknown effectors for CcpA.
The equilibrium constants of HPrSerP and CrhP
binding to CcpA from B. subtilis are quite low, but
they are very well adjusted to the cellular concentra-
tions of 1 lm of CcpA and 0.1–2 mm of HPrSerP, as
found in Bacilli and Streptococci in the presence of
glucose [34,35]. The low affinity of HPrSerP to CcpA
makes the in vitro analysis of the coupled binding to
cre difficult. This explains the unusually high concen-
trations of CcpA that had to be used to detect DNA
binding in all previous studies, except for binding to

amyO [23] and rocGcre [13]. We have previously deter-
mined a low apparent equilibrium constant of K
D
¼
200 nm for the CcpA–HPrSerP–cre complex from
B. megaterium by EMSA and SPR [25], because we
assumed a K
D
of at least 500 nm for the CcpA–HPr-
SerP complex and consequently used not enough HPr-
SerP to obtain saturation of CcpA. These conditions
also masked the effects of FBP and Glc6-P. The K
D
of
the CcpA–HPrSerP complex and the titrations of cre
with HPrSerP at a constant CcpA concentration deter-
mined here show that at least 50 lm of HPrSerP is
required to assure complete complex formation of
HPrSerP with CcpA, a prerequisite for quantification
of the CcpA–HPrSerP–cre interaction.
The rate and equilibrium constants determined here
agree well with those determined for other members of
the LacI ⁄ GalR family of bacterial regulators, like PurR
in the presence of guanine (k
a
¼ 1.5 ± 2 · 10
7
m
)1
Æs

)1
;
k
d
¼ 1.2 ± 0.2 · 10
)3
s
)1
; K
D
¼ 0.8 ± 1 · 10
)10
m)
[36] and LacI (k
a
¼ 2 · 10
6
m
)1
Æs
)1
; k
d
¼ 3.5 · 10
)4
s
)1
;
K
D

¼ 2 · 10
)10
m) [37]. However, there may be two dif-
ferent types of CcpA–cre interactions. CcpA binding to
the cre sites at the xylA, xynP [11], pta [12], glpFK [30]
or gnt [38] promoters is very weak or not detectable
without cofactors, whereas binding to amyO [23] or
rocGcre [13] is strong. HPrSerP at 0.68 lm stimulated
CcpA binding to amyO only 10-fold and 2 mm FBP
with 0.68 lm HPrSerP stimulated it 300-fold, whereas
CcpA–xylAcre binding is stimulated at least 1000-fold
in the presence of 50 lm HPrSerP [23]. Thus, different
cre sequences found in many genes or operons may
respond in a differential manner to FBP- or Glc6-P-
mediated stimulation.
Experimental procedures
Plasmid construction and bacterial strains
Strains and plasmids used in this study are listed
in Table 1. For in frame deletion of ccpA in B. subtilis two
DNA fragments were amplified from chromosomal DNA
from B. subtilis 168, where primer pairs dccpA1 (5¢-ATA
ATAATAGAGCTCGCTGTGCCGATTTTGAAACAAG-
3¢) and dccpA2 (5¢-TATTATTATAGCGGCCGCAATATT
GCTCATCCTAAAACC-3¢) yielded fragment 1 and dccpA3
(5¢-ATAATAATAGCGGCCGCTGAAGCACTGCAGCAT
CTGATG-3¢) with dccpA4 (5¢-TATTATTATGGTACCT
TTTCGGTGCCGTTCCTCC-3¢) yielded fragment 2. Frag-
G. Seidel et al. Regulatory differences of HPrSerP and CrhP
FEBS Journal 272 (2005) 2566–2577 ª 2005 FEBS 2573
ment 1 comprises the sequence from 500 bp upstream to

13 bp downstream of ccpA translational start with SacI
and NotI restriction sites at the 3¢- and 5¢-termini, respect-
ively. Fragment 2 includes the ccpA sequence from base-
pair 684–438 bp of ytxD downstream from ccpA with NotI
and KpnI restriction sites at the 3¢-or5¢- ends, respect-
ively. Plasmid pWH618 was constructed by cloning these
fragments into pBluescriptII SK + via the restriction sites
SacI and NotI for fragment 1 and NotI and KpnI for frag-
ment 2. The product carries a ccpA fragment lacking bases
13–684 (corresponding to residues Thr5–Leu228). The NotI
restriction site was positioned between bases 13 and 684
resulting in a linker with three alanines replacing CcpA
residues 6–227. Strain WH440 was generated by cotrans-
formation of B. subtilis 168 with the plasmid pWH618 and
chromosomal DNA from B. subtilis QB7144 (xynP¢::lacZ).
Transformants were selected for the presence of the cat
resistance gene linked to the xynP¢::lacZ fusion from
QB7144 on CSK medium supplemented with 1% glucose,
0.2% xylose and 80 mgÆmL
)1
X-Gal and 5 mgÆmL
)1
chlor-
amphenicol. Blue stained colonies showing deregulation of
xynP¢::lacZ were picked for verification of the deletion
of ccpA by Western blotting. For complementation of
WH440 ccpA was amplified with the primer pair ccpAmut1
(5¢-ATAATATCTAGAACCAAGTATACGTTTTCATC-3¢)
and ccpAstd2 (5¢-TATTATTATGGATCCTTTTCTTA
TGACTTGGTTT-3¢). This fragment contains the ccpA

promoter 290 bp upstream from the start codon [39]. This
fragment was cloned into the shuttle vector pHT304 [40]
via the restriction sites XbaI and BamHI resulting in
pWH1533. For construction of the vector pWH1541 ccpA
was amplified by ccpAmut1 and ccpAnot (5¢-TATTAT
TATGCGGCCGCTGACTTGGTTGACTTTCTA-3¢) using
pWH1533 as template. The His-tag encoding seq-
uence was amplified by primers hisnot (5¢-ATAA
TAGCGGCCGCGGGCGGTCATCACCATCACCATCAC
TA-3¢) and hisbam (5¢-TATTATTATGGATCCTTAGC
TTCCTTAGCTCCTGA-3¢) from vector pQE17. After
restriction of the ccpA fragment with XbaI and NotI and
the His-tag encoding fragment with NotIandBamHI, both
were cloned in a three-armed ligation into pHT304 via the
restriction sites and XbaI and BamHI. For construction of
pWH1542 ccpA was mutagenized via two-step mutagene-
sis using primers ccpAmut1, hisbam and ccpA +1W
(5¢-CGTAATATTGCTCCACATCCTAAAACC-3¢). The
resulting fragment encoding C-terminally His-tagged ccpA
carrying an additional tryptophan residue at the N terminus
was cloned into pHT304 via XbaI and BamHI. For over-
expression of HPr and Crh from B. subtilis or HPr from
B. megaterium either ptsH genes or crh were cloned into
pET3c via NdeI and BamHI resulting in pWH466,
pWH467 and pWH1576. For overexpression Escherichia
coli FT1 [41] was transformed with the latter plasmids.
For overexpression ccpA from B. subtilis was subcloned
from pWH1533 into pWH1520 resulting in pWH1537.
By analogy ccpA-1Whis was subcloned from pWH1542
yielding pWH1544. B. megaterium WH419 overexpressed

either proteins after transformation with pWH1537 or
pWH1544.
b-Galactosidase assays
Cells for b-galactosidase assays were grown overnight at
37 °C in CSK minimal medium. From overnight cultures the
same medium and CSK supplemented with 0.2% xylose or
with 1% glucose, 0.2% xylose were inocculated to D
600
¼ 0.1
and grown at 37 °C until a D
600
value of % 0.4 was reached.
One-hundred microlitres bacterial culture were diluted with
900 lL Z-buffer (60 mm Na
2
HPO
4
,40mm NaH
2
PO
4
,
10 mm KCl, 1 mm MgSO
4
,50mm b-mercaptoethanol,
pH 7). After lysis with lysozyme and Triton-X-100 b-galac-
tosidase activity was determined as described earlier [28].
Preparation of proteins
CcpA from B. subtilis was expressed in B. megaterium
WH419 ⁄ pWH1537 and C-terminally His-tagged CcpA-1 W

in B. megaterium WH419 ⁄ pWH1544 (Table 1) as described
[24]. For purification the cells were disrupted by ultrasonifi-
cation, centrifuged for 45 min at 48 400 g at 4 °C and incu-
bated with 5 lgÆmL
)1
RNaseA and 10 lgÆmL
)1
DNaseI
(Sigma, Munich, Germany). Wild-type CcpA was purified
by subsequent cation exchange chromatography on POROS
20 HS (Perseptive Biosystems, Framingham, MA, USA),
desalting (Pharmacia Biotech, Freiburg, Baden Wuerttem-
berg, Germany), anionic exchange chromatography on
Fractogel EMD TMAE (Merck, Darmstadt, Hesse, Ger-
many) and gelfiltration on Superdex G75 (Pharmacia Bio-
tech). C-terminally His-tagged CcpA-1 W was purified
using Ni-affinity chromatography on POROS 20 MC
(Perseptive Biosystems). Further purification was achieved
by gelfiltration on Superdex G75 (Pharmacia Biotech).
HPr from B. megaterium was overproduced in E. coli
FT1 ⁄ pWH1576, HPr from B. subtilis in E. coli FT1 ⁄
pWH466 and Crh in E. coli FT1 ⁄ pWH467. The crude
lysates have been incubated with 5 lgÆmL
)1
RNaseA and
10 lgÆmL
)1
DNaseI (Sigma), then prepurified by heat dena-
turation for 20 min at 70 °C and 65 °C, respectively. After
centrifugation from the precipitated proteins, HPr or Crh

could be extracted from the supernatant. Phosphorylation
of either protein was performed in the prepurified crude
lysate using a HPr kinase extract as described [25]. Purifica-
tion of HPr, HPrSerP, Crh or CrhP was achieved by anion
exchange chromatography on DEAE Sephacel (Pharmacia
Biotech) and subsequent gelfiltration on Superdex G75
(Pharmacia Biotech). The activities of both phosphorylated
proteins was assumed to be 100%, as there is no obvious
method for activity determination. However, we assume
that the potentially active fractions are the same for both,
Regulatory differences of HPrSerP and CrhP G. Seidel et al.
2574 FEBS Journal 272 (2005) 2566–2577 ª 2005 FEBS
similarly heat stable proteins. Therefore, the ratio of con-
stants should be reliable.
Determination of protein concentration
Protein concentrations were measured using a Bio-Rad
(Munich, Germany) Bradford dye binding assay. BSA was
used as a standard. The concentration of purified CcpA-1
W protein was confirmed by UV spectroscopy at 280 nm
using an extinction coefficient of e
280nm
¼ 21300 m
)1
Æcm
)1
.
Preparation of cre DNA
Forty-eight nucleotide synthetic oligonucleotides contain-
ing xylAcre (forward: 5¢-CTAATAAAATTAATCATTTT
GAAAGCGCAAACAAAGTTTTATACGAAG-3¢; back-

ward: 5¢-CTTCGTATAAAACTTTGTTTGCGCTTTCAAA
ATGATTAATTTTATTAG-3¢) and 26-nt oligonucleotides
containing xylAcre (forward: 5¢-AATCATTTTGAAAGC
GCAAACAAAGT-3¢; backward: 5¢-ACTTTGTTTGCG
CTTTCAAAATGATT-3¢) or a nonspecific DNA sequence
(5¢-AATCATTTATGGCATAGGCAACAAGT-3¢; back-
ward: 5¢-ACTTGTTGCCTATGCCATAAATGATT-3¢)
were hybridized and used for analyses without further puri-
fication. Both forward 26-nt oligonucleotides carry a C6
aminolinker at the 5¢-end. All oligonucleotides were pur-
chased with or without modification at MWG Biotech
(Ebersberg, Germany). The concentration of the hybridized
DNA was determined using an extinction coefficient of
e ¼ 1186 · 10
)6
m
)1
Æcm
)1
as determined from the nucleo-
tide composition.
SPR measurements
SPR measurements with CcpA, HPrSerP or CrhP each from
B. subtilis or xylAcre, were analysed using a BIAcoreX
instrument operated at 25 °C (BIAcoreX, Uppsala, Sweden).
For the analysis of protein–protein interactions CcpA was
immobilized by amine coupling on the carboxylated dextran
matrix of a CM5 sensorchip (Biacore AB) in flowcell Fowcell
1 contained TetR from E. coli and was used as a reference.
For immobilization on the activated chip matrix (injection of

35 lL of a mixture containing 50 mm N-hydroxysuccinimide
and 200 mm N-ethyl-N¢-(3-dimethylaminopropyl)carbodi-
imide hydrochloride in desalted, sterile water) the proteins
were injected at 500 nm concentrations in 10 mm sodiumace-
tate, pH 5. After coupling of the proteins the residual activa-
ted carboxyl groups were deactivated by injection of 1 m
ethanolamine hydrochloride ⁄ NaOH, pH 8.5. Both proteins,
CcpA and TetR-B ⁄ D, were adjusted to equal immobilization
levels of 1700–2100 RU on different sensorchips. During
immobilization and interaction analyses HBS ⁄ EP buffer
(0.01 m Hepes pH 7.4, 0.15 m NaCl, 3 mm EDTA, 0.005%
polysorbate) purchased from Biacore was used as a running
buffer at a flowrate of 5 lLÆmin
)1
. For the interaction analy-
ses, the injected analyte volume was adjusted to the amount
needed for a constant response difference indicating the equi-
librium of interaction of CcpA with HPrSerP or CrhP. The
concentration of the complex is measured directly as the
steady state response [R
(eq)
] in SPR. As the analyte is
constantly replenished during sample injection, the concen-
tration of free analyte is equal to the bulk analyte
concentration. The equilibrium constants were determined
by Langmuir fits of plots from the steady state response vs.
the analyte concentrations. Evaluation was done using the
Langmuir equation for 1 : 1 ligand binding of the program
sigmaplot
TM

8.0 (SPSS Inc., Chicago, IL, USA). Each equi-
librium constant and deviations were determined from three
different titrations. For interaction analyses of CcpA with
xylAcre we immobilized amino-modified 26-meric DNA (see
preparation of cre DNA) containing the xylAcre or a non-
specific DNA sequence on the surface of Biacore CM5 chips.
We used a new method for coupling of amino-modified
DNA to Biacore CM5 chips. This method uses cetyltrimeth-
ylammoniumbromide (CTAB) micelles as carriers to immo-
bilize DNA on the carboxymethylated dextran matrix
(H. Sjo
¨
bom, Biacore AB, Uppsala, Sweden, personal com-
munication). We coupled hybridized nonspecific DNA in
flowcell 1 and xylAcre containing DNA in flowcell 2 by injec-
tion of mixtures containing 5 lm of amino-modified DNA,
0.6 mm CTAB in 10 mm Hepes at a pH of 7.4 over a CM5
chip that was activated as described above. During coupling
we used HBS-N (10 mm Hepes, 150 mm NaCl) as a running
buffer at a flow rate of 5 lLÆmin
)1
. After deactivation of
residual activated carboxyl groups as described above
% 280 RU DNA remained stably attached to the chip, but
only % 30–60 RU were functional as calculated from the
maximum response of CcpA-HPrSerP binding to xylAcre.
For all CcpA–cre interaction analyses HBS-EP buffer pur-
chased from Biacore AB was used as a running buffer. The
mass transport limitation was tested by alteration of flow
rates. A flow rate of 40 lLÆmin

)1
was suitable for all experi-
ments to minimize mass transport. To regenerate the chip
surface the dissociation of the CcpA–HPrSer46P complex
was stopped by injection of 80 lL HBS-EP buffer at 40 lLÆ
min
)1
after each injection. Fits showed that concentrations
>30 nm CcpA or CcpA–HPrSerP complex, which saturate
the cre coupled to the chip, result in biphasic sensorgrams.
We analysed only sensorgrams from 1 nm to 30 nm CcpA in
the presence of HPrSerP or HPrSerP and FBP. The titrations
for the kinetic measurements have been carried out twice for
each protein complex, CcpA–HPrSerP or CcpA–HPrSerP–
FBP. FBP (Fluka) F-6-P, Glc6-P or Glc1-P (Sigma) were
diluted immediately before each experiment in HBS-EP buf-
fer to 100 mm stock solutions and if necessary adjusted to
pH 7.4. In order to prevent bulk effects the HBS-EP running
buffer was adjusted to the concentration of these compounds
and then supplied with HPrSerP if required.
G. Seidel et al. Regulatory differences of HPrSerP and CrhP
FEBS Journal 272 (2005) 2566–2577 ª 2005 FEBS 2575
Fluorescence measurements
For fluorescence spectroscopic measurements we used
CcpA-1 W and Crh or CrhP from B. subtilis and xylAcre
and HPr or HPrSerP from B. megaterium. FBP, F-6-P,
Glc6-P and Glc1-P were from Fluka or Sigma. All compo-
nents were dissolved in 10 mm Tris ⁄ HCl pH 7.5, 150 mm
NaCl, 5 mm MgCl
2

and 1 mm dithiothreitol. Fluorescence
emission spectra were recorded on a Spex Fluorolog 3 spec-
trofluorimeter at a slit width set of 4 mm. Tryptophan
emission was excited at a wavelength of 295 nm and a tem-
perature of 25 °C. In titration experiments, fluorescence
emission was scanned in a wavelength range of 340–
370 nm. As a measure for fluorescence intensity, peak areas
were determined by integration with computer software
Grams ⁄ 32 from Galactic Industries Corporation. For eval-
uation the intensities were corrected for increasing sample
volume and inner filter effect at each titration step by the
mathematical transformation:
I ¼ I
exp
ÂðV =V
0
ÞÂ10
A
295
=2
where I
exp
and I are the fluorescence intensity before and
after correction. V
0
and V are the sample volumes at the
start of the experiment and at each titration step. A
295
is
the overall absorption of the sample at the excitation wave-

length, which was measured for each titration step at a
Pharmacia Biotech Ultrospec 4000.
Acknowledgements
We thank Dr Lwin Mar Aung-Hilbrich for providing
pWH1576 and Eva Maria Henßler for TetR. We are
grateful to Dr Hans Sjo
¨
bom and Dr Anders Sjo
¨
din
from Biacore AB for their help with CTAB mediated
DNA coupling. This work was supported by the Deut-
sche Forschungsgemeinschaft through SFB 473
‘Schaltvorga
¨
nge der Transkription’, the Graduierten-
kolleg 805 and the Fonds der Chemischen Industrie.
References
1 Moreno MS, Schneider BL, Maile RR, Weyler W &
Saier MH (2001) Catabolite repression mediated by the
CcpA protein in Bacillus subtilis: novel modes of regula-
tion revealed by whole-genome analyses. Mol Microbiol
39, 1366–1381.
2 Tobisch S, Zuhlke D, Bernhardt J, Stu
¨
lke J & Hecker
M (1999) Role of CcpA in regulation of the central
pathways of carbon catabolism in Bacillus subtilis.
J Bacteriol 181, 6996–7004.
3 Stu

¨
lke J & Hillen W (2000) Regulation of carbon catabo-
lism in Bacillus species. Annu Rev Microbiol 54, 849–880.
4 Blencke HM, Homuth G, Ludwig H, Mader U, Hecker
M & Stu
¨
lke J (2003) Transcriptional profiling of gene
expression in response to glucose in Bacillus subtilis: reg-
ulation of the central metabolic pathways. Metab Eng 5,
133–149.
5 Turinsky AJ, Moir-Blais TR, Grundy FJ & Henkin TM
(2000) Bacillus subtilis ccpA gene mutants specifically
defective in activation of acetoin biosynthesis. J Bacter-
iol 182, 5611–5614.
6 Grundy FJ, Waters DA, Allen SHG & Henkin TM
(1993) Regulation of the Bacillus subtilis acetate kinase
gene by CcpA. J Bacteriol 175, 7348–7355.
7 Grundy FJ, Turinsky AJ & Henkin TM (1994) Catabo-
lite regulation of Bacillus subtilis acetate and acetoin uti-
lization genes by CcpA. J Bacteriol 176, 4527–4533.
8 Liu X & Taber HW (1998) Catabolite regulation of the
Bacillus subtilis ctaBCDEF gene cluster. J Bacteriol
180, 6154–6163.
9 Galinier A, Haiech J, Kilhofer M-C, Jaquinod M,
Stu
¨
lke J, Deutscher J & Martin-Verstraete I (1997) The
Bacillus subtilis crh gene encodes a HPr-like protein
involved in carbon catabolite repression. Proc Natl Acad
Sci USA 94, 8439–8444.

10 Turinsky AJ, Grundy FJ, Kim JH, Chambliss GH &
Henkin TM (1998) Transcriptional activation of the
Bacillus subtilis ackA gene requires sequences upstream
of the promoter. J Bacteriol 180, 5961–5967.
11 Galinier A, Deutscher J & Martin-Verstraete I (1999)
Phosphorylation of either crh or HPr mediates binding of
CcpA to the bacillus subtilis xyn cre and catabolite
repression of the xyn operon. J Mol Biol 286, 307–314.
12 Presecan-Siedel E, Galinier A, Longin R, Deutscher J,
Danchin A, Glaser P & Martin-Verstraete I (1999)
Catabolite regulation of the pta gene as part of carbon
flow pathways in Bacillus subtilis. J Bacteriol 181, 6889–
6897.
13 Belitsky BR, Kim HJ & Sonenshein AL (2004) CcpA-
dependent regulation of Bacillus subtilis glutamate dehy-
drogenase gene expression. J Bacteriol 186, 3392–3398.
14 Warner JB & Lolkema JS (2003) CcpA-dependent car-
bon catabolite repression in bacteria. Microbiol Mol Biol
Rev 67, 475–490.
15 Zalieckas JM, Wray LV Jr & Fisher S (1999) trans-acting
factors affecting carbon catabolite repression of the hut
operon in Bacillus subtilis. J Bacteriol 181, 2883–2888.
16 Warner JB & Lolkema JS (2003) A Crh-specific func-
tion in carbon catabolite repression in Bacillus subtilis,
FEMS Microbiol Lett 220, 277–280.
17 Gorke B, Fraysse L & Galinier A (2004) Drastic differ-
ences in Crh and HPr synthesis levels reflect their differ-
ent impacts on catabolite repression in Bacillus subtilis.
J Bacteriol 186, 2992–2995.
18 Miwa Y, Nagura K, Eguchi S, Fukuda H, Deutscher J

& Fujita Y (1997) Catabolite repression of the Bacillus
subtilis gnt operon exerted by two catabolite-responsive
elements. Mol Microbiol 23, 1203–1213.
19 Favier A, Brutscher B, Blackledge M, Galinier A, Deut-
scher J, Penin F & Marion D (2002) Solution structure
Regulatory differences of HPrSerP and CrhP G. Seidel et al.
2576 FEBS Journal 272 (2005) 2566–2577 ª 2005 FEBS
and dynamics of Crh, the Bacillus subtilis catabolite
repression HPr. J Mol Biol 317, 131–144.
20 Juy M, Penin F, Favier A, Galinier A, Montserret R,
Haser R, Deutscher J & Bockmann A (2003) Dimeriza-
tion of Crh by reversible 3D domain swapping induces
structural adjustments to its monomeric homologue
HPr. J Mol Biol 332, 767–776.
21 Penin F, Favier A, Montserret R, Brutscher B, Deut-
scher J, Marion D & Galinier D (2001) Evidence for a
dimerisation state of the Bacillus subtilis catabolite
repression HPr-like protein, Crh. J Mol Microbiol
Biotechnol 3, 429–432.
22 Deutscher J, Ku
¨
ster E, Bergstedt U, Charrier V & Hil-
len W (1995) Protein kinase-dependent HPr ⁄ CcpA inter-
action links glycolytic activity to carbon catabolite
repression in Gram-positive bacteria. Mol Microbiol 15,
1049–1053.
23 Kim JH, Voskuil MI & Chambliss GH (1998) NADP,
corepressor for the Bacillus catabolite control protein
CcpA. Proc Natl Acad Sci USA 95, 9590–9595.
24 Go

¨
sseringer R, Ku
¨
ster E, Galinier A, Deutscher J &
Hillen W (1997) Cooperative and non-cooperative DNA
binding modes of catabolite control protein CcpA from
Bacillus megaterium result from sensing two different
signals. J Mol Biol 266, 665–676.
25 Aung-Hilbrich LM, Seidel G, Wagner A & Hillen W
(2002) Quantification of the influence of HPrSer46P on
CcpA–cre interaction. J Mol Biol 319, 77–85.
26 Mahr K, Esteban CD, Hillen W, Titgemeyer F & Perez-
Martinez G (2002) Cross communication between com-
ponents of carbon catabolite repression of Lactobacillus
casei and Bacillus megaterium. J Mol Microbiol Biotech-
nol 4, 489–494.
27 Chauvaux S, Paulsen IT & Saier MH Jr (1998) CcpB,
a novel transcription factor implicated in catabolite
repression in Bacillus subtilis. J Bacteriol 180, 491–497.
28 Wagner A, Ku
¨
ster-Scho
¨
ck E & Hillen WH (2000) Sugar
uptake and carbon catabolite repression in Bacillus
megaterium strains with inactivated ptsHI. J Mol Micro-
biol Biotechnol 2, 587–592.
29 Lavergne JP, Jault JM & Galinier A (2002) Insights into
the functioning of Bacillus subtilis HPr kinase ⁄ phospha-
tase: affinity for its protein substrates and role of cati-

ons and phosphate. Biochemistry 41, 6218–6225.
30 Darbon E, Servant P, Poncet S & Deutscher J (2002)
Antitermination by GlpP, catabolite repression via
CcpA and inducer exclusion triggered by P-GlpK
dephosphorylation control Bacillus subtilis glpFK
expression. Mol Microbiol 43, 1039–1052.
31 Mijakovic I, Poncet S, Galinier A, Monedero V, Fieula-
ine S, Janin J, Nessler S, Marquez JA, Scheffzek K,
Hasenbein S, et al. (2002) Pyrophosphate-producing
protein dephosphorylation by HPr kinase ⁄ phosphory-
lase: a relic of early life? Proc Natl Acad Sci USA 99,
13442–13447.
32 Neves AR, Ventura R, Mansour N, Shearman C, Gas-
son MJ, Maycock C, Ramos A & Santos H (2002) Is
the glycolytic flux in Lactococcus lactis primarily con-
trolled by the redox charge? Kinetics of NAD(+) and
NADH pools determined in vivo by 13C NMR. J Biol
Chem 277, 28088–28098.
33 Chalumeau H, Delobbe A & Gay P (1978) Biochemical
and genetic study of d-glucitol transport and catabolism
in Bacillus subtilis. J Bacteriol 134, 920–928.
34 Vadeboncoeur C, Frenette M & Lortie LA (2000) Regu-
lation of the pts operon in low G+C Gram-positive
bacteria. J Mol Microbiol Biotechnol 2, 483–490.
35 Thevenot T, Brochu D, Vadeboncoeur C & Hamilton
IR (1995) Regulation of ATP-dependent P-(Ser)-HPr
formation in Streptococcus mutans and Streptococcus
salivarius. J Bacteriol 177, 2751–2759.
36 Xu H, Moraitis M, Reedstrom RJ & Matthews KS
(1998) Kinetic and thermodynamic studies of purine

repressor binding to corepressor and operator DNA.
Biol Chem 273, 8958–8964.
37 Bondeson K, Frostell-Karlsson A, Fagerstam L & Mag-
nusson G (1993) Lactose repressor–operator DNA inter-
actions: kinetic analysis by a surface plasmon resonance
biosensor. Anal Biochem 214, 245–251.
38 Fujita Y, Miwa Y, Galinier A & Deutscher J (1995)
Specific recognition of the Bacillus subtilis gnt cis-acting
catabolite-responsive element by a protein complex
formed between CcpA and seryl-phosphorylated HPr.
Mol Microbiol 17, 953–960.
39 Henkin TM, Grundy FJ, Nicholson WL & Chambliss
GH (1991) Catabolite repression of a-amylase gene
expression in Bacillus subtilis involves a trans-acting
gene product homologous to the Escherichia coli lacI
and galR repressors. Mol Microbiol 5, 575–584.
40 Arantes O & Lereclus D (1991) Construction of cloning
vectors for Bacillus thuringiensis. Gene 108, 115–119.
41 Parche S, Schmid R & Titgemeyer F (1999) The phos-
photransferase system (PTS) of Streptomyces coelicolor
identification and biochemical analysis of a histidine
phosphocarrier protein HPr encoded by the gene ptsH.
Eur J Biochem 265, 308–317.
42 Rygus T & Hillen W (1991) Inducible high-level expres-
sion of heterologous genes in Bacillus megaterium using
the regulatory elements of the xylose-utilization operon.
Appl Microbiol Biotechnol 35, 594–599.
43 Reizer J, Hoischen C, Titgemeyer F, Rivolta C, Rabus R,
Stu
¨

lke J, Karamata D, Saier MHJ & Hillen W (1998) A
novel protein kinase that controls carbon catabolite
repression in bacteria. Mol Microbiol 27, 1157–1169.
Supplementary material
The following material is available from http://www.
blackwellpublishing.com/products/journals/suppmat/EJB/
EJB4682/EJB4682sm.htm
G. Seidel et al. Regulatory differences of HPrSerP and CrhP
FEBS Journal 272 (2005) 2566–2577 ª 2005 FEBS 2577