Báo cáo khoa học: Subcellular localization of yeast Sec14 homologues and their involvement in regulation of phospholipid turnover pptx

Subcellular localization of yeast Sec14 homologues and their
involvement in regulation of phospholipid turnover
Martina Schnabl
1
, Olga V. Oskolkova
1
, Roman Holic
ˇ
2
, Barbara Brez
ˇ
na
´
2
, Harald Pichler
3
, Milos
ˇ
Za
´
gors
ˇ
ek
2
,
Sepp D. Kohlwein
4
, Fritz Paltauf
1
,Gu¨ nther Daum
1

and Peter Griac
ˇ
2
1
Department of Biochemistry, University of Technology, Graz, Austria;
2
Institute of Animal Biochemistry and Genetics,
Slovak Academy of Sciences, Ivanka pri Dunaji, Slovak Republic;
3
Department of Biochemistry, Faculty of Sciences, Sciences II,
University of Geneva, Switzerland;
4
Department of Molecular Biology, Biochemistry and Microbiology,
SFB Biomembrane Research Center, University of Graz, Austria
Sec14p of the yeast Saccharomyces cerevisiae is involved in
protein secretion and regulation of lipid synthesis and
turnover in vivo, but acts as a phosphatidylinositol–phos-
phatidylcholine transfer protein in vitro. In this work, the
five homologues of Sec14p, Sfh1p–Sfh5p, were subjected to
biochemical and cell biological analysis to get a better view of
their physiological role. We show that overexpression of
SFH2 and SFH4 suppressed the sec14 growth defect in a
more and SFH1 in a less efficient way, whereas overexpres-
sion of SFH3 and SFH5 did not complement sec14.Using
C-terminal yEGFP fusions, Sfh2p, Sfh4p and Sfh5p are
mainly localized to the cytosol and microsomes similar to
Sec14p. Sfh1p was detected in the nucleus and Sfh3p in lipid
particles and in microsomes. In contrast to Sec14p, which
inhibits phospholipase D1 (Pld1p), overproduction of Sfh2p
and Sfh4p resulted in the activation of Pld1p-mediated

phosphatidylcholine turnover. Interestingly, Sec14p and the
two homologues Sfh2p and Sfh4p downregulate phospho-
lipase B1 (Plb1p)-mediated turnover of phosphatidylcholine
in vivo. In summary, Sfh2p and Sfh4p are the Sec14p
homologues with the most pronounced functional similarity
to Sec14p, whereas the other Sfh proteins appear to be
functionally less related to Sec14p.
Keywords: SEC14; Sec14 homologues; subcellular localiza-
tion; phosphatidylcholine; phospholipase.
The product of the Saccharomyces cerevisiae SEC14 gene
was originally identified as a phosphatidylinositol transfer
protein (PITP) which catalyzes in vitro transport of phos-
phatidylinositol (PtdIns) and phosphatidylcholine (PtdCho)
between artificial and biological membranes [1]. Moreover,
Sec14p is essential for protein transport from the Golgi
complex to the cell periphery in vivo [2]. Systematic
screenings led to the discovery that mutations in the CDP-
choline pathway of PtdCho biosynthesis suppressed the
sec14 defect [3], suggesting a link between Sec14p function
and lipid metabolism. This view was supported by the
finding that phospholipase D1 (Pld1p) mediated PtdCho
turnover is necessary for suppression of the sec14 growth
and secretory defects [4,5]. In addition to its regulatory role
on the enzyme level, Sec14p was shown to contribute to the
regulation of phospholipid biosynthesis at the transcrip-
tional level [6]. Nevertheless, despite the accumulating
evidence [7,8] and even the elucidation of the crystal
structure of Sec14p [9], the function of Sec14p at the
molecular level in processes related to lipid metabolism
remained obscure.

The yeast genome contains five genes named SFH1-5
(SEC fourteen homologues) whose products exhibit signi-
ficant sequence homology to Sec14p (Table 1). Initial
characterization of these Sec14 homologues [10] revealed
that four of them are novel PITPs exhibiting PtdIns but not
PtdCho transfer activity. High expression levels of Sfh2p,
Sfh4p, and Sfh5p through a strong constitutive yeast
promoter led to suppression of sec14-related growth and
secretion defects. Deletion of two Sec14 homologues,
namely Sfh3p and Sfh4p (previously named Pdr16p and
Pdr17p, respectively), resulted in sensitivity against several
drugs [11]. This effect was most obvious in a sfh3D sfh4D
double mutant. Both mutations caused significant changes
of the lipid composition of the plasma membrane: deletion
of SFH3 had a pronounced effect on the sterol composition,
and deletion of SFH4 resulted in alterations of the
phospholipid pattern [11]. Recently, the SFH4 gene product
was identified as a component involved in the intracellular
transport of phosphatidylserine to its site of decarboxyla-
tion by Psd2p [12]. In addition, Sfh2p (also named Csr1p)
was identified as a multicopy suppressor of a mutant
defective in chitin synthesis and cell morphogenesis [13].
To obtain more insight into the physiological role of the
Sec14 homologues, we performed extended studies testing
the ability of these homologues to complement sec14 growth
and secretion defects, investigated the phenotype of sfh
deletion mutants with respect to growth on various carbon
Correspondence to Peter Griac
ˇ
, Institute of Animal Biochemistry and

Genetics, Slovak Academy of Sciences, 900 28 Ivanka pri Dunaji,
Slovak Republic. Fax: + 421 2 45943032, Tel.: + 421 2 45943151,
E-mail:
Abbreviations: Cho, choline; GroPCho, glycerophosphocholine; Ins,
inositol; Pld1p, phospholipase D1; PITP, phosphatidylinositol trans-
fer protein; PtdCho, phosphatidylcholine; PtdIns, phosphatidyl-
inositol; PtdSer, phosphatidylserine; SFH, Sec14 homologue;
yEGFP, yeast enhanced green fluorescent protein;
YPD, yeast extract/peptone/ dextrose.
(Received 19 March 2003, revised 9 May 2003,
accepted 27 May 2003)
Eur. J. Biochem. 270, 3133–3145 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03688.x
sources and sensitivity to drugs, and determined the lipid
composition of the respective deletion strains. To correlate
not only the function of Sec14 homologues to that of
Sec14p, but also to compare the sites of action of these
polypeptides, C-terminal fusions of Sfh-proteins with
yEGFP were constructed and the localization of the
proteins in the yeast cell was determined.
The enzyme catalyzing deacylation of PtdCho in S. cere-
visiae is a phospholipase B encoded by the PLB1 gene [14].
In a previous study [15] we observed increased glycero-
phosphocholine (GroPCho) release in a sec14
ts
mutant at
the nonpermissive temperature. This observation is in line
with the involvement of Sec14p in regulation of phospho-
lipid metabolism. Here we demonstrate that overexpression
of Sec14p, Sfh2p or Sfh4p resulted in reduced release of
GroPCho. We also show that Sfh2p and Sfh4p stimulate

phospholipase D1 (Pld1p) activity in contrast to Sec14p,
which had been shown previously to inhibit the activity of
this enzyme [10]. Thus, Sec14p and its homologues appear
to form a network of proteins involved in the regulation of
phospholipid metabolism.
Materials and methods
Strains and culture conditions
Yeast strains used in this study are listed in Table 2. Cells
were grown on yeast extract/peptone/dextrose (YPD;
2% glucose) media unless otherwise stated. Growth tests
on fermentable and nonfermentable carbon sources were
performed on solid media containing 1% yeast extract, 2%
peptone, and 2% agar supplemented with 2% glucose,
lactate or ethanol, respectively. For drug resistance assays
on solid media, drugs were added to the media immediately
prior to pouring plates as described by van den Hazel et al.
[11]. Chemically defined synthetic media lacking inositol
and choline (Ins–/Cho–) or supplemented with 75 l
M
inositol and 1 m
M
choline (Ins+/Cho+) were prepared
as described previously [16].
Plasmid and strain construction
Standard genetic methods were used throughout the work
[17]. Yeast transformation was performed by the lithium
acetate method [18].
Plasmids. Episomal plasmids containing SEC14 and its
homologues under their own promoters were constructed
on the basis of a 2 lm plasmid YEplac181 [19] as follows:

SEC14 gene was subcloned from an ATCC 3723 genomic
library plasmid (identified in an unrelated experiment)
using XbaIandNsiI restriction sites into XbaI/PstIrestric-
tion sites of YEplac181, creating plasmid YEplac181-
SEC14. The subcloned SEC14 gene region contains
638 bp of upstream promoter region of the SEC14 gene
and 879 bp downstream of SEC14.TheSFH1 ORF
region was generated by PCR using FY1679 chromo-
somal DNA as a template. PCR primers were 5¢-GGCAT
GTGGGTGAATTACAA-3¢ and 5¢-TTTGGGCCGGTT
CATTGTT-3¢. The generated DNA fragment was cut by
SacIandPstI restriction enzymes and subcloned into SacI/
PstI sites of YEplac181, creating plasmid YEplac181-
SFH1. Subcloned SFH1 fragment contains 694 bp of
upstream promoter region of SFH1 and 266 bp down-
stream of SFH1. SFH2 was subcloned from an ATCC
37323 genomic library plasmid (identified in an unrelated
experiment) using NsiI restriction sites to PstIrestriction
site of YEplac181, creating plasmid YEplac181-SFH2.
Subcloned SFH2 region contains 527 bp of upstream
promoter region of SFH2 and 745 bp downstream of
SFH2. SFH3 was subcloned from plasmid pBVH1355 [11]
using SacI, SalI restriction sites into respective sites of
YEplac181, creating plasmid YEplac181-SFH3. SFH4
was subcloned from plasmid pBVH1410 [11] using SacI,
KpnI restriction sites into the same restriction sites of
YEplac181, creating plasmid YEplac181-SFH4. Subcloned
SFH4 gene region contains 598 bp of upstream promoter
region of SFH4. SFH5 was subcloned from plasmid
pYCG-YJL145W (kindly provided by D. Alexandraki,

University of Crete, Heraklion, Greece) using XbaI
restriction sites into the same site of YEplac181, creating
plasmid YEplac181-SFH5. Subcloned SFH5 region con-
tains 949 bp of upstream promoter region of SFH5 and
167 bp downstream of SFH5. To create multicopy
plasmids with the URA3 gene as a yeast selective marker,
SEC14, SFH2,andSFH4 were subcloned into plasmid
YEplac195 [19].
Gene disruptions. All Sec14 homologues gene disruptions
were made in the FY1679–28c genetic background.
The mutants sfh3D and sfh4D were kindly provided
by A. Goffeau (Catholic University Louvain, Louvain la
Neuve, Belgium) [11], and sfh5D was obtained from
D. Alexandraki (University of Crete, Heraklion, Greece).
The strains sfh1D and sfh2D were constructed using a
kanMX4 module in a two step PCR synthesis to produce
marker DNA flanked by long homology regions [20].
Primers used for the construction of the respective deletions
andtoverifycorrectdeletionsarelistedinTable3.
Sfh-yEGFP hybrids. All GFP constructs were generated in
diploid FY1679 and in haploid FY1679–28c strains using
homologous recombination. The transforming DNA was a
linear PCR fragment (primers P1 and P2, Table 4) using
plasmid pMK199 (C-fus-GA5-yEGFP-kanMX6, kindly
provided by P. Philippsen, Biocenter University Basel,
Switzerland) as a template [21]. This PCR created yEGFP-
kanMX6 DNA sequences flanked by the last 65–70
Table 1. SEC14 and SFH genes.
Accession
number

Gene
Name
Alternative
gene names
% Identity
to SEC14
YMR079W SEC14
YKL091C SFH1* 62.5
YLR380W SFH2 CSR1 20.7
YNL231C SFH3 PDR16 21.7
YNL264C SFH4 PDR17, ISS1, PSTB2 19.4
YJL145W SFH5 16.1
* In databases another SFH1 gene (ORF YLR321c) is referred.
This gene product, which is homologous to Snf5p and involved in
chromatin modeling and cell cycle progression, is not related to
SFH1 (ORF YKL091) described in this study.
3134 M. Schnabl et al. (Eur. J. Biochem. 270) Ó FEBS 2003
Table 2. Yeast strains.
Name Genotype Source
PGY57 MATa ura3, his3, leu2, trp1, pld1::URA3, cki1::HIS3, sec14–1
ts
S. Henry [5]
PGY84 MATa leu2, trp1, lys2, ura3, his3, sec14–1
ts
This work
CTY1–1 A MATa ura3, lys2, his3, sec14–1
ts
V. Bankaitis [3]
CTY393 MATa ura3, lys2, his3, cki1::HIS3 V. Bankaitis [3]
CTY392 MATa ura3, lys2, his3, sec14–1

ts
, cki1::HIS3 V. Bankaitis [3]
PGY188 MATa ura3, lys2, his3, sec14–1
ts
, cki1::HIS3, [YEp195-SFH2] This work
PGY206 MATa ura3, lys2, his3, sec14–1
ts
, cki1::HIS3, [YEp195-SFH4] This work
PGY207 MATa ura3, lys2, his3, sec14–1
ts
, cki1::HIS3, pld1::kanMX4, [YEp195-SFH4] This work
JAGwt MATa his3, leu2, trp1, ura3 S. Henry [5]
S3 MATa leu2, his3, ura3, pct1::URA3, sec14::kanMX This work
S7 MATa ade, trp1, his3, ura3, leu2, cki1::HIS3, sec14::kanMX This work
PGY160 MATa leu2, his3, ura3, pct1::URA3, sec14::kanMX, [YEp181-SFH1-yEGFP] This work
PGY159 MATa leu2, his3, ura3, pct1::URA3, sec14::kanMX, [YEp181-SFH2-yEGFP] This work
PGY126 MATa ura3, his3, cki1::HIS3, sec14::kanMX S. Henry [5]
PGY145 MATa leu2, his3, trp1, ura3, cki1::HIS3, sec14::kanMX This work
PGY143 MATa leu2, trp1, lys2, ura3, his3, sec14–1
ts
, [YEp181] This work
PGY137 MATa leu2, trp1, lys2, ura3, his3, sec14–1
ts
, [YEp181-SEC14] This work
PGY138 MATa leu2, trp1, lys2, ura3, his3, sec14–1
ts
, [YEp181-SFH1] This work
PGY140 MATa leu2, trp1, lys2, ura3, his3, sec14–1
ts
, [YEp181-SFH2] This work

PGY139 MATa leu2, trp1, lys2, ura3, his3, sec14–1
ts
, [YEp181-SFH3] This work
PGY141 MATa leu2, trp1, lys2, ura3, his3, sec14–1
ts
, [YEp181-SFH4] This work
PGY142 MATa leu2, trp1, lys2, ura3, his3, sec14–1
ts
, [YEp181-SFH5] This work
FY 1679–28c MATa ura3, leu2, his3, trp1 A. Goffeau [11]
PGY151 MATa ura3, leu2, his3, trp1, sec14::SEC14-yEGFP This work
PGY152 MATa ura3, leu2, his3, trp1, sfh1::SFH1-yEGFP This work
PGY123 MATa ura3, leu2, his3, trp1, sfh2::SFH2-yEGFP This work
PGY154 MATa ura3, leu2, his3, trp1, sfh3::SFH3-yEGFP This work
PGY125 MATa ura3, leu2, his3, trp1, sfh4::SFH4-yEGFP This work
PGY156 MATa ura3, leu2, his3, trp1, sfh5::SFH5-yEGFP This work
PGY128 MATa ura3, leu2, his3, trp1, sfh3::hisG A. Goffeau [11]
PGY129 MATa ura3, leu2, his3, trp1, sfh4:: HIS3 A. Goffeau [11]
PGY130 MATa ura3, leu2, his3, trp1, sfh3::hisG sfh4::HIS3 A. Goffeau [11]
PGY95 MATa ura3, leu2, his3, trp1, sfh1::kanMX4 This work
PGY91 MATa ura3, leu2, his3, lys2, sfh5::kanMX4 EUROFAN collection,
Frankfurt, Germany
PGY90 MATa ura3, trp1, leu2, sfh5::kanMX4 EUROFAN collection,
Frankfurt, Germany
PGY102 MATa ura3, leu2, his3, trp1, sfh2::kanMX4 This work
Table 3. Primers for construction of sfh1D and sfh2D. Sequences homologous to kanMX module are underlined.
Location Name Primer
5¢ upstream of SFH1 SFH1/1D 5¢-ATGAAAAGAGGTCGGCATAG-3¢
SFH1/1R 5¢-
AGCTAAACAGATCTGGCGCGCCTTAAGTATGCTGGTTGTCATTCTTCC-3¢

Downstream of SFH1 SFH1/2D 5¢-
GTCGAAAACGAGCTCGAATTCATCGAGATACATCGGACCAGAAGGTG-3¢
SFH1/2R 5¢-CAGTCTGACCGAGTAGTTATTCC-3¢
Control primer 5¢ upstream of SFH1 SFH1/3D 5¢-CAAACCTGCTATTGGGACCC-3¢
Control primer inside SFH1 SFH1/3R 5¢-GTGTTGGCACCGTATTCTTCC-3¢
5¢ upstream of SFH2 SFH2/1D 5¢-ACGAGGCGGTCTCTGTTCTCTG-3¢
SFH2/1R 5¢-
AAGCTAAACAGATCTGGCGCGCCTTATGCTTTTATGCTTCTGTGTGCG-3¢
Downstream of SFH2: SFH2/2D 5¢-
GTCGAAAACGAGCTCGAATTCATCGACCACGCGACGCTCCATACTG-3¢
SFH2/2R 5¢-GGTGGCGTTCGTTCGTTAGC-3¢
Control primer 5¢ upstream of SFH2 SFH2/3D 5¢-GCTACTTGTGCCGTTGACAGC-3¢
Control primer inside SFH2 SFH2/3R 5¢-TAGAGGTGTGCCGCTTCAGC-3¢
Control primer inside kanMX4 gene kanMX/R 5¢-
CCAACAAATACAAGCCTACAC-3¢
Ó FEBS 2003 Yeast SEC14 homologues (Eur. J. Biochem. 270) 3135
Table 4. Primers used to generate and test C-terminal yEGFP fusions. All primers are in 5¢ to 3¢ orientation. Sequences homologous to pMK199 plasmid are underlined.
P1(SEC14) TATCGGTCCATGGAGGGATCCAAAGTATATTGGACCGGAAGGTGAAGCTCCGGAAGCCTTTTCGATGAAAGGAGCAGGTGCTGGTGCTG
P2(SEC14) CAGTTGTAAAATATCGTTACTTAGAACTCCTCTTTTCTCTCTCGAAAAAAAAATGTCTTTAAAAATAATA
TCGATGAATTCGAGCTCGTTTAAAC
KP1(SEC14) CGCCATTCGGTTTCTCTACC
KP2(SEC14)
AGGTTGGCCATGGAACTGG
P1(SFH1) GAGAGACCCTAGATACATCGGACCAGAAGGTGAAATTCCCAACATTTTTGGTAAATTTACTGTTACCAGC
GGAGCAGGTGCTGGTGCTG
P2(SFH1) CAGAGATATACATATTATAGAGTATGCATGCTATATTCACGGAAAGCTACGACGAAGGCCTGTATCATAG
TCGATGAATTCGAGCTCGTTTAAAC
KP1(SFH1) CTTCTTGGATCCAGTAACCGTGTC
KP2(SFH1)
AGGTTGGCCATGGAACTGG

F(SFH1-EGFP) GGCATGTGGGTGAATTACAA
R(SFH1-EGFP) GACGAGGCAAGCTAAACAGAT
P1(SFH2) AAACTACTCCAAGTTAGATCCGTACATCAGATCAAGATCCGTTTATGACTACAATGGTTCTCTAAAAGTT
GGAGCAGGTGCTGGTGCTG
P2(SFH2) AGGGACATATAAAGAAATAGATGTTTTTATAATAAAGGTCTATACAGTATGGAGCGTCGCGTGGCTTGGCTCGATGAATTCGAGCTCGTTTAAAC
KP1(SFH2) TCCAACCCCAATACATCCCT
KP2(SFH2)
GGTCAATTTACCGTAAGT
F(SFH2-EGFP) TCGGAATCCAGATGCATTTC
R(SFH2-EGFP) GACGAGGCAAGCTAAACAGAT
P1(SFH3) AAGTGAGGTTGATTTAAGAGGTACTCATGAAAAACTTCTTTACCCAGTAAAATCGGAAAGCAGTACCGTG
GGAGCAGGTGCTGGTGCTG
P2(SFH3) ATTAAACTTTTTATTCTCTTTTATTTATTATATATTATAGTGCATTATCATTATCTATCTAAATTTGCCTTCGATGAA
TTCGAGCTCGTTTAAAC
KP1(SFH3) CCCTTTTATTGACCCACTGACC
KP2(SFH3)
AGGTTGGCCATGGAACTGG
P1(SFH4) TGTCGGATTAAGTGAATATGACACCAAGGGCCAACATGACGAATTAAAATATCCTGTTGATATGGTCATT
GGAGCAGGTGCTGGTGCTG
P2(SFH4) ACATCTGAGTCTAGATATATACGTTTGTGTAGCGGGAAACGTTAAAAAAAAAAATCTTAATTATAGTTTATCGATGAATTCGAGCTCGTTTAAAC
KP1(SFH4) GCTCCACCCATCTCTATTGC
KP2(SFH4)
GGTCAATTTACCGTAAGT
P1(SFH5) TGTCACAAATGTCCATCCAACAGAATACGGCCTTTACATTTTACAAAAACAAATCATCGAGGACGTTGAG
GGAGCAGGTGCTGGTGCTG
P2(SFH5) AATATAAGGCAAAAATAAGAAATTATTATAGGGTTTATATAAGAGACTATTATTAGATCATGCCAACAAA
TCGATGAATTCGAGCTCGTTTAAAC
KP1(SFH5) AATGTCCCCACCGTTTTCG
KP2(SFH5)
AGGTTGGCCATGGAACTGG

3136 M. Schnabl et al. (Eur. J. Biochem. 270) Ó FEBS 2003
nucleotides upstream of the STOP codon of the ORF of
interestandonthe3¢ end, 65–70 nucleotides of the genomic
region downstream of the ORF of interest. Transformants
were recovered based on their geneticine (G418) resistance,
and the correct integration was verified by PCR with a pair
of primers, one inside the yEGFP sequence (primer KP2,
Table 4) and the other one inside the ORF of interest
(primer KP1). The described procedure generated integra-
tive versions of C-terminal yEGFP fusions in frame with the
ORF of interest. Thus, yEGFP fusions were present in
single copy in the genome and driven by the native promoter
of the ORF of interest.
In order to construct episomal SFH1-yEGFP and SFH2-
yEGFP fusions for functional studies, the respective DNA
fragments were PCR amplified from chromosomal DNA
and cloned into the high-copy number plasmid YEplac181
[19]. Using primers F(SFH1-EGFP) and R(SFH1-EGFP)
(Table 4) a 2663 bp SFH1-EGFP PCR fragment was
generated, cut with PstIandBglI and inserted into the
respective sites of YEplac181. Similarly, the SFH2-yEGFP
DNA fragment was generated by PCR from the chromo-
somal DNA of a strain containing the integrative version
of the SFH2-yEGFP using primers F(SFH2-EGFP) and
R(SFH2-EGFP). This 2778 bp PCR fragment was cut with
NsiIandBglII restriction enzymes and inserted into PstI
and BamHI sites of YEplac181.
Fluorescence microscopy
Cultures of cells harboring GFP constructs were grown over
night in liquid media and collected by brief centrifugation.

Cell suspension (0.5 lL) was mounted on a cover slip under
a sheet of 0.8% agarose, as described by Kohlwein [22].
Fluorescence was analyzed by confocal laser scanning
microscopy using Leica TCS4d and SP2 AOBS 2p confocal
microscopes. GFP fluorescence was monitored at 488 nm
excitation by using a 525/50 band pass filter. Staining with
Nile red and DAPI (4¢,6¢-diamidino-2-phenylindole) was
performed by adding the dyes to the agarose sheet
(1 lgÆmL
)1
and 10 lgÆmL
)1
, respectively). Nile red fluores-
cence was excited at 488 nm and detected with a LP560 nm
long pass filter; DAPI fluorescence was monitored using a
Mai Tai pulsed IR laser tuned to 750 nm for 2 photon
excitation, and detection at 450–480 nm.
Isolation and characterization of yeast subcellular
fractions
Yeast mitochondria were isolated by published procedures
[23]. Microsomal fractions were prepared from the post-
mitochondrial supernatant that had been cleared of small
mitochondria by centrifugation for 30 min at 20 000 g in an
SS-34 rotor (Sorvall). The resulting supernatant was sub-
jected to successive steps of differential centrifugation at
30 000, 40 000, and 100 000 g [24]. The 100 000 g super-
natant contains the cytosolic proteins. Lipid particles were
isolated as described by Leber et al.[25].Nucleiwere
prepared as described by Hurt et al. [26].
Proteins were precipitated from the aqueous phase using

trichloroacetic acid (10% final concentration). The protein
pellet was solubilized in 0.1% SDS, 0.1% NaOH. Protein
was quantified by the method of Lowry et al.[27],using
bovine serum albumin as the standard. SDS/PAGE was
carried out by the method of Laemmli [28]. Samples were
dissociated at 37 °C. Western blot analysis was carried out
after separating proteins using a 12.5% SDS/PAGE and
transferring to nitrocellulose filters (Hybond-C, Amersham,
Arlington Heights, IL, USA) [29,30]. GFP-tagged proteins
were detected using mouse anti-GFP as the first antibody
and goat anti-mouse Ig linked to peroxidase as the second
antibody.
Lipid analysis of whole cell extracts
Cells were homogenized for 3 min under CO
2
cooling in the
presence of glass beads using a Merckenschlager Homo-
genizer (Braun, Melsungen, Germany). Lipids of whole
yeast cells were extracted by the procedure of Folch et al.
[31], and individual phospholipids were separated by two-
dimensional thin-layer chromatography on silica gel 60
plates (Merck, Darmstadt, Germany) using chloroform/
methanol/25% NH
3
(65 : 35 : 5, v/v/v) as the first, and
chloroform/acetone/methanol/acetic acid/water (50 : 20 :
10 : 10 : 5 v/v/v/v/v) as the second developing solvent.
Phospholipids on plates were visualized by staining with
iodine vapor, scraped off and quantified by the method of
Broekhuyse [32].

Alkaline hydrolysis of lipid extracts was carried out as
described elsewhere [33]. Individual sterols were analyzed by
gas–liquid chromatography on a Hewlett Packard HP 5890
equipped with a flame ionization detector operated at
320 °C using a capillary column (HP5, 30 m · 0.32 mm ·
0.25 lm film thickness). After a 1 min hold at 50 °Cthe
temperature was increased to 310 °Cat10°CÆmin
)1
.The
final temperature was held for 10 min. Nitrogen was used as
a carrier gas and 1 lL aliquots of samples were injected cool
on column. Relative retention times of sterols were similar
as described previously [34–36].
Analysis of water soluble lipid degradation products
in the growth medium
Strains expressing Sec14 homologues from multicopy
plasmids in a sec14
ts
background were pregrown for 48 h,
transferred into 10 mL of fresh synthetic medium (2%
glucose, 50 l
M
choline and 50 l
M
inositol) to D
600
¼
0.05 and incubated for 1 h at 24 °C. Then, 20 lCi of
[methyl-
14

C]choline chloride and 10 lCi of myo-[2-
3
H]ino-
sitol (NEN Life Science Products) were added, and the
incubation was continued for 14 h at 24 °C to label PtdCho
and PtdIns. Cells were collected by centrifugation, washed
three times with 5 mL sterile cold water, and resuspended in
10 mL of fresh medium supplemented with unlabeled
choline, inositol, GroPCho, and GroPIns, 100 l
M
each.
Then, each cell culture was divided into two parts of 5 mL
and cultivated for another 6 h at 24 °Cor37°C, respect-
ively. Aliquots were removed at time zero and after 6 h cells
were precipitated by centrifugation, and radioactivity of
supernatants was determined by liquid scintillation count-
ing. The secretion products inositol, inositol phosphate, and
GroPIns were isolated by anion exchange chromatography
(AG1-X2, 200–400 mesh, Bio-Rad) as described by Haw-
kins et al. [37]. Radioactivity in GroPCho and choline was
determined after separation on a cation exchange column
Ó FEBS 2003 Yeast SEC14 homologues (Eur. J. Biochem. 270) 3137
Dowex 50 WX 8 (200–400 mesh, Serva) as described by
Cook and Wakelam [38].
PtdCho turnover in a cki1 genetic background was
analyzed as reported earlier [6,39]. Yeast strains were grown
overnight at 37 °C in 2 mL Ins–/Cho– media containing
1 lCiÆmL
)1
[methyl-

14
C]choline chloride. Cultures were
harvested during mid logarithmic growth phase, washed
twice with sterile distilled water and resuspended in 5 mL of
fresh unlabeled Ins–/Cho– media. At time points indicated,
1.4 mL of the cultures were removed and cells were
precipitated by centrifugation. The supernatant was saved
as the medium fraction. The cell pellet was suspended in
0.5 mL of 5% trichloroacetic acid and incubated on ice for
20 min. After centrifugation, the supernatant was saved as
the intracellular water-soluble fraction. The pellet was
resuspended in 0.5 mL of 1
M
Tris buffer, pH 8, centri-
fuged, and the resulting supernatant was combined with the
intracellular water-soluble fraction effectively neutralizing
the acidic extract. The final pellet was saved as the total
membrane fraction. To solubilize the cell pellet it was
suspended in 100 lL of 1% Triton X-100, frozen at )70 °C
and incubated in the presence of 10% deoxycholate
overnight at 37 °C. Radioactivity of all fractions was
determined by liquid scintillation counting.
Results
Complementation of the
sec14
growth defect
by overexpressed Sec14 homologues
As shown previously [10], some Sec14 homologues when
placed under the transcriptional control of the powerful and
constitutive yeast phosphoglycerate kinase promoter are

able to complement the sec14
ts
growth defect. Results
presented here (Table 5) extend these findings by showing
the effect of individual Sec14 homologues expressed from
their own promoters on a sec14
ts
defect in two genetic
backgrounds, namely in a strain bearing the sec14–1
ts
allele
(PGY84) and in a sec14–1
ts
cki1 pld1 (PGY57) triple
mutant. Our data confirmed the previous finding that SFH2
and SFH4 overexpression complemented the growth defect
of the sec14–1
ts
strain in a most efficient way. In our
hands, however, also SFH1-overexpression suppressed the
sec14–1
ts
associated growth defect to a low but significant
degree. In the sec14–1
ts
cki1 pld1 background SFH2-
overexpression and, less efficiently, SFH1-overexpression
rescued the growth defect. Interestingly, SFH4-overexpres-
sion did not suppress the growth defect of the sec14–1
ts

cki1
pld1 strain under restrictive conditions, indicating that
functional phospholipase D1 or a functional CDP-choline
pathway are necessary to manifest the activity related to
Sfh4p.
We also performed complementation experiments using
yeast strains with a sec14 deletion. As sec14 deletion
mutants are not viable, bypass mutations causing dys-
function of the CDP-choline pathway of PtdCho biosyn-
thesis [3] had to be introduced. Thus, strains S3 (sec14D
pct1D) and S7 (sec14D cki1D) (Table 2) were viable due to
a combination of sec14D with mutations in phospho-
choline:CTP cytidylyltransferase (pct1) or choline kinase
(cki1), respectively. Diploids sec14D/sec14D CKI1/cki1D
pct1D/PCT1, obtained by the genetic cross of S3 and S7
strains failed to grow, because these diploids are homo-
zygous for the sec14D allele but heterozygous for both
recessive suppressors cki1D and pct1D, unless an intact
SEC14 gene or an efficiently complementing Sec14 homo-
logue were introduced. As can be seen from Fig. 1, only
overexpression of Sfh2p, Sfh4p and, to a lesser extent,
Sfh1p yielded viable diploids.
Phenotype analysis of yeast mutants deleted
of
SEC14
homologous genes
None of the five SEC14 homologues is essential for growth
under standard conditions [10]. Variation of growth tem-
perature and carbon sources, however, resulted in changes
of the growth behavior of sfh mutant strains (Table 6).

Most significantly, sfh3D and sfh4D, and especially the sfh3D
sfh4D double mutant (previously characterized as pdr16D
pdr17D) exhibited reduced growth rates at low temperature.
Thus, these mutants are not only drug sensitive as shown
before [11], but also cold sensitive. Moreover, the sfh3D
sfh4D double mutant failed to grow on ethanol at all
temperatures. The sensitivity against ethanol might result
from changes in the plasma membrane lipid composition
[11]. Among the five strains deleted of Sec14 homologues,
only sfh3D (pdr16D)andsfh4D (pdr17D)andthesfh3D sfh4D
Table 5. Complementation of the se c1 4
ts
growth defect by overexpres-
sion of Sec14 homologues. The sec14–1
ts
(PGY 84) and sec14–1
ts
cki1
pld1 (PGY 57) strains were transformed with yeast multicopy plasmids
containing individual Sec14 homologues under their own promoters.
Rate of growth at 37 °C (nonpermissive temperature for sec14–1
ts
)in
YPD was used as a measure to determine the ability of the homologues
to rescue the sec14–1
ts
associated growth defect.
sec14
ts
sec14

ts
cki1 pld1
SEC14 +++ +++
SFH1 ++
SFH2 +++ ++
SFH3 ––
SFH4 ++ –
SFH5 ––
YEplac181 (control) – –
Degree of complementation: + + +, very good; + +, good; +,
weak; –, no complementation.
Fig. 1. Complementation of the sec14D growth defect by Sec14 homo-
logues. Strain S3 (sec14D pct1D) transformed with individual Sec14
homologues was crossed with the S7 (sec14D cki1D) strain and replica
plated to selective medium. Diploids grew only when the respective
Sec14 homologue complemented the growth defect caused by the sec14
deletion.
3138 M. Schnabl et al. (Eur. J. Biochem. 270) Ó FEBS 2003
double mutant turned out to be sensitive against various
drugs such as miconazole, terbinafine, edelfosine, and
4-nitroquinoline-N-oxide (data not shown) confirming pre-
vious results from our laboratory [11]. Similarly, only
deletions of SFH3 and SFH4 caused significant changes of
the lipid composition of plasma membrane and total cell
extracts as reported earlier [11].
Subcellular localization of the Sec14p homologues
To determine the subcellular localization of Sec14p homo-
logues we constructed C-terminal chromosomal fusions of
individual Sec14 homologues with yEGFP, expressed under
control of their native promoters. To confirm functionality

of the hybrids, we performed complementation tests as
follows: SFH3-yEGFP and SFH4-yEGFP fusions rescued
the miconazole sensitivity [11] of sfh3D (pdr16D)andsfh4D
(pdr17D) strains (Fig. 2A); overexpression of SFH1-yEGFP
and SFH2-yEGFP complemented the sec14D growth defect
similarly to overexpression of SFH1 and SFH2 (Fig. 2B).
As SFH5 is not complementing the sec14 defect in an
efficient way no such tests could be performed for this Sec14
homologue to proof functionality of the GFP fusion.
Laser scanning fluorescence microscopy of strains bear-
ing yEGFP fusions showed presence of SEC14-yEGFP
mainly in the cytosol (Fig. 3). Similarly, SFH2-yEGFP,
SFH4-yEGFP and SFH5-yEGFP localized mainly to the
cytosol, but SFH4-yEGFP and SFH5-yEGFP were also
visualized at the cell periphery close to or at the plasma
membrane. Localization of SFH2-yEGFP in punctuate
structures identified earlier as endosomes [10] were also
observed in our investigation, although less pronounced.
SFH3-yEGFP was localized to lipid particles and at the cell
periphery (plasma membrane) and SFH1-yEGFP was
found mainly in the nucleus. Localization of the latter
fusion proteins to lipid particles and nuclei was confirmed
by double staining with Nile red (for lipid particles)
(Fig. 4A–C) or DAPI (nucleus) (Fig. 4D–F), respectively.
In addition to fluorescence microscopy, Sfh-yEGFP
hybrids were localized by subcellular fractionation using
standard techniques of organelle isolation [24] and West-
ern blot analysis (Fig. 5). EGFP hybrids of SEC14, SFH2
and SFH5, which were localized mainly to the cytosol by
fluorescence microscopic inspection, were also detected in

the cytosol by Western blot analysis. Significant amounts
of these polypeptides were also found in microsomal
fractions, which correlates with the fluorescence signal in
punctuate intracellular and peripheral structures, the latter
probably representing peripheral endoplasmic reticulum or
plasma membrane [40]. SFH1-yEGFP was localized to
microsomes, cytosol and also to the nucleus although at
minor concentration. This discrepancy between microscopy
and cell fractionation data will be discussed below (see
Discussion). SFH3-yEGFP was localized mainly to micro-
somal fractions and also to lipid particles. Thus, Sfh3p
may be dually located similar to many other lipid particles
proteins [41].
Regulation of phospholipase D1 and phospholipase B1
mediated PtdCho turnover by Sec14p and its
homologues
Previous reports have shown that in S. cerevisiae PtdCho
can be hydrolyzed by phospholipase D1 (Pld1p) to produce
phosphatidic acid and choline [5,6], and by phospholipase
B1 (Plb1p) [14,42] to produce GroPCho and fatty acids.
Sec14p has been previously shown to downregulate Pld1p
activity in yeast cells [5,6,10], whereas homologues of
Sec14p were reported to collectively activate Pld1p [10]. In
our previous work increased GroPCho release was observed
in a sec14
ts
mutant at the nonpermissive temperature [15].
To study the role of individual Sec14 homologues in
phospholipid turnover, strains overproducing Sec14p
and the five homologues were analyzed in the sec14

ts
background.
To assess the role of Sec14 homologues in the regulation
of Pld1p-mediated PtdCho turnover a mutant lacking
choline kinase (cki1), the first enzyme of the CDP-choline
pathway, was employed. Introduction of the cki1 mutation
has two major advantages: (a) sec14
ts
cki1 strains are viable
at the otherwise sec14
ts
nonpermissive temperature of 37 °C
[3]; and (b) cki1 prevents reincorporation of the majority of
released free choline into PtdCho via the CDP-choline
pathway [6]. On the other hand, strains bearing the cki1
mutation have a strongly reduced capacity to incorporate
[
14
C]choline into PtdCho during the labeling period [6].
Ethanolamine kinase, however, can phosphorylate choline
to some extent [43] and is thus responsible for choline
Table 6. Growth characteristics of mutants deleted of SFH genes. Strains were grown on solid media with different carbon sources at different
temperatures as indicated in the Materials and methods section.
Strain
Temperature (°C)
YPD YP lactate YP ethanol
15 30 37 15 30 37 15 30 37
FY 1679–28c ++++++±++
sfh1D ++++++±++
sfh2D ± ++±++ – ++

sfh3D – ++±++ – ++
sfh4D – ++±++ – ++
sfh3Dsfh4D – ++– ±+ – – –
sfh5D ++++++±++
+, good; ±, weak; –, no growth.
Ó FEBS 2003 Yeast SEC14 homologues (Eur. J. Biochem. 270) 3139
phosphorylation and incorporation of [
14
C]choline into
PtdCho of these strains.
After overnight labeling with [
14
C]choline at 37 °Ccells
were shifted to unlabeled medium and grown for additional
6 h at 37 °C. Radioactivity in the membrane associated
pool, i.e. PtdCho, the intracellular water-soluble pool and
the medium was estimated at indicated time points (Fig. 6).
In wild-type cells (Fig. 6A), only a small amount of the label
appeared in the medium after a 6-h chase. SEC14 cki1 cells
(Fig. 6B) showed a steady loss of label from PtdCho with
corresponding appearance of labeled free choline in the
medium [6]. In sec14
ts
cki1 cells (Fig. 6C), the label from
PtdCho was rapidly lost and appeared as free choline in the
medium as a result of Pld1p activation upon inactivation of
Sec14p [5].
In a similar experiment, Sec14 homologues were tested
for their ability to regulate phospholipase D1 mediated
PtdCho degradation. For this purpose, strains overexpress-

ing Sec14 homologues in a sec14
ts
cki1 genetic background
were used. The strain sec14
ts
cki1 bearing the empty cloning
vector YEplac181 showed the same PtdCho turnover
pattern as sec14
ts
cki1 cells, and sec14
ts
cki1 cells with the
control construct YEplac181-SEC14 exhibited the same
PtdCho turnover as SEC14 cki1 (data not shown). Among
the transformants overexpressing the Sec14 homologues
cells containing Sfh2p and Sfh4p exhibited a significan-
tly higher turnover of PtdCho than sec14
ts
cki1 cells
(Fig. 6D,E) as judged from the fast disappearance of the
label in the membrane fraction and the appearance of free
intra- and extracellular choline.
Is this massive choline release into the media result of
enhanced Pld1p activity? To answer this question, PtdCho
turnover in a sec14
ts
cki1 pld1D strain overexpressing Sfh2p
(Fig. 6F) was studied. In this strain, a slow steady loss of the
label from the membrane fraction, representing PtdCho,
was observed with corresponding appearance of label in the

medium. Most of this label was in the form of GroPCho
based on chromatography of the medium on Dowex 50
WX 8 (data not shown). The slow turnover of PtdCho in
the pld1D strain compared to the high level of PtdCho
turnover in the strain with intact PLD1 gene and analysis of
the turnover products indicate that high PtdCho turnover
observed in SFH2 and SFH4 overexpressing cells is linked
to Pld1p activity.
Determination of choline release in a strain overexpress-
ing Sfh-proteins in a sec14
ts
CKI1 background (data not
shown) confirmed the view that Sfh2p and Sfh4p contribute
to the increased Pld1p mediated turnover of PtdCho.
Experiments using [
3
H]inositol as a precursor of PtdIns
revealed that Sec14 homologues did not affect the turnover
of this phospholipid.
Similar to the release of choline, the excretion of
GroPCho was significantly affected by Sec14p and some
of its homologues overexpressed in the sec14
ts
strain at the
restrictive temperature (Fig. 7). In the sec14
ts
strain the
excretion of GroPCho at the nonpermissive temperature
was dramatically increased as compared to a strain trans-
formed with SEC14 representing wild type. Whereas

overexpression of Sfh1p, Sfh3p and Sfh5p did not signifi-
cantly alter the sec14
ts
stimulated secretion of GroPCho,
overproduction of Sfh2p and Sfh4p significantly decreased
the release of GroPCho into the medium. As phospholipase
B1 (Plb1p) is mainly responsible for the cleavage of PtdCho
and the formation of GroPCho [42], the amount of
GroPCho released into the medium represents the rate of
Plb1p mediated turnover of PtdCho. Thus, Sfh2p, Sfh4p
and Sec14p appear to be inhibitors of PtdCho degradation
by Plb1p in vivo. Interestingly, the effect of overexpressed
Sfh2p and Sfh4p was not observed in a SEC14 strain, nor
did strains deleted of SFH2 and SFH4, respectively, in
the SEC14 background exhibit increased Plb1p activity
(data not shown). Thus, it appears that Sec14p is a
Ômaster regulatorÕ of the yeast Plb1p pathway of PtdCho
degradation.
Fig. 2. Sfh-yEGFPs functionally replace original Sfh-proteins. (A)
Drug sensitivity of sfh3D/pdr16D and sfh4D/pdr17D is cured by Sfh3p-
yEGFP and Sfh4p-yEGFP, respectively. Growth of yeast strains with
SFH3-yEGFP or SFH4-yEGFP integrated in their genomes instead of
the wild-type SFH3 or SFH4 genes were tested on YPD plates con-
taining 10 ngÆmL
)1
miconazole. Early stationary phase cultures (3 lL)
and 1 : 10 dilutions of these cultures were spotted onto the miconazole
containing plate. (B) Functionality test of the Sfh1p-yEGFP and
Sfh2p-yEGFP constructs. S3 strain (sec14D pct1D) transformed with
SEC14, SFH1, SFH2 or empty vector (upper lane), and SFH1-yEGFP

or SFH2-yEGFP (lower lane) on the multicopy plasmid YEplac181
was crossed with the strain S7 (sec14D cki1D) and replica plated onto
selective medium. Diploids grew only when Sfh-proteins complemen-
ted the growth defect caused by the sec14 deletion.
3140 M. Schnabl et al. (Eur. J. Biochem. 270) Ó FEBS 2003
Discussion
The goal of this study was to gain insight into the
physiological functions of the family of Sfh proteins that
are homologous to the major yeast PITP Sec14p. For this
purpose, we used (a) mutants deleted of the respective SFH
genes; (b) strains overexpressing Sfh proteins to study their
relationship to Sec14p and their effects on phospholipid
metabolism; and (c) SFH-yEGFP hybrids to investigate
their subcellular distribution.
As reported earlier [10], Sfh2p and Sfh4p are the Sec14
homologues that complement the sec14 growth defect
best. Sfh3p and Sfh5p under the transcriptional control
of their own promoters failed to do so. We also
confirmed an important observation that the comple-
mentation of the sec14 growth defect by Sfh4p depend
on functional phospholipase D1 and/or a functional
CDP-choline pathway. Contrary to results obtained by Li
et al. [10], we show that the polypeptide with the highest
sequence homology to Sec14p, Sfh1p, also complemented
the sec14 related growth defect to some degree (Table 5
and Fig. 1).
Colocalization of Sec14p and its homologues could
explain the complementing effects of Sfh-proteins. Interest-
ingly, proteins which complement the sec14 related growth
defect best are not those with the highest homology to

Sec14p, but those which localize mainly to the cytosol and
microsomes, similar to Sec14p (see Fig. 3), namely Sfh2p
and Sfh4p. Occurrence of Sfh2p in endosomes (contained
in microsomal fractions) as a modulator of Pld1p was
described before by Li et al.[10].TheroleofSfh2p(Csr1p)
as a multicopy suppressor to rescue the chs5 spa2 defect in
cell wall synthesis is supported by its localization, because
Chs5p is a cytosolic component and Spa2p a protein
associated with the cytoskeleton [13]. The localization of
Sfh4p (also named Pdr17p, PSTB2 or PstB2p) is in line with
its role as a regulator of Psd2p, probably as a transporter of
PtdSer from the site of synthesis, the endoplasmic reticulum,
to a Golgi/vacuolar compartment where Psd2p is localized
[12]. Sfh5p is localized to cytosol and microsomes but its
ability under its own promoter to complement the sec14
defect is negligible. Li et al. [10] studied the complementa-
tion effect of Sec14 homologues placed under the control of
the strong constitutive phosphoglycerate kinase promoter.
Fig. 3. Subcellular localization of SFH-yEGFP-fusion proteins by laser scanning fluorescence microscopy. Fluorescence microscopy was carried out
on a confocal microscope as described in the Materials and methods section. Logarithmic phase cultures of cells expressing C-terminal chromo-
somal yEGFP fusions were collected by centrifugation and analyzed as described previously [22]. Left panels: GFP fluorescence; right panels:
Nomarski (DIC) optics. (A) SEC14-yEGFP; (B) SFH1-yEGFP; (C) SFH2-yEGFP; (D) SFH3-yEGFP; (E) SFH4-yEGFP; (F) SFH5-yEGFP.
Scale bar ¼ 5 lm.
Ó FEBS 2003 Yeast SEC14 homologues (Eur. J. Biochem. 270) 3141
Under these circumstances also Sfh5p was able to comple-
ment sec14 related growth defect. This result indicates that
in case of Sfh5p the weak expression from its own promoter,
rather than from Sec14p different localization, is the reason
for the failure of complementation tests. Although Sfh3p
(Pdr16p) is highly homologous to Sfh4p (Pdr17p) (49%

identity and 75% similarity), the localization of the two
polypeptides is different insofar as Sfh3p is present in
significant amounts in lipid particles. Sfh3p (Pdr16p) was
shown to affect sterol metabolism [11], and as lipid particles
and the endoplasmic reticulum are the major locations of
sterol-synthesizing enzymes [44], this Sec14 homologue may
act as a modulator of sterol biosynthesis. A further
interesting link of SFH2 (CSR1) to sterol metabolism was
recently uncovered [45] showing that forced expression of
the SUT1 gene, which is involved in sterol utilization,
suppressed sec14–1
ts
by upregulating SFH2.
An interesting exception among the Sec14 homologues
appears to be Sfh1p, which was associated mainly with the
nucleus by microscopic inspection, and with microsomes,
cytosol and also partially with the nucleus by cell fraction-
ation. Some probability for nuclear localization is also
predicted using the PSORT (Prediction of Protein Sorting
Signals) and Localization Prediction programs from Yale
University ( />[46] supporting the observed GFP-fusion localization pat-
tern. The hydropathy profile of this protein rather predicts
a soluble protein [47]. These features may explain the
apparent discrepancy between our localization data
obtained by microscopy and cell fractionation. Sfh1p is by
far the least abundant polypeptide of this family and, as a
soluble protein, may be washed out from the nucleus during
subcellular fractionation. The localization of Sfh1p resem-
bles the localization of PITP isoform a in higher eukaryotes:
upon microinjection into fetal bovine heart endothelial cells,

PITP-a was predominantly present in the nucleus and in the
cytoplasm [48].
Fig. 4. Laser scanning fluorescence microscopy of strains expressing SFH1-yEGFP and SFH3-yEGFP. Nuclear and mitochondrial DNA were
stained using DAPI, and lipid particles using Nile red, as described previously [22]. (A–C) Strain expressing an Sfh1p-yEGFP fusion. (D–F) Strain
expressing an Sfh3p-yEGFP fusion. (A,D) yEGFP-fluorescence; (B) DAPI staining; (E) Nile red staining; (C,F) Nomarski (DIC) optics. Scale
bar ¼ 10 lm.
Fig. 5. Localization of Sec14 homologues by cell fractionation and
Western blot analysis. Western blot analysis was carried out after
separating proteins using a 12.5% SDS/PAGE and transferring to
nitrocellulose filters. yEGFP tagged proteins were detected using
mouse anti-GFP as the first antibody and goat anti-mouse Ig linked to
peroxidase as the second antibody. 1, homogenate; 2, mitochondria;
3, microsomes 30 000 g;4,microsomes40000g;5,microsomes
100 000 g;6,cytosol;N,nucleus;LP,lipidparticles.
3142 M. Schnabl et al. (Eur. J. Biochem. 270) Ó FEBS 2003
It was shown previously that Sec14p [4–6] and Sec14
homologues collectively [10] contribute to the regulation of
Pld1p. In this study, we show in more detail that Sfh2p and
Sfh4p activate Pld1p in vivo.Inthesec14
ts
strain over-
expression of Sfh2p and Sfh4p increased the Pld1p mediated
PtdCho hydrolysis as judged from the higher level of cho-
line released into the medium (see Fig. 6). Direct physical
interaction of Sfh2p with Pld1p was suggested earlier by Li
et al. [10]. The mode of interaction of Sfh2p and Sfh4p with
Pld1p remains to be demonstrated. As shown previously,
phospholipase D1 activity was required for suppression of
the yeast sec14 defect, and deletion of the PLD1 gene in a
sec14

ts
cki1 strain yielded a strain which was not viable at
the restrictive temperature of 37 °C [4,5]. Thus, it was not
possible to study the dependence of PtdCho turnover
on phospholipase D1 activity in vivo in the sec14
ts
cki1
background. As Sfh2p was able to complement the growth
defect in the sec14
ts
cki1 pld1D mutant and rendered a
sec14
ts
cki1 pld1D SFH2
+
strain viable at 37 °C(Table5),
experiments addressing the role of Pld1p as mentioned
above could be performed. Our results shown in Fig. 6D,F
clearly indicate that Pld1p activity is responsible for
increased PtdCho turnover in SEC14 defective yeast cells
thus supporting the finding that activity of Pld1p in vitro is
enhanced in sec14
ts
strains cultivated at the restrictive
temperature [5]. Conclusively, Sec14p and its homologues
are involved in the complex regulatory network of PtdCho
turnover by decreasing or increasing, respectively, the rate
of degradation of this phospholipid in vivo.Moreover,
Sec14p appears to be involved in the regulation of
phospholipase D2 (Pld2p) as shown recently by Tang

et al. [49].
In addition to regulatory effects of Sec14p and two of its
homologues on Pld1p we observed regulatory effects of
these proteins on phospholipase B1, Plb1p. The product of
Plb1p-catalyzed PtdCho degradation is GroPCho, which
can be released into the medium. Plb1p has a substrate
preference for PtdCho [14,42] in contrast to other yeast
phospholipases B. Here we show that functional Sec14p
does not permit high Plb1p activity thus keeping the level
of GroPCho excretion low (see Fig. 7). In contrast,
formation of GroPCho by Plb1p is highly enhanced in
the sec14
ts
mutant. Similar to Sec14p, overexpression of
Sfh2p and Sfh4p reduced GroPCho formation, indicating
that Sec14p and the two homologues act as inhibitors of
Plb1p in vivo. This observation explains at least in part the
low Plb1p activity in wild-type cells. Interestingly, the
inhibitory effect of Sfh2p and Sfh4p overproduction
became only evident in the absence of Sec14p. Thus,
Sec14p appears to overrule its two homologues as inhibitor
of Plb1p.
Previous studies [2–4,8–10,12] and this investigation
unveiled features which can be regarded as characteristic
for Sec14p: ability to bind/transfer PtdIns, ability to bind/
transfer PtdCho, regulatory effect on PtdCho turnover
through modulation of Pld1p activity, regulatory effect on
PtdCho turnover by inhibition of Plb1p, and subcellular
localization to the cytosol and microsomes (Golgi). When
we compare the five Sec14 homologues to Sec14p by these

criteria, and include the ability of Sfh proteins to comple-
ment the sec14 growth defect, a picture emerges which
allows us to estimate the functional similarity within the
Sec14/Sfh protein family. As can be seen from Fig. 8, Sfh2p
and Sfh4p are the closest functional homologues to Sec14p,
Fig. 6. Phosphatidylcholine turnover in strains overexpressing Sfh-
proteins. Yeast cultures were grown overnight at 37 °CinIns–/Cho–
medium containing 1 lCiÆmL
)1
[methyl-
14
C]choline chloride to
mid-logarithmic stage of growth. At time point zero cells were washed
and resuspended in fresh unlabeled Ins–/Cho– medium. Data repre-
sent percent of total radioactivity in the medium (d), in the intra-
cellular water-soluble fraction (j), and in the membrane associated
fraction (m). Total radioactivity incorporated into strains deleted of
the CKI1 gene was 10–15% compared to the incorporation in the
wild-type strain. (A) wild type; (B) SEC14 cki;(C)sec14
ts
cki1;(D)
sec14
ts
cki1 – YEplac195-SFH2;(E)sec14
ts
cki1 – YEplac195-SFH4;
(F) sec14
ts
cki1 pld1-YEplac195-SFH2. Data on panels D, E and F
are the average of three independent experiments.

Fig. 7. Release of GroPCho into the growth medium. Pulse-chase
labeling experiments using [methyl-
14
C]choline chloride as a PtdCho
precursor were performed as described in the Materials and methods
section. Media were collected after 6 h of chase, and the radioactivity
in GroPCho was estimated after chromatographic separation of water-
soluble products. Values are percent of total radioactivity per A
600
at
time point zero. Black bars: 24 °C (permissive temperature; hatched
bars: 37 °C (nonpermissive temperature). Mean values of two inde-
pendent experiments are shown.
Ó FEBS 2003 Yeast SEC14 homologues (Eur. J. Biochem. 270) 3143
followed by Sfh5p, Sfh3p and Sfh1p. It is surprising that
Sfh1p, which exhibits highest sequence homology to
Sec14p, appears at the end of this list. Although moderate
complementation of sec14 by SFH1 was observed, the
known biochemical and cell biological features of the
respective gene products practically do not overlap. Thus,
we may speculate that despite the multiple properties of
Sec14p that became evident additional ones so far escaped
our attention.
Acknowledgements
The technical assistance of Heimo Wolinski for microscopic studies is
gratefully acknowledged. This study was financially supported by the
following grants: P-12260 and F706 of the Fonds zur Fo
¨
rderung der
wissenschaftlichen Forschung in O

¨
sterreich to FP and SDK, respect-
ively, VEGA 2/1016/21 and Science and Technology Assistance
Agency (Slovak republic) APVT-51-016502 grants to PG, and the
Ost-West project of the Austrian Ministry of Education, Science and
Culture to G.D.
References
1. Szolderits,G.,Hermetter,A.,Paltauf,F.&Daum,G.(1989)
Membrane properties modulate the activity of a phosphatidyl-
inositol transfer protein from the yeast, Saccharomyces cerevisiae.
Biochim. Biophys. Acta 986, 301–309.
2. Bankaitis, V.A., Aitken, J.R., Cleves, A.E. & Dowhan, W. (1990)
An essential role for a phospholipid transfer protein in yeast Golgi
function. Nature 347, 561–562.
3. Cleves, A.E., McGee, T.P., Whitters, E.A., Champion, K.M.,
Aitken, J.R., Dowhan, W., Goebl, M. & Bankaitis, V.A. (1991)
Mutations in the CDP-choline pathway for phospholipid bio-
synthesis bypass the requirement for an essential phospholipid
transfer protein. Cell 64, 789–800.
4. Xie, Z., Fang, M., Rivas, M.P., Faulkner, A.J., Sternweis, P.C.,
Engebrecht, J.A. & Bankaitis, V.A. (1998) Phospholipase D
activity is required for suppression of yeast phosphatidylinositol
transfer protein defects. Proc. Natl Acad. Sci. USA 95, 12346–
12351.
5. Sreenivas, A., Patton-Vogt, J.L., Bruno, V., Griac, P. & Henry,
S.A. (1998) A role for phospholipase D (Pld1p) in growth, secre-
tion, and regulation of membrane lipid synthesis in yeast. J. Biol.
Chem. 273, 16635–16638.
6. Patton-Vogt,J.L.,Griac,P.,Sreenivas,A.,Bruno,V.,Dowd,S.,
Swede, M.J. & Henry, S.A. (1997) Role of the yeast phospha-

tidylinositol/phosphatidylcholine transfer protein (Sec14p) in
phosphatidylcholine turnover and INO1 regulation. J. Biol. Chem.
272, 20873–20883.
7. Kent, C. & Carman, G.M. (1999) Interactions among path-
ways for phosphatidylcholine metabolism, CTP synthesis and
secretion through the Golgi apparatus. Trends Biochem. Sci. 24,
146–150.
8. Li, X., Xie, Z. & Bankaitis, V.A. (2000) Phosphatidylinositol/
phosphatidylcholine transfer proteins in yeast. Biochim. Biophys.
Acta 1486, 55–71.
9. Sha, B., Phillips, S.E., Bankaitis, V.A. & Luo, M. (1998) Crystal
structure of the Saccharomyces cerevisiae phosphatidylinositol-
transfer protein. Nature 391, 506–510.
10. Li, X., Routt, S.M., Xie, Z., Cui, X., Fang, M., Kearns, M.A.,
Bard, M., Kirsch, D.R. & Bankaitis, V.A. (2000) Identification
of a novel family of nonclassic yeast phosphatidylinositol
transfer proteins whose function modulates phospholipase D
activity and Sec14p-independent cell growth. Mol. Biol. Cell 11,
1989–2005.
11. van den Hazel, H.B., Pichler, H., do Valle Matta, M.A., Leitner,
E., Goffeau, A. & Daum, G. (1999) PDR16 and PDR17,two
homologous genes of Saccharomyces cerevisiae, affect lipid bio-
synthesis and resistance to multiple drugs. J. Biol. Chem. 274,
1934–1941.
12. Wu, W.I., Routt, S., Bankaitis, V.A. & Voelker, D.R. (2000)
A new gene involved in the transport-dependent metabolism
of phosphatidylserine, PSTB2/PDR17, shares sequence similar-
ity with the gene encoding the phosphatidylinositol/phos-
phatidylcholine transfer protein, SEC14. J. Biol. Chem. 275,
14446–14456.

13. Santos, B. & Snyder, M. (2000) Sbe2p and Sbe22p, two homo-
logous Golgi proteins involved in yeast cell wall formation. Mol.
Biol. Cell 11, 435–452.
14. Lee, K.S., Patton, J.L., Fido, M., Hines, L.K., Kohlwein, S.D.,
Paltauf, F., Henry, S.A. & Levin, D.E. (1994) The Saccharomyces
cerevisiae PLB1 gene encodes a protein required for lyso-
phospholipase and phospholipase B activity. J. Biol. Chem. 269,
19725–19730.
15. Gnamusch, E., Kalaus, C., Hrastnik, C., Paltauf, F. & Daum, G.
(1992) Transport of phospholipids between subcellular mem-
branes of wild-type yeast cells and of the phosphatidylinositol
transfer protein-deficient strain Saccharomyces cerevisiae sec14.
Biochim. Biophys. Acta 1111, 120–126.
16. Griac, P., Swede, M.J. & Henry, S.A. (1996) The role of phos-
phatidylcholine biosynthesis in the regulation of the INO1 gene of
yeast. J. Biol. Chem. 271, 25692–25698.
17. Burke, D., Dawson, D. & Stearns, T. (2000) Methods in Yeast
Genetics, a Cold Spring Harbor Laboratory Course Manual,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
New York.
18.Gietz,D.,StJean,A.,Woods,R.A.&Schiestl,R.H.(1992)
Improved method for high efficiency transformation of intact
yeast cells. Nucleic Acids Res. 20, 1425.
19. Gietz, R.D. & Sugino, A. (1988) New yeast-Escherichia coli shuttle
vectors constructed with in vitro mutagenized yeast genes lacking
six-base pair restriction sites. Gene 74, 527–534.
20. Wach,A.,Brachat,A.,Pohlmann,R.&Philippsen,P.(1994)New
heterologous modules for classical or PCR-based gene disruptions
in Saccharomyces cerevisiae. Yeast 10, 1793–1808.
21.Wach,A.,Brachat,A.,Alberti-Segui,C.,Rebischung,C.&

Philippsen, P. (1997) Heterologous HIS marker and GFP reporter
modules for PCR targeting in Saccharomyces cerevisiae. Yeast 13,
1065–1075.
22. Kohlwein, S.D. (2000) The beauty of the yeast: live cell micro-
scopy at the limits of optical resolution. Microsc. Res. Techn. 51,
511–529.
Fig. 8. Relationship between Sec14p and Sfh proteins. Characteristic
properties of Sec14p are listed at the left. Cubes in the respective lanes
represent coincidence of properties of Sfh-proteins compared to
Sec14p.
3144 M. Schnabl et al. (Eur. J. Biochem. 270) Ó FEBS 2003
23. Daum, G., Bohni, P.C. & Schatz, G. (1982) Import of proteins
into mitochondria. Cytochrome b
2
and cytochrome c peroxidase
are located in the intermembrane space of yeast mitochondria.
J. Biol. Chem. 257, 13028–13033.
24. Zinser, E. & Daum, G. (1995) Isolation and biochemical char-
acterization of organelles from the yeast, Saccharomyces cerevi-
siae. Yeast 11, 493–536.
25. Leber, R., Zinser, E., Zellnig, G., Paltauf, F. & Daum, G. (1994)
Characterization of lipid particles of the yeast, Saccharomyces
cerevisiae. Yeast 10, 1421–1428.
26. Hurt, E.C., McDowell, A. & Schimmang, T. (1988) Nucleolar and
nuclear envelope proteins of the yeast Saccharomyces cerevisiae.
Eur. J. Cell Biol. 46, 554–563.
27. Lowry, O.H., Rosebrough, N.J., Farr, A.L. & Randall, R.J.
(1951) Protein measurement with the folin phenol reagent. J. Biol.
Chem. 193, 265–275.
28. Laemmli, U.K. (1970) Cleavage of structural proteins during

the assembly of the head of bacteriophage T4. Nature 227,
680–685.
29. Haid, A. & Suissa, M. (1983) Immunochemical identification of
membrane proteins after sodium dodecyl sulfate-polyacrylamide
gel electrophoresis. Methods Enzymol. 96, 192–205.
30. Tang, W J.Y. (1993) Blot-affinity purification of antibodies.
Methods Cell Biol. 37, 95–104.
31. Folch, J., Lees, M. & Sloane-Stanley, G.H. (1957) A simple
method for the isolation and purification of total lipids from
animal tissues. J. Biol. Chem. 226, 497–509.
32. Broekhuyse, R.M. (1968) Phospholipids in tissues of the eye:
isolation, characterization and quantitative analysis by two-
dimensional thin-layer chromatography of diacyl and vinyl-ether
phospholipids. Biochim. Biophys. Acta 260, 449–459.
33. Lewis, T.A., Rodriguez, R.J. & Parks, L.W. (1987) Relationship
between intracellular sterol content and sterol esterification and
hydrolysis in Saccharomyces cerevisiae. Biochim. Biophys. Acta
921, 205–212.
34. Nes, W.D., Xu, S. & Haddon, W.F. (1989) Evidence for simila-
rities and differences in the biosynthesis of fungal sterols. Steroids
53, 533–558.
35. Xu, S., Norton, R.A., Crumley, F.G. & Nes, W.D. (1988) Com-
parison of the chromatographic properties of sterols, select addi-
tional steroids and triterpenoids: gravity-flow column liquid
chromatography, thin-layer chromatography, gas-liquid chroma-
tography and high-performance liquid chromatography.
J. Chromatogr. 452, 377–398.
36. Patterson, G.W. (1971) Relation between structure and retention
time of sterols in gas chromatography. Anal. Chem. 43, 1165–1170.
37. Hawkins, P.T., Stephens, L.R. & Dowens, C.P. (1986) Rapid

formation of inositol 1,3,4,5-tetrakisphosphate and inositol 1,3,4-
trisphosphate in rat parotid glands may both result indirectly from
receptor-stimulated release of inositol 1,4,5-trisphosphate from
phosphatidylinositol 4,5-bisphosphate. Biochem. J. 238, 507–516.
38. Cook, S.R. & Wakelam, J.O. (1989) Analysis of the water-soluble
products of phosphatidylcholine breakdown by ion-exchange
chromatography. Bombesin and TPA (12-O-tetradecanoylpho-
rb.ol-13-acetate) stimulate choline generation in Swiss 3T3 cells by
a common mechanism. Biochem. J. 263, 581–587.
39. Dowd, S.R., Bier, M.E. & Patton-Vogt, J.L. (2001) Turnover of
phosphatidylcholine in Saccharomyces cerevisiae. J. Biol. Chem.
276, 3756–3763.
40. Pichler, H., Gaigg, B., Hrastnik, C., Achleitner, G., Kohlwein,
S.D., Zellnig, G., Perktold, A. & Daum, G. (2001) A subfraction
of the yeast endoplasmic reticulum associates with the plasma
membrane and has a high capacity to synthesize lipids. Eur. J.
Biochem. 268, 2351–2361.
41. Zweytick, D., Athenstaedt, K. & Daum, G. (2000) Intracellular
lipid particles of eukaryotic cells. Biochim. Biophys. Acta 1469,
101–12040.
42. Merkel, O., Fido, M., Mayr, J.A., Pruger, H., Raab, F., Zando-
nella, G., Kohlwein, S.D. & Paltauf, F. (1999) Characterization
and function in vivo of two novel phospholipases B/lysophos-
pholipases from Saccharomyces cerevisiae. J. Biol. Chem. 274,
28121–28127.
43. Kim, K., Kim, K.H., Storey, M.K., Voelker, D.R. & Carman,
G.M. (1999) Isolation and characterization of the Saccharomyces
cerevisiae EKI1 gene encoding ethanolamine kinase. J. Biol. Chem.
274, 14857–1486640.
44.Daum,G.,Lees,N.D.,Bard,M.&Dickson,R.(1998)

Biochemistry, cell biology and molecular biology of lipids of
Saccharomyces cerevisiae. Yeast 14, 1471–1510.
45. Regnacq, M., Ferreira, T., Puard, J. & Berges, T. (2002) SUT1
suppresses sec14–1 through upregulation of CSR1 in Saccharo-
myces cerevisiae. FEMS Microbiol. Lett. 216, 165–170.
46. Drawid, A. & Gerstein, J. (2000) A bayesian system integrating
expression data with sequence patterns for localizing proteins:
comprehensive application to the yeast genome. J. Mol. Biol. 301,
1059–1075.
47. Hirokawa, T., Boon-Chieng, S. & Mitaku, S. (1998) SOSUI:
classification and secondary structure prediction system for
membrane proteins. Bioinformatics 14, 378–379.
48. De Vries, K.J., Westerman, J., Bastiaens, P.I., Jovin, T.M., Wirtz,
K.W. & Snoek, G.T. (1996) Fluorescently labeled phosphatidyl-
inositol transfer protein isoforms (alpha and beta), microinjected
into fetal bovine heart endothelial cells, are targeted to distinct
intracellular sites. Exp. Cell Res. 227, 33–39.
49. Tang, X., Waksman, M., Ely, Y. & Liscovitch, M. (2002) Char-
acterization and regulation of yeast Ca
2+
-dependent phosphati-
dylethanolamine-phospholipase D activity. Eur. J. Biochem. 269,
3821–3830.
Ó FEBS 2003 Yeast SEC14 homologues (Eur. J. Biochem. 270) 3145