Báo cáo khoa học: The N-acetylglutamate synthase/N-acetylglutamate kinase metabolon of Saccharomyces cerevisiae allows co-ordinated feedback regulation of the first two steps in arginine biosynthesis potx

The
N
-acetylglutamate synthase/
N
-acetylglutamate kinase
metabolon of
Saccharomyces cerevisiae
allows co-ordinated
feedback regulation of the first two steps in arginine biosynthesis
Katia Pauwels, Agnes Abadjieva, Pierre Hilven, Anna Stankiewicz and Marjolaine Crabeel
Department of Genetics and Microbiology of the Vrije Universiteit Brussel, Brussels, Belgium
In Saccharomyces cerevisiae, which uses the nonlinear
pathway of arginine biosynthesis, the first two enzymes,
N-acetylglutamate synthase (NAGS) and N-acetylglutamate
kinase (NAGK), are controlled by feedback inhibition. We
have previously shown that NAGS and NAGK associate in
a complex, essential to synthase activity and protein level
[Abadjieva, A., Pauwels, K., Hilven, P. & Crabeel, M. (2001)
J. Biol. Chem. 276, 42869–42880].
The NAGKs of ascomycetes possess, in addition to the
catalytic domain that is shared by all other NAGKs and
whose structure has been determined, a C-terminal domain
of unknown function and structure. Exploring the role of
these two domains in the synthase/kinase interaction, we
demonstrate that the ascomycete-specific domain is required
to maintain synthase activity and protein level.
Previous results had suggested a participation of the third
enzyme of the pathway, N-acetylglutamylphosphate reduc-
tase, in the metabolon. Here, genetic analyses conducted in
yeast at physiological level, or in a heterologous background,
clearly demonstrate that the reductase is dispensable for

synthase activity and protein level.
Most importantly, we show that the arginine feedback
regulation of the NAGS and NAGK enzymes is mutually
interdependent. First, the kinase becomes less sensitive to
arginine feedback inhibition in the absence of the synthase.
Second, and as in Neurospora crassa, in a yeast kinase
mutant resistant to arginine feedback inhibition, the
synthase becomes feedback resistant concomitantly.
We conclude that the NAGS/NAGK metabolon pro-
motes the co-ordination of the catalytic activities and feed-
back regulation of the first two, flux controlling, enzymes of
the arginine pathway.
Keywords:yeast;N-acetylglutamate synthase; N-acetylglu-
tamate kinase; metabolon; co-ordinated feedback inhibition.
De novo arginine biosynthesis in plants and microorganisms
occurs in eight biochemical steps starting from glutamate. In
the fifth step of this pathway ornithine is generated from
N-acetylornithine. Two different ornithine synthesis reac-
tions can be distinguished. In the linear pathway, ornithine
is generated through the hydrolysis of N-acetylornithine. In
the cyclic pathway, the acetyl group of N-acetylornithine is
transferred to glutamate, thereby regenerating N-acetylglu-
tamate (Fig. 1). Because it avoids the acetyl-CoA consu-
ming initial step, catalysed by N-acetylglutamate synthase
(NAGS) (EC 2.3.1.1), the cyclic pathway is energetically
more favourable. However, an organism, which regenerates
N-acetylglutamate through ornithine synthesis, still requires
the synthase in order to ensure a constant level of acetylated
compounds during cell growth. Therefore an anaplerotic
role is attributed to acetylglutamate synthase in organisms

using the cyclic pathway of ornithine synthesis [1,2].
The linear pattern of ornithine synthesis is found in
Escherichia coli and some other bacteria and archea [1–5].
The cyclic pattern is more widespread among the procary-
otes [6–13], and it is observed in all investigated ascomyce-
tes, including Candida utilis [14], Saccharomyces cerevisiae
[15], Neurospora crassa [2], and in Chlamydomonas algae
[16]. In the fungi, ornithine synthesis proceeds entirely in the
mitochondria [17,18].
Control of the metabolic flux through a biosynthetic
pathway usually occurs at the level of the first committed
step and is often mediated by the end product of the
pathway. This classical mechanism operates in organisms
using the linear pathway of arginine synthesis: arginine
exerts feedback inhibition on N-acetylglutamate synthase in
E. coli and Salmonella typhimurium [19–21]. In pathways
where acetylglutamate is regenerated, the second enzyme of
arginine biosynthesis, N-acetylglutamate kinase (NAGK)
(EC 2.7.2.8) becomes the main controlling step. Feedback
inhibition of the kinase by arginine has been demonstrated
in several bacteria [7,22,23]. Yet, metabolic control should
occur on the production of acetylglutamate, regardless of its
origin. Therefore, feedback inhibition on both the synthase
and the kinase is believed to be general for organisms using
Correspondence to M. Crabeel, Department of Genetics and
Microbiology of the Vrije Universiteit Brussel, c/o CERIA-COOVI,
Emile Gryson avenue 1, B-1070 Brussels, Belgium.
Fax: + 32 2 526 72 73, Tel.: + 32 2 526 72 84,
E-mail:
Abbreviations:NAGS,N-acetylglutamate synthase; NAGK,

N-acetylglutamate kinase; NAGPR, N-acetylglutamylphosphate
reductase; CD, catalytic active domain; ASD, ascomycetes specific
domain.
Enzymes: N-acetylglutamate synthase (EC 2.3.1.1), N-acetylglutamate
kinase (EC 2.7.2.8), N-acetylglutamylphosphate reductase
(EC 1.2.1.38).
(Received 25 November 2002, revised 14 January 2003,
accepted 22 January 2003)
Eur. J. Biochem. 270, 1014–1024 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03477.x
cyclic ornithine synthesis. The feedback regulation of these
first two steps in the arginine pathway has been clearly
demonstrated in the bacterium Pseudomonas aeruginosa and
in two ascomycetes: S. cerevisiae and N. crassa [24–28].
In the latter two organisms, the control of the first two
steps of the arginine pathway includes an extra level of
complexity. Beside its own structural gene (ARG2),
N-acetylglutamate synthase activity also requires the yeast
ARG5,6 gene (arg-6 in N. crassa). The ARG5,6 and arg-6
genes encode each a polyprotein precursor which is
maturated in the mitochondrial matrix to N-acetylglu-
tamate kinase and N-acetylglutamylphosphate reductase
(NAGPR) (EC 1.2.1.38), catalysing, respectively, the sec-
ond and third step of arginine biosynthesis [29,30]. This
requirement of an extra gene for the synthase activity was
first observed in N. crassa, where cells containing some
nonsense mutants of the arg-6 gene displayed no detectable
synthase activity, despite the presence of an intact synthase
encoding gene (arg-14) [28,31]. An interaction between the
synthase and the kinase of N. crassa was demonstrated by
the yeast two-hybrid system (R. L. Weiss, S. K. Chae,

J. Chung, C. McKinstry, M. Karaman and G. Turner,
University of California, Los Angeles, CA, USA, personal
communication). Similar data in yeast were independently
obtained by our group [32]. An increase in synthase activity,
expected to result from higher copy numbers of its structural
gene ARG2, has only been observed with a parallel increase
in the ARG5,6 gene copy number. The yeast synthase/kinase
interaction was demonstrated by coimmunoprecipitation
methods [32].
The physical participation of reductase, the second mat-
urated gene product of ARG5,6, to the synthase/kinase com-
plex, has not been provenso far. Hence, it is not clear whether
synthase activity and protein level require reductase. How-
ever, the existence of mutations in the reductase-encoding
domain of the N. crassa arg-6 gene, which affect synthase
activity, suggests a possible role for the reductase [28,31].
Moreover, increasing the copy-number of a synthetic gene,
only encoding the kinase domain of S. cerevisiae ARG5,6
gene, is not sufficient to increase the activity of yeast NAGS
when coexpressed with high copy-number of ARG2 [32].
Another remarkable result, concerning the regulation of
the first enzymes of the arginine pathway, has been reported
by the team of R. L. Weiss. A series of ornithine-over-
producing N. crassa mutants [33], were mapped to the
N-terminus of N-acetylglutamate kinase and shown to bear
F81L modifications. The data suggest that this single
amino-acid modification of the kinase might result in the
deregulation of the first two enzyme activities of the arginine
pathway, leading to the hypothesis of a co-ordinated
feedback control (R. L. Weiss, S. K. Chae, J. Chung,

C. McKinstry, M. Karaman and G. Turner, University of
California, Los Angeles, CA, USA, personal communi-
cation).
The co-ordinated regulation of the first two enzymes of
the arginine pathway in ascomycetes seems to correlate with
some particular features of both the synthase and the kinase
genes. The ascomycete N-acetylglutamate synthase enco-
ding genes are conserved and appear evolutionarily not
related to the gene family encoding N-acetylglutamate
synthase in bacteria [32,34]. Recently, the murine and the
human genes encoding N-acetylglutamate synthase were
Fig. 1. Simplified scheme of the arginine biosynthesis pathway in
S. cerevisiae. Step 1 is catalysed by N-acetylglutamate synthase
(synthase), step 2 by N-acetylglutamate kinase (kinase), step 3 by
N-acetylglutamylphosphate reductase (reductase), and step 5 by
N-acetylornithine-glutamate acetyltransferase (acetyltransferase).
Ó FEBS 2003 Co-ordinated feedback regulation (Eur. J. Biochem. 270) 1015
characterized and shown to pertain to the same family as the
ascomycete synthase [35,36]. This apparent dual origin
of the synthases is in sharp contrast with the common
evolutionary relationship ascribed to all other genes
involved in the arginine biosynthesis in different organisms.
Amino-acid sequence alignments of known members of
the N-acetylglutamate kinase family illustrate conservation
over all three domains of living organisms (Bacteria,
Archaea, and Eucarya) of a region corresponding to the
E. coli NAGK, the only NAGK of known 3D structure
[37], representing the catalytic NAGK domain. However,
all the ascomycete N-acetylglutamate kinases characterized
to date, namely those of S. cerevisiae, Schizosaccharomyces

pombe, N. crassa,andCandida albicans, have two specific
features: (a) they are encoded together with NAGPR as a
bi-functional precursor protein that is processed into two
distinct enzymes in the mitochondria, and (b) they possess
an extra region of about 200 amino acids at their
C-terminus, that we call the ascomycete-specific domain
(ASD) [29,30]. It is tempting to speculate that the
ascomycete-specific domain (ASD) of the kinase might
play a role in formation of the synthase/kinase protein
complex.
This work investigates three important unsolved ques-
tions related to the structure and function of the yeast
NAGS/NAGK metabolon. We analyse (a) the role of the
reductase in the activity and protein level of the synthase, (b)
the role of the ASD of the kinase in its interaction with the
synthase, and (c) the significance of the yeast NAGS/
NAGK metabolon in terms of its co-ordinated feedback
regulation by arginine.
Experimental procedures
Strains and growth conditions
S. cerevisiae. The wild-type strain of this laboratory is
S1278b (Mat a). MG471 (Mat a, ura3–471) was directly
derived from S1278b by M. Grenson, Universiteit
Brussel, Belgium. The strains YeBR5 (Mat a, ura3–471,
Darg5::gen
R
), YeBR6 (Mat a, ura3–471, Darg6::gen
R
,
arg5

–
), and 14S31b (Mat a, ura3
–
, his3
–
) have been
described previously [32]. The construction of strain SS1
(Mat a, ura3–471, Darg3), derived from MG471, has been
described [38]. Strain KA44 (Mat a, ura3
–
, his3
–
, Darg2::
gen
R
) and strain KA42 (Mat a, ura3
–
, his3
–
, Darg5,6::gen
R
)
are derived from 14S31b and were constructed using A.
Wach’s method [39]: the genomic ARG2 ORF (KA44) or
the genomic ARG5,6 ORF (KA42) were replaced by the
kanMX4 cassette and the strains were selected on the basis
of their geneticin resistance. PCR analysis confirmed the
presence of the expected modification in those strains. SA2,
derived from MG471, was constructed using the delitto
perfetto system developed by Storici et al.[40].The

procedure allowed scarless removal of the NAGK encoding
ARG6 region from the chromosomal ARG5,6 gene (deletion
from amino acid 84–493 in the ORF encoding the kinase/
reductase precursor). The resulting ura3
–
, Darg6 mutant
strain can be restored to prototrophy by plasmid pYB7,
expressing ARG6 from a GAL promoter. This confirms
that, as expected, SA2 expresses active NAGPR from the
remaining ARG5 region of the ARG5,6 gene.
All yeast strains were grown at 30 °ConM.ammedium,
a minimal medium containing 0.02
M
(NH
4
)
2
SO
4
,3%
glucose, vitamins, and trace minerals [41]. Where required,
uracil,
L
-histidine or
L
-arginine was added to a concentra-
tion of 25 lgÆmL
)1
. Genes which are transcriptionally
controlled by the GAL promoter were induced by growing

cells on M.gal medium (containing 2% galactose as the
carbon source) instead of the usual M.am medium
(containing 3% glucose). Arginine starved cells were
initially grown on medium containing arginine, centrifuged,
washed with water and resuspended in M.am medium
without arginine. Cells were starved for 3 h before
harvesting them.
E. coli. Strains XA4(argA
–
)andXC33(argC
–
)fromthe
laboratory of S. Baumberg have been described previously
[32]. Rosetta(DE3)(pRARE) is a commercial strain (Nov-
agen) in which the pRARE plasmid over-expresses tRNAs
for most rare E. coli codons.
E. coli strains were grown at 37 °C on rich medium
supplemented with ampicillin (25 lgÆmL
)1
)andchloram-
phenicol (35 lgÆmL
)1
) where required. Cell cultures at a
D
600
of 0.600 were induced by addition of IPTG (2,5 m
M
)
and overnight incubation at 30 °C.
Culture conditions for the spot tests: approximately 2 mL

of cells at D
600
of 0.250 grown on rich medium plus
ampicilline, were harvested by centrifugation, washed and
resuspended in minimal medium to a concentration of
10
10
cellsÆmL
)1
. Drops of 10 lL of 10-fold serial dilutions
(from 10
10
cellsÆmL
)1
to 10
5
cellsÆmL
)1
) were spotted on
minimal medium with or without arginine (100 lgÆmL
)1
),
and with or without IPTG (1 m
M
). Sets of four plates were
incubated at 37 °C, 30 °Cor25°C.
Oligonucleotides
BY4, BY5: [32], HP72 ¼ GTCTCACAACAACAATTGG
CTGTGATCAAGGTG. HP73 ¼ CACCTTGATCACA
GCTAATTGTTGTTGTGAGAC. HP79 ¼ CACACG

ACTTCACAAAATTTTCAACTAATTTGTAACCTCT
CCTGATCATAG. HP80 ¼ CTATGATCAGGAGAGG
TTACAAATTAGTTGAAAATTTTGTGAAGTCGTG
GTG. HP81 ¼ CACTAATTTGTAACCTCTCCTGAT
AACCTCTCTTTTTGTGCTGATATTG. HP82 ¼ CAA
TATCAGCACAAAAAGAGAGGTTATCAGGAGAG
GTTACAAATTAGTG. AA29 ¼ CGTCAGACCATGG
GGTGGAGGAGAATATTCGCGCATGAACTCAAG.
K1 ¼ GGCCATGGTTTCATCTACTAACGGCTTTT
CAG. K2 ¼ GGCCAAGCTTTCAACTACTTGCTGA
TGAGTTGAGGGTAG. K4 ¼ GGCCTGCAGCTCAA
GGCGCACTCCCGTTCTG. K8 ¼ GGCCTGCAGTCA
ATGATGATGATGATGATGTGAAATATTTTTTTCA
TTTTCCCAAC. K10 ¼ CCGGAAGCTTTCAGACAC
CAATAATTTTATTTTCAGGG. K12 ¼ CCGGAAG
CTTGTGAGCGGATAACAATTTCACACAGGAAAC
AGACCATGCCTCGTCCCGAGGGAGTTAACACC.
Plasmid constructs
Table 1 gives an overview of the main features of the
plasmids used in this work, including the new constructs.
Plasmids pHP17, pHP21, and pHP22 (expressing the
1016 K. Pauwels et al. (Eur. J. Biochem. 270) Ó FEBS 2003
ARG5,6 gene altered in its NAGK-encoding ARG6 region)
were all constructed by recombinant PCR, using S1278b
genomic DNA as template. Two overlapping fragments
were generated in a first PCR amplification step, then self-
annealed, elongated to duplex DNA, and amplified in a
second PCR step using the two ÔexternalÕ oligonucleotide
primers of the two oligonucleotide pairs of the first PCRs.
These external primers are designed to add adequate

restriction sites for classical cloning in the pYX223 vector
(from R&D systems). The latter is a 2 micron-based yeast–
E. coli shuttle vector, bearing HIS3 as selection marker, and
in which the expression of the inserted genes is put under the
control of a GAL promoter. The BY4/HP73 and HP72/
BY5 primer pairs were used to construct pHP17, BY4/
HP79, and HP80/BY5 for pHP21 and BY4/HP81 and
HP82/BY5 for pHP22.
Plasmids of the pYK series were all derived from the
E. coli expression vector pTrc99a (Pharmacia) and contain
different insertions, all obtained by PCR amplification. The
inserted fragments allow the expression of the ORF under
the transcriptional control of the IPTG-inducible strong
bacterial trp-lac promoter and under the translational
control of an appropriate Shine–Dalgarno sequence.
Plasmids pYK1 expresses the ARG6 ORF, cloned as an
NcoI–HindIII fragment amplified using K1 and K2 as
primers and plasmid pYB3 as a template. Plasmid pYK7
expresses the ARG2 ORF, cloned as a NcoI–PstI fragment
(primers AA29 and K8 and pYB2 as a template). With
primer AA29, a tag of six histidine codons is fused in frame
to the C-terminus of the ARG2 ORF for immunodetection
of the enzyme. Plasmid pYK8 was obtained by inserting
the ARG6 ORF and its trp-lac promoter (from position
)115) as a PstI–HindIII fragment (primers K4/K2, tem-
plate pYK1) into plasmid pYK7. The artificial operon of
plasmid pYK11 expresses a bi-cistronic ARG5/ARG6
mRNA under the control of the trp-lac promoter and
was obtained by inserting a HindIII fragment (primers
K10/K12, template pYK3), containing the reductase

encoding region, into plasmid pYK8. Primer K12 has a
35-nucleotide 5¢ extension containing a ribosome site and
an initiator codon.
DNA sequencing
The nucleotide sequence of the ARG5,6 gene, cloned in
the plasmids pHP17, pHP21, pHP22 and pYK11, was
determined. Beside the intended modification or deletion,
these constructions, issued from independent PCR-
amplifications, share additionally the same 15 single-
nucleotide differences with respect to the data base
sequence. These S1278b-specific differences with respect
to the ARG5,6 gene of strain S288c, used to establish
the data base, result in only one amino-acid difference:
the E803K modification in the region of the gene
encoding NAGPR.
Enzyme activity assays
Acetylglutamate synthase. This enzyme activity was meas-
ured by a radioassay using
L
-[U-
14
C] glutamate and acetyl-
CoA as substrates, as described previously [32]. Dependent
on the experiment, 400 mL to 2 L of yeast cultures at
D
600
 0.4 were required. Extracts were prepared using the
French press. For E. coli experiments, cells of 100 mL
cultures (induced overnight) were collected and extracts
were obtained by ultrasonication.

Table 1. Main features of the plasmids used in this work.
Plasmids Cloning vector
Origin of
insert Nature of insert Expressed protein
pYB2 pYX213 (2l, URA3) S1278b PromoterGAL ò ARG2 ORF-HAtag (32) WT NAGS-HA
pYB3 pYX223 (2l, HIS3) S1278b PromoterGAL ò ARG5,6 ORF (32) WT NAGK + WT NAGPR
(amino acids 1–863)
pYB7 pYX223 (2l, HIS3) S1278b PromoterGAL ò ARG6 (32) WT NAGK (amino acids 1–537)
pYB8 pYX223 (2l, HIS3) S1278b PromoterGAL ò ARG5 (32) WT NAGPR (amino acids 1–38 +
amino acids 494–863)
pHP17 pYX223 (2l, HIS3) S1278b PromoterGAL ò ARG5,6 ORF (F99L) FB
R
NAGK + WT NAGPR
pHP21 pYX223 (2l, HIS3) S1278b PromoterGAL ò ARG5,6 ORF
(Damino acids 355–493)
NAGK (DASD) + WT NAGPR
pHP22 pYX223 (2l, HIS3) S1278b PromoterGAL ò ARG5,6 ORF
(Damino acids 85–347)
NAGK (DCD) + WT NAGPR
p238 YCp50 (ARS-CEN, S288c GCN4 (4 uORFs untranslated)
a
Constitutive expression of Gcn4p
URA3)
pYK1 pTrc99a S1278b PromoterTrc ò ARG6 WT NAGK (amino acids 58 to 51)
pYK7 pTrc99a S1278b PromoterTrc ò ARG2 ORF-HIS6tag WT NAGS-HIS6
pYK8 pTrc99a S1278b PromoterTrc ò ARG2 ORF-HIS6tag +
PromoterTrc ò ARG6
WT NAGS-HIS6 + WT NAGK
(amino acids 58–513)
pYK11 pTrc99a S1278b PromoterTrc ò ARG2 ORF-HIS6tag +

PromoterTrc ò ARG6 +
ARG5 operon
WT NAGS-HIS6 + WT NAGK
(amino acids 58–513) + WT NAGPR
(amino acids 531–863)
a
Gift of A. Hinnebusch, National Institute of Child Health and Human Development, Bethesda, MD, USA.
Ó FEBS 2003 Co-ordinated feedback regulation (Eur. J. Biochem. 270) 1017
Acetylglutamate kinase. The assay used to measure
NAGK activity has been described previously [18]. In total
yeast extracts, this assay detects two distinct enzymatic
reactions [18,26]. As the interfering activity is not inhibited
by arginine (in contrast to the full inhibition of NAGK), a
blank including 5 m
M
arginine was used by Jauniaux et al.
to subtract the interfering activity [18]. Because we used
arginine feedback resistant mutants in this work, we used
adapted blanks containing 50 m
M
arginine. In some
experiments, the blanks were reaction mixtures incubated
without the substrate acetylglutamate. This explains the
presence of a residual activity, resistant to arginine inhibi-
tion, in Fig. 5 (about 15% of the initial kinase activity). A
kinase activity similar to that residual activity is measured in
extracts of strain KA42 bearing a full deletion of the
ARG5,6 gene.
All NAGS and NAGK activities reported in this work
are means of at least three independent experiments.

Standard deviations generally did not exceed 15%.
Western blots
A standard chemiluminescence Western blotting protocol
(Roche) was used to analyse the yeast NAGS expressed in
E. coli from plasmids pYK7, pYK8, and pYK11. Equal
amounts of total proteins of the different crude extracts were
separated by SDS/PAGE on 12% gels, and then blotted on
an ECL Hybond nitrocellulose membrane (Amersham
Pharmacia Biotech) in transfer buffer [25 m
M
Tris,
192 m
M
glycine, 20% (v/v) methanol] using a Mini PRO-
TEAN 3 blotting cell (Bio-Rad). Specific primary mouse
anti-HIS Ig (Santa Cruz Biotechnology) (0.1 ngÆmL
)1
)and
40 UÆmL
)1
peroxidase-labelled secondary antibody (Roche)
were used to detect the tagged synthase protein. Chemilu-
minescence was monitored by autoradiography. Detection
of Haemaglutinin (HA)-tagged NAGS, expressed by the
pYB2 plasmid in yeast cells, was as described previously [32].
Results
At physiological levels, the presence
of N-acetylglutamyl phosphate reductase
is dispensable to synthase activity
In order to determine the influence of N-acetylglutamyl

phosphate reductase on the activity of N-acetylglutamate
synthase, the synthase activity was measured in different
mutants carrying deletions in relevant parts of the chromo-
somal ARG5,6 gene. Strain YeBR6 expresses neither the
kinase nor the reductase, while only the kinase is expressed
by strain YeBR5 [32]. A new strain, SA2 bears a deletion of
the kinase-encoding domain of ARG5,6 and has its
remaining reductase-encoding domain fused to the mito-
chondrial targeting peptide. The SS1 strain is used as the
ARG5,6
+
positive control. SS1 bears an ARG3 deletion
rendering the control strain arginine-dependent, like the
tested strains. SS1, SA2, YeBR5 and YeBR6 are all directly
derived from MG471.
In a crude extract of wild-type yeast, the physiological
level of synthase activity is barely detectable. The detection
becomes even more difficult for the strains requiring
arginine for cell growth, presumably due to a tight binding
of the feedback inhibitor. Moreover, adequate removal of
the inhibiting arginine, by dialysis or repeated gel filtration,
is limited by the lack of stability of the synthase. To
overcome this difficulty, we choose to assay NAGS in
extracts of arginine-starved cells (see strains and growth
conditions). The arginine deprivation results in a Gcn4p-
mediated transcriptional activation of the ARG2 gene
(K. Pauwels and M. Crabeel, unpublished results) and
reduces the pool of the feedback inhibitor. Even higher
levels of synthase activity were detected in strains bearing
the p238 plasmid, due to a constitutive production of the

Gcn4p transcriptional transactivator (Table 2).
Synthase activity was assayed in crude extracts of arginine
starved SS1, YeBR5, SA2 and YeBR6, with and without
the plasmid p238 (Table 2). No synthase activity was
detectable in absence of the kinase (SA2 and YeBR6 vs.
SS1). In contrast, the absence of reductase did not affect
considerably the synthase activity, though a small decrease
was observed (YeBR5 vs. SS1). These data demonstrate
that, at physiological level, the synthase activity requires the
presence of the kinase, and that the additional presence of
the reductase is dispensable.
Activity and protein level of the yeast synthase
expressed in
E. coli
, require the coexpression
of the yeast kinase but not of the yeast reductase
The E. coli strain XA4 (argA
–
), which is defective in
N-acetylglutamate synthase, cannot be restored to arginine
prototrophy by a trp-lac-promoter-driven expression of the
Table 2. Physiological levels of the N-acetylglutamate synthase in strains bearing different deletions in the ARG5,6 gene.
Strain Relevant genotype
Status of
NAGS activity (nmolÆmin
)1
Æmg
)1
protein)NAGK NAGPR
SS1 ARG5,6, Darg3 + + 2.2

SS1 (p238)
a
9.36
YeBR5 Darg5 + – 1.5
YeBR5 (p238)
a
7.3
SA2 Darg6 – + <0.2
b
SA2 (p238)
a
<0.2
b
YeBR6 Darg5,6 – – <0.2
b
YeBR6 (p238)
a
<0.2
b
a
Plasmid p238 expresses Gcn4p constitutively;
b
below detection.
1018 K. Pauwels et al. (Eur. J. Biochem. 270) Ó FEBS 2003
yeast synthase [32]. In the present study we analysed the
influence of the additional expression of the yeast kinase,
and of the yeast kinase and reductase together. Three
plasmids, derived from pTrc99A, are designed to express
yeast synthase (pYK7), yeast synthase and kinase (pYK8)
or yeast synthase, kinase and reductase (pYK11). These new

constructions, including the empty vector pTrc99a, are
transformed in strain XA4. SDS/PAGE/Coomassie Blue
analysis and kinase activity assays confirmed that XA4
(pYK8) and XA4(pYK11) are over-expressing functional
kinase protein (data not shown). Beside the kinase protein,
XA4 (pYK11) expresses the reductase protein, however, in
lower amounts. The functionality of the reductase, encoded
by pYK11, was verified by complementation of the
reductase deficient E. coli strain XC33 (argC
–
) (data not
shown).
First, all four plasmids were tested for their efficiency to
complement the argA
–
deficiency of the XA4 strain, using
spot tests of serial dilutions incubated at 37 °C. Under
noninducing conditions (Fig. 2A), pYK8 and pYK11 (both
expressing the kinase protein) allow growth of the arginine-
deficient mutant in the absence of arginine. On the other
hand, plasmids pYK7 and the empty vector pTrc99a (both
lacking the yeast kinase ORF) were completely unable to
complement the mutation. These data demonstrate that the
presence of the kinase is essential to yeast synthase activity
while the additional presence of the reductase (pYK11 vs.
pYK8) does not improve complementation. The observa-
tion that complementation is even slightly lower in the
presence of the reductase, could be due to a lower copy
number of pYK11, which is larger than pYK8. Unexpect-
edly, expression of pYK8 and pYK11 under induced

conditions did not improve the efficiency of complementa-
tion of the argA
–
XA4 strain (Fig. 2C). In contrast, it
appeared to be toxic to the cell. This cell toxicity was
demonstrated by the severe growth handicap observed
when ITPG and arginine were supplemented together to the
medium (Fig. 2D vs. 2C). On the other hand, the absence of
growth of strain XA4(pYK7) under inducing conditions
(Fig. 2C) demonstrates the incapacity of the plasmid that
bears only the synthase gene to complement the arginine
deficiency, rather than revealing cell toxicity. This is shown
by a similar behaviour in growth of XA4(pTrc99A) and
XA4(pYK7), in all conditions used.
Same series of spot test were also realized with plate
incubations at 30 °Cand25°C. These milder temperatures
did not allow any growth of XA4(pYK7) in the absence of
arginine, but complementation of the synthase deficiency by
pYK8 and pYK11 slightly and gradually improved with
decreasing incubation temperatures (data not shown).
In a second step, synthase specific activity was determined
in XA4 strains bearing one of the four plasmids mentioned
above, following an overnight induction at 30 °Cwith
2.5 m
M
IPTG. Table 3 summarizes the results. No synthase
activity was detected for XA4(pYK7) (expressing only the
yeast synthase) and high activity was measured for
XA4(pYK8) (coexpressing synthase and kinase). Compared
to XA4(pYK8), XA4(pYK11), which additionally expresses

the reductase, showed a slight decrease in synthase activity,
which can presumably be ascribed to a lower plasmid copy
number.
To test whether the absence of synthase activity is the
result of low levels of NAGS protein, an immunoWestern
Table 3. Yeast N-acetylglutamate synthase specific activity in the XA4
(argA
–
) E. coli background.
Plasmid
Yeast enzymes
expressed
NAGS activity
after IPTG induction
(nmolÆmin
)1
Æmg
)1
protein)
pTrc99A none <0.2
a
pYK7 NAGS <0.2
a
pYK8 NAGS + NAGK 44
pYK11 NAGS + NAGK + NAGPR 30
a
Below detection.
Fig. 2. Spot growth tests of the E. coli strain XA4(argA
–
) transformed with various plasmids as indicated. In each row, from left to right, 10 lLof

10-fold serial dilutions of a cell suspension (going from 10
10
cellsÆmL
)1
to 10
5
cellsÆmL
)1
) were spotted, either under noninducing conditions,
without arginine (A) and with arginine (B); or under inducing conditions, without arginine (C) and with arginine (D). Plates were incubated at 37 °C.
Ó FEBS 2003 Co-ordinated feedback regulation (Eur. J. Biochem. 270) 1019
blot analysis was performed, comparing equal amounts of
total proteins from crude extracts of the four type of
transformants (Fig. 3). The synthase protein was detected
by its His
6
tag in extracts of the strains bearing pYK8 or
pYK11, but not in extracts of a strain bearing pYK7. A
small difference in protein concentration was observed
between pYK8 and pYK11 in some blots, ascribed to a
lower plasmid copy number. Thus, protein concentration
data correspond to the data of the growth assays and of the
activity measurements. Therefore, unless kinase is coex-
pressed, yeast synthase appears unstable, both in a hetero-
logous bacterial background (present data) and in an yeast
homologous context [32]. This suggests an intrinsic insta-
bility of the synthase protein. Furthermore, in a hetero-
logous bacterial background, the supplementary presence of
the yeast reductase, in addition to the yeast kinase, does not
enhance synthase activity or levels.

The ascomycete-specific domain of
N
-acetylglutamate
kinase is required to maintain
N
-acetylglutamate
synthase activity and protein level
Yeast N-acetylglutamate kinase consists of two distinguish-
able domains. The N-terminal domain is conserved in both
eucaryotes and procaryotes and is therefore inferred to be
the catalytic active domain (CD). The C-terminal domain is
specific to ascomycetes (ASD). It extends from about amino
acid348toaresiduelocatedbetweenaminoacid510and
540, the region in which the kinase/reductase precursor is
maturated [29]. We addressed the question whether the two
kinase domains are needed to observe synthase activity and
stability. By inference, this would indicate a role for each
domainintheassociationoftheNAGS/NAGKina
complex.
For this experiment, new high copy number plasmids
were derived from pYB3, each lacking one of the kinase
domains. Plasmid pYB3 encodes the full length ARG5,6
gene, plasmid pHP21 is truncated for the ascomycete
specific domain of the kinase (Daa355–493) and plasmid
pHP22 is truncated for the catalytic domain of the kinase
(Daa85–347). The functionality of the kinase protein
encoded by those plasmids was assessed by transforming
the plasmids in the Darg5,6 genetic background of strain
KA42 and measuring kinase activity. As expected
KA42(pHP22) lacks any kinase activity while

KA42(pHP21) keeps more than 50% of the wild-type
kinase activity as compared to KA42(pYB3) (data not
shown), implying that the ASD-truncated kinase is stably
expressed.
We then analysed the synthase activity and protein level
when the synthase protein was coexpressed with one of the
truncated kinases. Therefore, pYX223, pYB3, pHP21 and
pHP22 were cotransformed in 14S31b with pYB2, which is
a GAL promoter-driven plasmid, over-expressing the
synthase fused to a C-terminal haemaglutinin (HA)-tag.
The first two combinations served as a negative and a
positive control, respectively. The host strain 14S31b has a
ARG2, ARG5,6 genetic background circumventing the need
to add arginine in the growth medium, but explaining the
low background synthase activity and protein level of the
negative control.
Table 4 summarizes the values of the synthase specific
activity measured under galactose promoter inducing
growth conditions. As expected, the coexpression of wild-
type kinase and synthase resulted in high synthase activity.
The combined expression of synthase with each of the
truncated kinase proteins, however, showed no increase in
the synthase activity compared to the negative control. This
suggests that complex formation does not occur, resulting in
synthase protein instability. Alternatively, a non-productive
but stable association can be the cause of this inactivity. To
assess the synthase protein level, an immunoWestern
blotting was performed on crude extracts of several strains,
as shown in Fig. 4A. No synthase was detectable in any of
the samples, except for 14S31b(pYB2 + pYB3), which was

used as a positive control. Only when the gels were
deliberately overloaded, did synthase become detectable in
the extracts from strains bearing pHP21 and pHP22, yet in
amounts comparable to the basal level produced in the
negative control (Fig. 4B).
The results demonstrate that the ascomycete-specific
domain of the kinase is required for accumulation of the
synthase. However, if this domain is assumed to be
Fig. 3. NAGS detection by immunoWestern blot analysis of total pro-
tein extracts of E. coli strain transformed with plasmid pYK7 expressing
His
6
-tagged yeast N-acetylglutamate synthase (NAGS), pYK8 expres-
sing His
6
-tagged NAGS and N-acetylglutamate kinase (NAGK) or
pYK11 expressing His
6
-tagged NAGS, NAGK and N-acetylglutamyl
phosphate reductase. Plasmid pTrc99a is the corresponding empty
cloning vector. MM, molecular mass markers. The arrow indicates the
protein band corresponding to NAGS.
Table 4. N-acetylglutamate synthase specific activity in strains coex-
pressing promoter GAL-driven ARG2 and ARG5,6 genes: effect of
domain deletions in the N-acetylglutamate kinase.
Strain
Status
of NAGK
NAGS activity
(nmolÆmin

)1
Æmg
)1
protein)CD
a
ASD
b
14S31b (pYB2 + pYX223) – – 14
14S31b (pYB2 + pYB3) + + 206
14S31b (pYB2 + pHP21) + – 10
14S31b (pYB2 + pHP22) – + 16
a
CD, catalytic domain;
b
ASD, ascomycete specific domain.
1020 K. Pauwels et al. (Eur. J. Biochem. 270) Ó FEBS 2003
expressed and to be stable in the CD truncated kinase, these
data indicate that the ASD is insufficient to maintain the
activity of the synthase.
The kinase F99L mutant leads to arginine feedback
resistance of both the kinase and the synthase
R. L. Weiss and coworkers found that the F81L modifica-
tion in the N-acetylglutamate kinase of N. crassa renders
the enzyme resistant to arginine feedback inhibition
(R. L. Weiss, S. K. Chae, J. Chung, C. McKinstry,
M. Karaman and G. Turner, University of California,
Los Angeles, CA, USA, personal communication). Align-
ment of the amino-acid sequences of S. cerevisiae, S. pombe,
C. albicans,andN. crassa kinases shows the phenylalanine
81 of N. crassa to be conserved in ascomycete kinases. It

corresponds to the phenylalanine 99 in S. cerevisiae.We
constructed the yeast kinase ARG5,6 F99L mutant in a
vector with a GAL promoter, yielding plasmid pHP17.
Plasmid pYB2, encoding the yeast synthase, was cotrans-
formed with pHP17 in the strain YeBR6. YeBR6
(pYB2 + pYB3), over-expressing both the wild-type kinase
and synthase, was used as a reference strain. The trans-
formants were grown on galactose medium and N-acetyl-
glutamate kinase activity in cell extracts was assayed in the
presence of increasing arginine concentrations. Figure 5A
compares the arginine inhibition curves of the wild-type and
F99L mutant kinases. The arginine concentration required
to inhibit 50% of the activity of the wild-type kinase (I
0.5
)is
0.1 m
M
, a value that is comparable to an I
0.5
of 0.05 m
M
Fig. 4. ImmunoWestern blot detection of N-acetylglutamate synthase in
total protein extracts of yeast strain 14S31b bearing plasmid pairs as
indicated above the lanes. pYB2 expresses a haemaglutinin-tagged
NAGS, pYB3 expresses the wild-type NAGK/NAGPR, pHP21 and
pHP22 are derived from pYB3 and, respectively, lack the ascomycete-
specific domain and the catalytic domain of the kinase encoding
region, pHP17, also derived from pYB3, bears the F99L modification
in NAGK. pYX213 and pYX223 are the empty cloning vectors. (A)
Equal amounts of total protein were loaded in lanes 1–4, and double

that amount in lanes 6–9. (B) All lanes contain equal amounts of total
protein. (C) Lanes 1 and 2 contain 7.5 lg total protein, lanes 3 and 4
contain 15 lg, and lanes 5 and 6 contain 30 lg. MM is the molecular
mass standard.
Fig. 5. Feedback inhibition by arginine of yeast N-acetylglutamate (A)
kinase and (B) synthase activities in extracts of strain YeBR6
(pYB2 + pYB3) expressing NAGS, NAGK and NAGPR (d)and
strain YeBR6(pYB2 + pHP17) expressing NAGS, mutant F99L
NAGK and NAGPR (s), after growth on galactose medium. The insert
shows the effect of arginine at higher concentrations, (A) up to
100 m
M
,(B)upto10m
M
. The arginine-resistant residual activity in A
is due to a distinct enzymatic activity not encoded by ARG6.
Ó FEBS 2003 Co-ordinated feedback regulation (Eur. J. Biochem. 270) 1021
mentioned by Hilger [26]. It is also comparable to the I
0.5
of
0.075 m
M
determined for the wild-type kinase of N. crassa
[27]. In the absence of arginine the kinase specific activity in
the extract from yeasts carrying the F99L mutation was
only one half of the activity of wild-type yeast. It remains
susceptible to feedback inhibition by arginine, but 100 times
higher arginine concentration is required to reach 50%
inhibition (I
0.5

of 10 m
M
).
Synthase activity and its arginine sensitivity were also
assayed using the same extracts (Fig. 5B). In the presence of
the wild-type kinase, 0.015 m
M
arginine is required to reach
I
0.5
of the synthase. This value corresponds with the
I
0.5
-value of 0.02 m
M
published by Wipf and Leisinger
[25]. It is noticeable that the yeast synthase is 10 times more
sensitive to feedback inhibition by arginine than the
N. crassa synthase (50% inhibition at 0.16 m
M
[28]). When
coexpressed with the F99L mutant kinase, the synthase
behaves quite differently than when coexpressed with the
wild-type kinase. The synthase specific activity is reduced
fivefold and, like the mutant kinase, the enzyme becomes
much less sensitive to arginine feedback inhibition (I
0.5
of
0.75 m
M

). The reduction in activity is not a consequence of
a loss in synthase protein, as immunoWestern blots revealed
equal amounts of the haemaglutinin-tagged synthase in
both transformants (Fig. 4C).
The increased resistance to feedback inhibition of the
wild-type synthase, resulting from the presence of the
feedback-resistant F99L kinase, suggests a mechanism of
co-ordinated feedback regulation of the synthase and the
kinase.
Arginine feedback inhibition of
N
-acetylglutamate
kinase is altered in the absence of
N
-acetylglutamate
synthase protein
Proper feedback inhibition of the synthase appears to
require an association with a feedback-sensitive kinase. To
find out whether the opposite is also true, we studied
arginine feedback inhibition of the kinase in the presence
and absence of the synthase protein. KA44, a strain derived
from 14S31b (ura3
–
,his3
–
) and lacking the ARG2 ORF, was
constructed and cotransformed with (pYB2 + pYB3) and
(pYX213 + pYB3). Because of the growth requirement of
the latter transformants, cells were grown on galactose
medium supplemented with arginine. Kinase specific acti-

vity in extracts was assayed in the presence of increasing
arginine concentrations. The results are presented in Fig. 6.
In extracts of KA44(pYB2 + pYB3), the wild-type
kinase proved to be sensitive to arginine inhibition. The
inhibition curve displays a normal hyperbolic shape and the
I
0.5
-value of 0.26 m
M
arginine in the illustrated experiment
(Fig. 6) is comparable to the I
0.5
of 0,1 m
M
measured with
YeBR6(pYB2 + pYB3) extracts (Fig. 5A). In fact, three
similar, less detailed experiments (data not shown), display
an I
0.5
-value closer to 0.1 m
M
. Interestingly, the apparent
affinity of the kinase for the feedback inhibitor is markedly
lower when the synthase is absent (I
0.5
-value of 1.5 m
M
). In
addition, the inhibition curve becomes reproducibly sigmo-
idal. These data show that the kinase requires an interaction

with the synthase for its normal arginine feedback inhibi-
tion. Furthermore, the values of the specific activity of the
kinase were reproducibly two times higher in extracts of
KA44(pYX213 + pYB3) compared to those of KA44
(pYB2 + pYB3), suggesting that the association with the
synthase inhibits partially the kinase activity.
Discussion
In our previous work, we showed that synthase forms a
complex with the kinase, an association essential to synthase
activity and synthase protein accumulation. In contrast, no
physical interaction could be demonstrated conclusively
between synthase (or kinase) and reductase despite the fact
that some data suggested a role of the reductase for synthase
activity [32].
To investigate further the role of the reductase in the
metabolon, we have now followed two new genetic
approaches. First, the activity of the synthase, expressed
from its natural locus, was measured in yeast deletion
mutants lacking relevant parts of the chromosomal ARG5,6
gene. Second, synthase activities and protein accumulation
were monitored by over-expressing yeast genes in the
heterologous E. coli background. Both approaches led to
the same conclusions, namely that synthase activity is
strictly dependent on the presence of the kinase and
essentially independent of the reductase. This dispensibility
of the reductase for synthase activity, is in contrast with the
previous results obtained in a context of over-expression in
yeast, which had indicated an apparent requirement of the
reductase [32]. One (unexplored) hypothesis that might
explain the discrepancy, is that the bulk of over-expressed

kinase is inefficiently targeted to the yeast mitochondria in
the absence of reductase.
The present data in E. coli further show that no synthase
protein is detectable in the absence of kinase, a situation
similar to the one observed previously in yeast. We attribute
this drastic reduction in steady state concentration of the
protein to an instability of the yeast synthase when not
associated to the kinase. Because it is also observed in the
heterologous E. coli background, this apparent instability is
likely to be an intrinsic feature of the protein, rather than to
result from of a yeast specific degradation process. Alter-
natively, the uncomplexed synthase might present structural
features rendering it susceptible to proteolytic degradation
Fig. 6. Feedback inhibition by arginine of yeast N-acetylglutamate
kinaseactivityinextractsofDarg2 strain KA44(pYB2 + pYB3) (d)
and KA44(pYX213 + pYB3) (s), after growth on galactose medium
supplemented with arginine.
1022 K. Pauwels et al. (Eur. J. Biochem. 270) Ó FEBS 2003
in general. In any case, the lack of synthase protein in the
absence of kinase has been observed with expression
systems using totally different promoters and translation
initiation signals. Therefore, the hypothesis that it results
from an effect on transcription or translation can be
reasonably excluded.
The data in hand today do not allow to tell if the lack of
synthase activity in the absence of kinase fully correlates
with the physical disappearance of the enzyme, or if inactive
free synthase can subsist. However, as discussed below, the
kinetic properties of the synthase are likely to be modulated
by its association with the kinase.

The role of the catalytic and the ascomycete specific
domainofNAGKincomplexformationwithNAGSwas
tested in an indirect way. Our approach is based on the
knowledge that synthase activity and protein levels are
dependent upon the enzyme association with the kinase (32
and new data above). Therefore, capacity for complex
formation was deduced from measurements of over-
expressed synthase activity and from estimations of the
concentrations of over-expressed synthase protein. Present
data showed that deletions of the catalytic domain (CD) or
the ascomycete specific domain (ASD) of the kinase both
result in the loss of synthase activity and stability. As the
ASD-truncated kinase is shown to be stable and active, it
implies that the ASD of the kinase is necessary for a
productive association with the synthase. The presence of
CD-truncated kinase in yeast extracts could not be
demonstrated (neither over-expressed truncated kinases
nor the wild-type are detectable by SDS/PAGE/Coomassie
Blue staining analysis), but if it is assumed to be stable,
then the data show that the ASD is not sufficient for
association with the kinase. Previous data revealing highly
reduced amounts of synthase when coexpressed with
N-terminally His
10
-tagged kinase [32], support the hypo-
thesis that the ASD of the kinase does not suffice for
complex formation.
By analogy with the F81L substitution of N. crassa
kinase, which renders it feedback resistant, a new mutant of
the yeast kinase (F99L substitution) was constructed. Our

results show that the yeast mutant kinase is feedback
resistant as well. In comparison to the wild-type yeast
kinase, 100 times more arginine is required to reach half-
inhibition of the F99L yeast mutant kinase. Our results
illustrate further that feedback regulation of the wild-type
yeast synthase is strongly dependent upon the presence of a
normally regulated kinase. In the presence of the wild-type
kinase, the synthase is fully inhibited by 0.1 m
M
arginine,
while 10 m
M
arginine is required to inhibit completely the
synthase activity when the partner is a feedback-resistant
mutant kinase. Moreover, the kinetic properties of the
synthase appear dependent upon its association with the
kinase. Indeed, in the context of the mutated kinase,
the synthase specific activity was reduced by 80% while the
amount of enzyme remained unchanged.
Contrasting with the strict requirement of NAGK for
NAGS activity, the absence of NAGS increased the activity
of NAGK by approximately twofold, possibly reflecting
inhibition of NAGK in the NAGS/NAGK complex. The
presence of NAGS had also the effect of rendering
hyperbolic the inhibition of the kinase by arginine, whereas
in absence of NAGS the inhibition was sigmoidal and
exhibited an increased I
0.5
-value, strongly suggesting that
more than one site for arginine has to be occupied to

inhibit the kinase. Although the present results demon-
strate quite different apparent affinities for arginine of the
kinase and the synthase, the data do not allow to decide if
specific inhibitory sites for arginine exist in the two
enzymes or if only the kinase possesses a binding site for
the inhibitor. In any case, the mutual influence of each
enzyme on the other concerning its susceptibility to
arginine inhibition suggest the existence of either a cross-
talk between the inhibitory sites of the two enzymes, or an
intermoleculair transmission of an inhibitory signal from a
binding site on the kinase to the catalytic site of the
synthase. Both are in agreement with the hypothesis of
co-ordinated feedback regulation of NAGS and NAGK
in yeast, as proposed initially for N. crassa (R. L. Weiss,
S. K. Chae, J. Chung, C. McKinstry, M. Karaman and
G. Turner, University of California, Los Angeles, CA,
USA, personal communication).
Acknowledgements
K. P. is the recipient of a Specialization Grant from the IWT (Vlaams
Instituut voor de bevordering van het wetenschappelijk-technologisch
onderzoek in de industrie). We thank J. P. Ten Have for his help with
the figures and tables.
References
1. Cunin, R., Glansdorff, N., Pierard, A. & Stalon, V. (1986) Bio-
synthesis and metabolism of arginine in bacteria. Microbiol. Rev.
50, 193–225.
2. Davis, R. (1986) Compartmental and regulatory mechanisms in
the arginine pathways of Neurospora crassa and Saccharomyces
cerevisiae. Micr. Rev. 50, 280–313.
3. Harris, B. & Singer, M. (1998) Identification and characterization

of the Myxococcus xanthus argE gene. J. Bacteriol. 180, 6412–
6414.
4. Van de Casteele, M., Demarez, M., Legrain, C., Glansdorff, N. &
Pie
´
rard, A. (1990) Pathways of arginine biosynthesis in extreme
thermophilic archaeo- and eubacteria. J. Gen. Microbiol. 136,
1177–1183.
5. Xu, Y., Liang, Z., Legrain, C., Ruger, H. & Glansdorff, N. (2000)
Evolution of arginine biosynthesis in the bacterial domain: novel
gene-enzyme relationships from psychrophilic Moritella strains
(Vibrionaceae) and evolutionary significance of N-alpha-acetyl
ornithinase. J. Bacteriol. 182, 1609–1615.
6. Udaka, S. & Kinoshita, S. (1958) Studies on 1-ornithine fermen-
tation. I. The biosynthetic pathway of 1-ornithine in Micrococcus
glutamicus. J. General Appl. Microbiol. 4, 272–282.
7. Hoare, D. & Hoare, S. (1966) Feedback regulation of arginine
biosynthesis in blue-green algae. J. Bacteriol. 92, 375–379.
8. Haas, D., Kurer, V. & Leisinger, T. (1972) N-acetylglutamate
synthetase of Pseudomonas aeruginosa. An assay in vitro and
feedback inhibition by arginine. Eur. J. Biochem. 31, 290–295.
9. Shinners, E. & Catlin, B. (1978) Arginine biosynthesis in Neisseria
gonorrhoeae: enzymes catalyzing the formation of ornithine and
citrulline. J. Bacteriol. 136, 131–135.
10. Meile, L. & Leisinger, T. (1984) Enzymes of arginine biosynthesis
in methanogenic bacteria. Experientia 40, 899–900.
11. Sakanyan, V., Kochikyan, A., Mett, I., Legrain, C., Charlier, D.,
Pie
´
rard, A. & Glansdorff, N. (1992) A re-examination of the

pathway of ornithine biosynthesis in a thermophilic and two
mesophilic Bacillus species. J. Gen. Microbiol. 138, 125–130.
Ó FEBS 2003 Co-ordinated feedback regulation (Eur. J. Biochem. 270) 1023
12. Hindle,Z.,Callis,R.,Dowden,S.,Rudd,B.&Baumberg,S.
(1994) Cloning and expression in Escherichia coli of a Strepto-
myces coelicolor A3(2)argCJB gene cluster. Microbiology 140,
311–320.
13. Baetens, M., Legrain, C., Boyen, A. & Glansdorff, N. (1998)
Genes and enzymes of the acetyl cycle of arginine biosynthesis in
the extreme thermophilic bacterium Thermus thermophilus HB27.
Microbiology 144, 479–492.
14. Middelhoven, W. (1963) The ornithine pathway in the yeast
Candida utilis. Biochim. Biophys. Acta 77, 152–154.
15. De Deken, R. (1963) Biosynthe
`
se de l’arginine chez la levure. I. Le
sort de la N-acetylornithine. Biochim. Biophys. Acta 78, 606–616.
16. Staub, M. & Denes, G. (1966) Mechanism of arginine biosynthesis
in Chlamydomonas reinhardi.I.Purificationandpropertiesof
ornithine acetyltransferase. Biochim. Biophys. Acta 128, 82–91.
17. Weiss, R. & Davis, R. (1973) Intracellular localization of enzymes
of arginine metabolism in Neurospora. J. Bacteriol. 248, 5403–
5408.
18. Jauniaux, J.C., Urrestarazu, A. & Wiame. J.M. (1978) Arginine
metabolism in Saccharomyces cerevisiae: subcellular localization
of the enzymes. J. Bacteriol. 133, 1096–1107.
19. Vyas, S. & Maas, W. (1963) Feedback inhibition of acetyl
glutamate synthetase by arginine in Escherichia coli. Arch. Bio-
chem. Biophys. 100, 542–546.
20. Leisinger, T. & Haas, D. (1975) N-acetylglutamate synthase of

Escherichia coli. Regulation of synthesis and activity by arginine.
J. Biol. Chem. 250, 1690–1693.
21. Abdelal, A. & Nainan, O. (1979) Regulation of N-acetylglutamate
synthesis in Salmonella typhimurium. J. Bacteriol. 137, 1040–1042.
22. Udaka, S. (1966) Pathway-specific pattern of control of arginine
biosynthesis in bacteria. J. Bacteriol. 91, 617–621.
23. Haas, D. & Leisinger, T. (1975) N-acetylglutamate 5-phospho-
transferase of Pseudomonas aeruginosa. Catalytic and regulatory
properties. Eur. J. Biochem. 52, 377–383.
24. Haas, D., Kurer, V. & Leisinger, T. (1972) N-acetylglutamate
synthetase of Pseudomonas aeruginosa. An assay in vitro and
feedback inhibition by arginine. Eur. J. Biochem. 31, 290–295.
25. Wipf, B. & Leisinger, T. (1979) Regulation of activity and
synthesis of N-acetylglutamate synthase from Saccharomyces
cerevisiae. J. Bacteriol. 140, 874–880.
26. Hilger, F., Culot, M., Minet, M., Pie
´
rard, A., Grenson, M. &
Wiame, J.M. (1973) Studies on the kinetics of the enzyme sequence
mediating arginine synthesis in Saccharomyces cerevisiae. J. Gen.
Microbiol. 75, 33–41.
27. Wolf, E. & Weiss, R. (1980) Acetylglutamate kinase. A
mitochondrial feedback-sensitive enzyme of arginine biosynthesis
in Neurospora crassa. J. Biol. Chem. 255, 9189–9195.
28. Hinde, R.W., Jacobson, J.A., Weiss, R.L. & Davis, R.H. (1986)
N-acetyl-L-glutamate synthase of Neurospora crassa.Character-
istics, localization, regulation, and genetic control. J. Biol. Chem.
261, 5848–5852.
29. Boonchird, C., Messenguy, F. & Dubois, E. (1991) Determination
of amino acid sequences involved in the processing of the ARG5/

ARG6 precursor in Saccharomyces cerevisiae. Eur. J. Biochem.
199, 325–335.
30. Gessert, S., Kim, J.H., Nargang, F. & Weiss, R.L. (1994) A
polyprotein precursor of two mitochondrial enzymes in Neuro-
spora crassa. Gene structure and precursor processing. J. Biol.
Chem. 269, 8189–8203.
31. Kim, J.H. & Weiss, R.L. (1995) Genetic analysis of interactions
between arg-14 and arg-6 products in Neurospora crassa. Mol.
Cells 5, 461–466.
32. Abadjieva, A., Pauwels, K., Hilven, P. & Crabeel, M. (2001) A
new yeast metabolon involving at least the two first enzymes of
arginine biosynthesis: acetylglutamate synthase activity requires
complex formation with acetylglutamate kinase. J. Biol. Chem.
276, 42869–42880.
33. Weiss, R. & Lee, C. (1980) Isolation and characterization of
Neurospora crassa mutants impaired in feedback control of
ornithine synthesis. J. Bacteriol. 141, 1305–1311.
34. Yu, Y.G., Turner, G. & Weiss, R.L. (1996) Acetylglutamate
synthase from Neurospora crassa: structure and regulation of
expression. Mol. Microbiol. 22, 545–554.
35. Caldovic, L., Morizono, H., Yu, X., Thompson, M., Shi, D.,
Gallegos, R., Allewel, N., Malamy, M. & Tuchman, M. (2002)
Identification, cloning and expression of the mouse N-acetyl-
glutamate synthase gene. Biochem. J. 364, 825–831.
36. Caldovic, L., Morizono, H., Gracia Panglao, M., Gallegos, R.,
Yu, X., Shi, D., Malamy, M.H., Allewell, N.M. & Tuchman, M.
(2002) Cloning and expression of the human N-acetylglutamate
synthase gene. Biochem. Biophys. Res. Commun. 299, 581–586.
37. Ramon-Maiques, S., Marina, A., Gil-Ortiz, F., Fita, I. &
Rubio, V. (2002) Structure of acetylglutamate kinase, a key

enzyme for arginine biosynthesis and a prototype for the amino
acid kinase enzyme family, during catalysis. Structure (Camb) 10,
329–342.
38. Crabeel, M., Seneca, S., Devos, K. & Glansdorff, N. (1988)
Arginine repression of the Saccharomyces cerevisiae ARG1 gene.
Comparison of the ARG1 and ARG3 control regions. Curr. Genet
13, 113–124.
39. Wach, A. (1996) PCR-synthesis of marker cassettes with long
flanking homology regions for gene disruptions in S. cerevisiae.
Yeast 12, 259–265.
40. Storici, F., Lewis, K. & Resnick, M. (2001) In vivo site-directed
mutagenesis using oligonucleotides. Nat. Biotechnol. 19, 773–776.
41. Messenguy, F. (1976) Regulation of arginine biosynthesis in
S. cerevisiae: isolation of a cis-dominant constitutive mutant for
ornithine carbamoyltransferase synthesis. J. Bacteriol. 128, 49–55.
1024 K. Pauwels et al. (Eur. J. Biochem. 270) Ó FEBS 2003