Báo cáo khoa học: Characterization and synthetic applications of recombinant AtNIT1 from Arabidopsis thaliana doc

Characterization and synthetic applications of recombinant AtNIT1
from
Arabidopsis thaliana
Steffen Osswald,
1
Harald Wajant
2
and Franz Effenberger
1
1
Institut fu
È
r Organische Chemie, and
2
Institut fu
È
r Zellbiologie und Immunologie, Universita
È
t Stuttgart, Germany
The nitrilase AtNIT1 from Arabidopsis thaliana was over-
expressed in Escherichia coli with an N-terminal His
6
tag
and puri®ed by zinc chelate anity chromatography in a
single step almost to homogeneity in a 68% yield with a
speci®c activity of 34.1 U ámg
)1
. The native enzyme
( 450 k Da) consists of 11±13 subunits (38 kDa). The
temperature optimum was determined to be 35 °C, and a
pH optimum of 9 was fo und. Thus, recombinant AtNIT1

resembles in its properties the native enzyme and the
nitrilase from Brassica napus. The stability of AtNIT1
could be signi®cantly i mproved by t he addition of
dithiothreitol and E DTA. The substrate range of AtNIT1
diers considerably from those of bacterial nitrilases.
Aliphatic nitriles are the most eective substrates, showing
increasing rates of hydrolysis with increasing size of the
residues, a s d emonstrated in the series butyronitrile,
octanenitrile, phenylpropionitrile. In comparison with
3-indolylacetonitrile, the rate of hydrolysis of 3-phenyl-
propionitrile is increased by a factor of 330, and the K
m
value is reduced by a factor of 23. With the exception of
¯uoro, substituents in the a position to the nitrile function
completely inhibit the hydrolysis.
Keywords: Arabidopsis thaliana; enzymatic properties; nitrile;
substrate s peci®city.
Nitriles are found in a variety of naturally occurring
compounds such as cyanolipids, cyanoglucosides, and
simple aliphatic or aromatic nitriles as metabolites of
micro-organisms [1]. In nature, the hydrolysis of nitriles to
the corresponding carboxylic acid and NH
3
is catalyzed by
nitrilases ( EC 3.5.5.1) or based on the sequential action of
a nitrile hydratase (EC 4.2.1.84)±amidase (EC 3.5.1.4)
system [2,3]. Most nitrilases described so far have been
isolated from fungi or bacteria. In recent years, however,
four nitrilases (AtNIT1±AtNIT4) have been cloned from
Arabidopsis thaliana, a member of the brassicaceae family

[4,5]. The genes of AtNIT1±3 are clustered on chromosome 3
and have sequence identities of more than 80% at the
amino acid level, whereas AtNIT4 has a distinct chromo-
somal localization a nd is only 65% identical with AtNIT1±3
[5]. The subdivision of the Arabidopsis nitrilases i nto
AtNIT1±3 and AtNIT4 is also re¯ected by functional
differences between these enzymes. Whereas AtNIT1±3
convert 3-indolylacetonitrile (IAN) into the plant hormone
3-indolylacetic acid, IAN is not a substrate for AtNIT4
[6,7]. Moreover, homologs of AtNIT1±3 have exclusively
been found in Arabidopsis and other members of the
brassicaceae, whereas AtNIT4 isoforms have also been
reported in species from other taxonomic groups such as
tobacco [8] and rice [7]. In accordance with the brassi-
caceae-restricted occurrence of nitrilases of the AtNIT1±3
type, t hese en zymes seem to be involved in the degradation
of nitriles released from glucosinolates, which can be found
in high concentrations in various species of the brassicaceae
[9]. Recent studies have shown that AtNIT4 and two
related n itrilases f rom t obacco are b-cyano-(
L
)-alanine
nitrilases [7]. As nitrilases of the AtNIT4 type have been
found in taxonomically quite distinct groups, it seems likely
that AtNIT4 homologs may exist in all higher plants.
In accordance with this is the fact that the substrate of the
AtNIT4-type nitrilases, b-cyano-(
L
)-alanine, seems to occur
in all plants as t he result of detoxi®cation of cyanide, which

is inevitably produced during biosynthesis of the plant
hormone ethylene [10].
In general, nitriles are synthetically more acce ssible than
the corresponding carboxylic acids. Chemical hydrolysis of
nitriles to carboxylic acids, however, requires drastic
conditions (strong mineral acids and bases and relatively
high reaction temperature). Biocatalysts for the transfor-
mation of nitriles to carboxylic acids are therefore of
particular interest.
Up until now, hydratase±amidase systems, not nitri-
lases, have mainly been used in practice as nitrile-
hydrolyzing enzymes [3,11±14]. In this paper, we report
on basic investigations of the nitrilase AtNIT1 from
A. thaliana, in particular, the substrate range required for
the hydrolysis of nitriles to carboxylic acids. Cloning and
overexpression of AtNIT1 [4,5] (EC 3.5.5.1) will provide
an interesting plant nitrilase in suf®cient quantities for
synthetic applications. The application of AtNIT1 to the
hydrolysis of several speci®c substrates such as aliphatic
dinitriles and 2-¯uoroarylacetonitriles has been published
in detail [15,16].
Correspondence to F. Eenberger, Institut fu
È
r Organische Chemie,
Universita
È
t Stuttgart, Pfaenwaldring 55, D- 7 0569 St uttgart,
Germany. Fax: + 49 711685 4269, Tel.: + 49 711685 4265,
E-mail: franz.e
Abbreviations: AtNIT1, nitrilase from Arabidopsis thaliana;IAN,

3-indolylacetonitrile.
Note: This is part 42 of the series of publications Enzyme catalyzed
reactions. Part 41 is Eenberger , F. & Osswald, S. (2001) Select ive
hydrolysis of aliphatic dinitriles to monocarboxylic acids by a nitrilase
from Arabidopsis thaliana. Synthesis 1866±1872.
(Received 3 September 2001, revised 23 November 2001, accepted 26
November 2001)
Eur. J. Biochem. 269, 680±687 (2002) Ó FEBS 2002
MATERIALS AND METHODS
Expression cloning of AtNIT1
AtNIT1 cDNA was cloned in the expression vector pQE10
(Qiagen), which allows isopropyl b-
D
-thiogalactoside-
induced expression of N-terminally His-tagged recombinant
protein. In brief, the c oding region and p art of the
3¢-noncoding region of AtNIT1 cDNA were ampli®ed
from an A. thaliana cDNA library (Stratagene) with an
advanced polymerase system (Clontech) using the primers
AtNIT1-for (5¢-GCTGCTAGATCTTATGTC AACTGT
CCAAAA CGCAACTCCTTTTAACGGCGTTGCCCC
ATCCACC -3¢; start codon according to [4] in bold) and
AtNIT1-rev (5¢-ACAATTGATGATTCAACGCCCAAC
3¢). Using the BglII sites in the 5¢ overhang of AtNIT1-for
and the 3¢-noncoding region of the cDNA, the AtNIT1
cDNA was inserted in-frame in the BamHI site of pQE10.
The resulting expression plasmid pQE10-AtNIT1 was
sequenced to con®rm the identity of the AtNIT1 sequence
after PCR ampli®cation. pQE10-AtNIT1 was transformed
in Escherichia coli M15[pREP4] cells (Qiagen) for over-

expression of AtNIT1. For induction of recombinant
AtNIT1, an overnight culture was performed at 37 °Cin
Luria±Bertani medium supplemented with ampillicin
(50 lgámL
)1
) and kanamycin (20 lgámL
)1
), diluted 1 : 20
with Luria±Bertani medium supplemented again with
ampillicin and kanamycin, and grown at 30 °C. After 4 h,
isopropyl b-
D
-thiogalactoside was added to a ®nal concen-
tration of 0.5 m
M
for in duction of AtNIT1 expression.
After an additional 6 h, cells were harvested.
Preparation of the crude extract and puri®cation
of recombinant AtNIT1
Cells were separated from the nutrient medium by centri-
fugation (30 min, 4 °C, 5700 g), and washed with sodium
phosphate buffer A (50 m
M
, pH 7.8). The p ellet was
resuspended in buffer A (100 mL per 10 g wet weight)
andsonicated(3´ 5min, 0°C). The homogenate was
centrifuged (40 min, 4 °C, 186 000 g). The supernatant
(100 mL) was degassed with argon, ®ltered through a
membrane (70 lm)andappliedtoaZn
2+

-charged HiTrap
metal c helate af®nity chromatography column (Pharmacia).
The column was rinsed successively with 20 mL each of
sodium p hosphate buffer B (50 m
M
,100 m
M
NaCl, p H 7.8)
and buffer A until the absorbance reached the base line of
column equilibration. Nonspeci®cally bound proteins were
eluted at a ¯ow rate of 2 mLámin
)1
in a 22.5-mL linear
gradient of 0±100 m
M
imidazole in buffer A, and succes-
sively in 5 mL of sodium phosphate buffer C (50 m
M
,
100 m
M
imidazole, pH 7.8). After additional rinsing with
11.25 mL buffer A, AtNIT1 was eluted with 11.25 m L
sodium phosphate buffer (50 m
M
,100 m
M
EDTA, pH 7.8).
To the collected fractions (2.5 mL), 25 lL sodium phos-
phate buffer (50 m

M
, 100 m
M
dithiothreitol, pH 7.8) was
added, and after measurement of enzyme activity, fractions
were pooled.
Gel-®ltration analysis
Recombinant puri®ed AtNIT1 (200 lL) was separated by
size-exclusion c hromatography on a Superdex 200 HR10/30
column (Pharmacia) in 50 m
M
sodium phosphate buffer,
containing 100 m
M
EDTA and 1 m
M
dithiothreitol,
pH 7.8, at a ¯ow rate of 0.5 m Lámin
)1
. For calibration
of the column, thyroglobulin (663 kDa), apoferritin
(443 kDa), alcohol dehydrogenase (150 kDa), BSA
(66 k Da), carbonic anhydrase ( 29 kDa) and cytochrome c
(12.4 k Da) (all from Sigma) were used.
Enzyme assay
Enzyme activity towards 3-phenylpropionitrile was assayed
using bacterial protein (0.34±135 mg) in 5 mL Tris/HCl
buffer (70 m
M
,pH8.5)and50lL 3-phenylpropionitrile in

methanol (0.25
M
). The reaction was carried out for 1 h at
35 °C. An aliquot of 1 mL was acidi®ed with 50 lLHCl
(5
M
) and ex tracted with d iethyl ether (5 mL). After
centrifugation (5 min, 2000 g) and cooling at )30 °Cfor
30 min to freeze the aqueous layer, the organic layer was
decanted and derivatized with ethereal diazomethane
(0.2
M
). After concentration, the residue was taken up in
1 m L d iethyl ether and subjected to gas chromatography on
a C arlo Erba Fractovap 4160 wit h FID and Spectra Physics
minigrator using a capillary glass column ( 50 m) with PS086
and carrier gas 50 kPa hydrogen. Peak areas were calibrated
as follows. A volume of 5 mL each of a solution of
3-phenylpropionitrile (181.5 mg) and 3-phenylpropionic
acid (205.2 mg) in methanol (10 mL), and Tris/HCl buffer
(990 mL, 70 m
M
, pH 8.5) were mixed, and 5 mL from this
mixture was added to 5 mL of the 3-phenylpropionitrile
solution. This procedure w as repeated three times. A sample
of 1 mL from each solution was treated as described above
and analyzed by gas chromatography. The conversion
factor was determined from the plot of ratio areas vs. ratio
concentrations. One unit is de®ned as 1 lmol convert-
edámin

)1
.
Determination of temperature and pH optimum
of AtNIT1
Temperature dependence. Nitrilase activity towards
3-phenylpropionitrile was assayed as described above using
puri®ed enzyme (55.2 UámL
)1
,1.98mgproteinámL
)1
)ina
1 : 5000 dilution with Tris/HCl buff er ( 70 m
M
,pH8.5)and
50 lL 3-phenylpropionitrile in methanol (0.25
M
). The
reaction was initiated by the addition of substrate either
directly after preliminary heating at the respective tempera-
ture for 10 min or cooling at 7 °C f or 30 min and after 24 h,
respectively.
PH dependence. Enzyme activity was assayed as described
above using puri®ed enzyme (56.8 UámL
)1
,1.78mgpro-
teinámL
)1
) in phosphate buffer (50 m
M
, pH 7.8), which w as

diluted (1 : 5000) at 4 °C w ith the respectiv e buffer. Aft er
preliminary w arming at room temperature, the reaction w as
initiated by the addition of 50 lL 3-phenylpropionitrile in
methanol.
RESULTS
Puri®cation and determination of
K
m
values
Recombinant AtNIT1 was puri®ed from E. coli lysates by
metal chelate af®nity chromatography using a Zn
2+
-charged
Ó FEBS 2002 Synthetic applications of recombinant AtNIT1 (Eur. J. Biochem. 269) 681
HiTrap column. After a wash step with 100 m
M
imidazole,
the tightly bound AtNIT1 was eluted with h igh recovery by
100 m
M
EDTA (Fig. 1A). This single-step puri®cation
yielded almost pure AtNIT1 (Fig. 1B) with a speci®c activity
of 34.1 Uámg
)1
(Table 1) and a subunit mass of 38 kDa
(Fig. 1 B). Recombinant AtNIT1 was e luted during
gel-®ltration chromatography (Fig. 1C) in fractions corre-
sponding to a molecular m ass of  450 kDa, s uggesting that
native AtNIT1 occurs as a homomeric protein complex of
11±13 subunits (data not shown).

Recombinant AtNIT1 showed a K
m
value of 3.67 m
M
for
3-indolylacetonitrile and 0.159 m
M
for 3-phenylpropionit-
rile (Fig. 2A,B). The K
m
value for 3-indolylacetonitrile is in
good agreement with a reported value of 5 m
M
[4].
Enzyme stability
As a crude extract o f recombinant AtNIT1 had a half-time
of 2 d ays at pH 8 and 4 °C, the i n¯uence of antioxidants
and protease inhibitors on enzyme stability was investi-
gated.
Of the applied thiols that p roved to be good an tioxidants
(mercaptoethanol and dithiothreitol) [4,17±21], dithiothre-
itol had the better stabilizing effect (Table 2). The loss of
enzyme activity on the addition of 2 m
M
dithiothreitol was
20% compared with 63% for the reference without thiol.
However, increasing the dithiothreitol concentration to
5m
M
did not further improve enzyme stability. The best

result with protease inhibitors was achieved using EDTA at
a concentration of 2 m
M
(Table 2). Thus, all buffers used
for cell disintegration and conversions were supplemented
with dithiothreitol a nd EDTA (2 m
M
each). In this way, we
succeeded in signi®cantly increasing the enzyme stability of
both crude extract and puri®ed enzyme: after 2 days at
room temperature and 3 months at 4 °C, 95% and 90%
enzyme activity, respectively, remained.
Temperature optimum
The nitrilases investigated so far generally show highest
activity in the temperature range 35±40 °C, no matter what
the enzyme source [18,21±23]. However, as little is known
about their stability a t higher temperatures, which is a
decisive factor in their application as biocatalysts in
chemical reactions, the effect of temperature on AtNIT1
stability was investigated. Recombinant AtNIT1 shows a
sharp temperature optimum at 35 °C, determined after 1 h
of incubation, with a gentle slope at < 35 °C a nd a steeper
slope at > 35 °C (Fig. 3). E nzyme stability at different
temperatures was determined after 24 h of incubation. At
25 °Cand35°C, only a slight decrease in activity was
found. At 35 °C, the relative enzyme activity amounts to
 80%, whereas the enzyme was almost completely deac-
tivated at 40 °C. The highest absolute enzyme activity,
Fig. 1. Puri®cation and characterization of recombinant AtNIT1 in
E. c oli. (A) Lysate of isopropyl b-

D
-thiogalactopyranoside-induced
E. c oli-pQE10-AtNIT1 was applied to a Zn
2+
-charged HiTrap
column. The column was washed w ith 100 m
M
imidazole (- - - -), and
bound AtNIT1 was eluted with 100 m
M
EDTA (± ± ± ±). Fractions were
analyzed for nitrilase a ctivity as described in M aterials and methods.
The elution pro ®le was detected at 280 nm. (B) Fractions o btaine d in
(A) were separat ed by SDS /PAGE a nd stain ed with Coo massie . Last
lane, molecular masses of standards (kDa); lanes 17±19, active fractions
after HiTrap chromatography. (C) E stimation of native m olecular mass
of recombinant AtNIT1 by gel-®ltration chromatography on a
Superdex 200 HR10/30 column. A 200 lL volume of puri®ed
AtNIT1 (d) and various m ass standards [s; thyroglobulin ( 663 kDa),
apoferritin (443 kDa), alcohol dehydrogenase (150 kDa), BSA
(66 kDa), carbo nic anhydrase ( 29 kDa) and c ytochrom e c (12.4 kDa)]
were separated at a ¯ow rate of 0.5 mLámin
)1
.AtNIT1waseluted.The
AtNIT1 elution volume corresponds to m olec ular mass of  450 kDa.
The dotted line shows the 95% con®dence interval of the linear
regression of the s emilogarithmic molecular m ass±elution volume plot.
Table 1. Summary of puri®cation of the nitrilase from A. thaliana.
Fraction
Total

activity (U)
Total
protein (mg)
Speci®c
activity (Uámg
)1
)
Puri®cation
(fold)
Yield (%)
Crude extract 459 4350 0.10 1 100
HiTrap 312 9.15 34.10 326 68
682 S. Osswald et al.(Eur. J. Biochem. 269 ) Ó FEBS 2002
however, w as found at 35 °C, and, moreover, t he stability at
this temperature is suf®cient for applications in longer
lasting biotransformations.
PH dependence of AtNIT1
The pH dependence of AtNIT1 was investigated with
different buffer systems in order to guarantee suf®cient
buffering capacity in the range pH 6±10 (Fig. 4).
As can be seen from Fig. 4, the choice of the buffer
system affects the enzyme activity slightly, changing from
Tris/HCl to glycine/NaOH. With both buffer systems,
however, an activity optimum of pH 9.0 was found, with
97% of the maximum activity being measured at pH 8.5.
The decrease in enzyme activity at pH values > 9 is not an
irreversible process: acidifying an enzyme solution with
pH 10 back to pH 9 r esulted in > 80% r ecovery of activity.
The pH optimum measured in this way is in slight contrast
with the value of pH 7.5 reported for the nitrilase from

A. thaliana [4], possibly arising from the deviant structure at
the N-terminus. However, several bacterial nitrilases also
clearly have a basic pH optimum [23±27].
Substrate range of recombinant AtNIT1
The substrate range of recombinant AtNIT1 was investi-
gated using structurally varied aromatic a nd aliphatic
nitriles (Table 3). The a ctivities g iven in Table 3 are referred
to the speci®c nitrilase activity towards butyronitrile. As c an
be seen, aliphatic nitriles are the most effective substrates,
showing increased rates of hydrolysis with increasing size
of the hydrophobic residue, in the order butyronitrile,
octanenitrile, phenylpropionitrile. In contrast with 3-phe-
nylpropionitrile, arylacetonitriles s uch as benzyl cyanide
were converted 20 times more slowly. Aromatic nitriles,
such as benzonitrile, were converted even more slowly (270
times) than phenylpropionitrile. The assumed natural
substrate of AtNIT1, 3-indolylacetonitrile [4], was found
Fig. 3. Determination of the temperature optimum of AtNIT1.
Table 2. Eect of antioxidants and protease inhibitors on enzyme
activity. Enzyme activity was determined after incubation of 5 mL
crude enzyme extract in Tris/HCl buer (70 m
M
, pH 8.0) with the
respective antioxidant (neat) or a st ock s olution of p rotease inhibitors
(50-fold concentration; Protease-Inhibitor-Set, Boehringer-Mann-
heim). T he reaction was carried out fo r 48 h at room t emperature with
vigorous stirring. The initial activity of 112 UáL
)1
is 100% in the case
of antioxidants and 97 UáL

)1
in the case of inhibitors.
Reagent
Concn
(m
M
)
Relative
activity
(%)
Mercaptoethanol
a
162
264
554
Dithiothreitol
a
161
280
578
Aminophenylmethanesulfonyl ¯uoride
b
176
523
EDTA
b
188
296
10 94
100 97

a
Activity of the reference, 37%;
b
activity of the reference, 82%.
Fig. 2. Experimentally determined rates for the hydrolysis of 3-ind-
olylacetonitrile (100 mg proteináL
)1
) (A) an d 3 -phenylpropionitrile
(0.3 mg protein áL
)1
) (B) plotted against initial substrate c oncentrations.
A Lineweaver±Burk plot of the data was used to calculate K
m
values: 3.67 m
M
for 3-indolylacetonitrile and 0.159 m
M
for 3-phenyl-
propionitrile.
Fig. 4. Determination of the pH optimum of AtNIT1 using dierent
buer systems. (j) Tris/HCl; (m)glycine/NaOH;(.)KH
2
PO
4
/
K
2
HPO
4
.

Ó FEBS 2002 Synthetic applications of recombinant AtNIT1 (Eur. J. Biochem. 269) 683
to be a poor substrate (Table 3). Also the hydrolytic rate of
cinnamonitrile, an a,b-unsaturated system, is signi®cantly
diminished compared with the corresponding saturated
phenylpropionitrile. A double bond in th e b,c-position,
however, has almost no effect on enzyme activity, as can be
seen if 4-phenyl-3-butenenitrile is compared with 4-phenyl-
butyronitrile. Suitability as a substrate is strongly in¯ue nced
by the substituents in the 2-position. All substituents other
than ¯uoro inhibit enzymatic hydrolysis almost completely
(Table 3). Nitriles with substituents in the 3-position, for
example 3-methylbutyronitrile, a re also poor substrates, b ut
the decrease in the hydrolytic rate is less pronounced.
Interestingly, benzoylglycine nitrile is a much better
substrate for AtNIT1 than glycine nitrile itself.
Acid amides as byproducts of AtNIT1-catalyzed
nitrile hydrolysis
Acid amide was ®rst detected as a major product of
AtNIT1-catalyzed nitrile hydrolysis with fumaronitrile as
substrate. In this reaction, which was followed by gas
chromatography, less than 10% of the expected amount of
3-cyanoacrylic acid, estimated from the calibration, was
formed. A product mixture of an unidenti®ed product and
3-cyanoacrylic acid in the ratio 93 : 7 (Table 4) was found
by HPLC. As demonstrated by co-injection, fumaric acid
was not formed in the r eaction. After extractive separation
from 3-cyanoacrylic acid and subsequent recrystallization
from chloroform, the unknown product was isolated in
68% yield and unambiguously characterized as 3-cyano-
acrylamide by elemental analysis and NMR spectroscopy.

The a mide to acid ratio was independent of conversion. The
isolated amide was not hydrolyzed to 3-cyanoacrylic acid
under these reaction conditions. Moreover, the hydrolytic
rate and r atio of acid to amide did not depend on enzyme
purity, giving similar results with both crude extract and
highly puri®ed enzyme. From blank experiments, it could
also be excluded that it was an impurity of nitrile hydratase.
As 3-cyanoacrylamide h ad been identi®ed as a byproduct
of fumaronitrile hydrolysis, the AtNIT1-catalyzed hydro-
lysis of other substrates with donor and acceptor substi-
tuents was investigated with respect to amide formation
Table 4. Product distribution of amide and acid in the AtNIT1-cata-
lyzed nitrile hydrolysis. The reactions were performed as described
(Table 3) in Tris/HCl buer (70 m
M
, containing dithiothreitol and
EDTA, 2 m
M
each, pH 8) a t r oom temperature with 10 m
M
substrate
concentration. The samples were analyzed by gas chromatography
and/or HPLC (RP C
18
Vertex column; 4 ´ 250 mm; Nucleosil 100;
5 lm; Knaur ( ); ¯ow rate 1 mLámin
)1
; 220 nm detection wavelength).
Relative activities are referred to the speci®c n itrilase activity t owards
butyronitrile [8.931 lmolámin

)1
á(mg protein)
)1
 100% at pH 8.0;
1.736 lmolámin
)1
á(mg protein)
)1
 100% at pH 6.0].
Substrate
Relative
activity
(%)
Product
distribution
(amide : acid)
a
Relative activity referred to the E-isomer.
b
Conversion at
pH 6.0, relative activity referred to butyronitrile under these
conditions.
Table 3. Relative activities of recombinant AtNIT1-catalyzed hydrolysis of nitriles. The reactions were performed in Tris/HCl buer (7 0 m
M
,with
dithiothreitol and EDTA, 2 m
M
each, pH 8) at room temperatu re. At a concen tratio n of 1.25 m
M
, all substrates were completely soluble; the

enzyme concentration was varied so that the reaction time for all substrates w as in the range 2±4 h for c onversion of 15± 40%. Relative activities are
referred to the speci®c nitrilase activity towards butyronitrile [1.393 lmo lámin
)1
á(mg protein)
)1
 100%].
Substrate
Relative
activity
(%)
Substrate
Relative
activity
(%)
Butyronitrile 100 2-Methylbutyronitrile < 0.01
b
Octanenitrile 291 2-Fluoropentanenitrile 131
3-Indolylacetonitrile
a
2.2 2-Phenylpropionitrile < 0.01
b
Benzonitrile 2.7 3-Methylbutyronitrile 4.0
Benzyl cyanide
a
31 Cyclopropylacetonitrile 15
3-Phenylpropionitrile
a
729 2-Hydroxypentanenitrile 0.2
c
4-Phenylbutyronitrile

a
154 Glycine nitrile 0.4
Cinnamonitrile 48 2-Amino-4-methylpentanenitrile < 0.03
b
4-Phenylbut-3-enenitrile 188 Benzoylglycine nitrile 65
a
See also literature data [9].
b
24 h reaction time.
c
Hydrolysis at pH 7.0.
684 S. Osswald et al.(Eur. J. Biochem. 269 ) Ó FEBS 2002
(Table 4). Amides have also been found as major products
in the AtNIT1-catalyzed hydrolysis of a-¯uoroarylaceto-
nitriles [15]. An a-¯uoro substituent, however, does not
conclusively result in amide formation as can be seen in the
hydrolysis of a-¯uorobutyronitrile, y ielding 95% of the
corresponding acid (Table 4). Nevertheless, both a ¯uoro
substituent in the a position and a second nitrile group
conjugated to the nitrile (fumaronitrile) seem to play a
decisive role in amide formatio n.
The assumption that electron-withdrawing substituents
favor the formation of amides was supported by the
hydrolysis of differently 3-substituted acrylonitriles
(Table 4). Whereas 3-nitroacrylonitrile was hydrolyzed to
3-nitroacrylamide as sole product, in the case of the donor-
substituted 3-methoxyacrylonitrile and crotononitrile, the
corresponding acids were formed almost quantitatively
(Table 4). As 3-nitroacrylonitrile tends to decompose under
basic conditions, the reaction was performed at pH 6

(Table 4), where the amide was formed only by enzyme-
catalyzed hydrolysis and not by chemical reaction, as
con®rmed by a blank experiment. Table 4 reveals that the
relative activity is almost completely independent of the
kind of substituent.
DISCUSSION
Substrate range
Analysis of the substrate range w ith a var iety of structurally
different aromatic and aliphatic nitriles revealed that
aliphatic nitriles are hydrolyzed more ef®ciently than the
natural substrate IAN or structurally related aromatic
nitriles. With a relative a ctivity of only 2.2%, compared with
butyronitrile, 3-indolylacetonitrile is a poorer substrate for
AtNIT1 than benzyl cyanide (31% relative activity). This
®nding is in agreement with literature data, showing that
IAN is one o f the weakest substrates [9]. The order of the
relative AtNIT1 activity towards the substrates 3-phenyl-
propionitrile, 4-phenylbutyronitrile and benzyl cyanide
(Table 3) also corresponds to that just recently reported
[9]. 2-Substituted substrates such as 2-methylbutyronitrile
and 2 -phenylpropionitrile, however, w ere almost c ompletely
unacceptable for AtNIT1, indicating that substituents in the
2-position, other than ¯uoro, inhibit the hydrolysis. The
broad substrate range observed for AtNIT1 in this study is
in good agreement with reports showing that AtNIT1 acts
on a variety of aliphatic a nd aromatic substrates [4,9] and is
in contrast with the high speci®city of AtNIT4 for b-cyano-
(
L
)-alanine [7]. Its broad substrate range, recombinant

accessibility and reasonable stability make AtNIT1 a
promising c andidate for applications in organic chemistry,
in particular the synthesis of optically active 2-¯uorocarb-
oxylic acids, which are very useful as analogs o f pheromones
and antirheumatics, for example [15]. Also the mono-
hydrolysis of aliphatic dinitriles to monocarboxylic acids is
of great industrial interest because selective chemical
hydrolysis is virtually impossible [16].
Amide formation
The formation of amides as byproducts of nitrilase-
catalyzed reactions was ®rst reported as early as 1964
[28,29]. Furthermore, in subsequent publications [19,30±
32], small amounts of amides (< 15%) could be detected
besides the carboxylic acids during nitrilase catalysis. In all
cases, the amide to acid ratio was indepen dent of reaction
conditions (temperature and pH) and the applied enzyme
concentrations. In their basic work on the four A. thaliana
nitrilases NIT1±4, Bartel & Fink [5] described the
conversion of IAN into 3-indolylacetic acid and indole-
3-acetamide and found that the latter is not a substrate
for these enzymes. For the hydrolysis of b-cyano-
(
L
)-alanine, catalyzed by NIT4, Piotrowski et al.[7]
reported the simultaneous formation of asparagine and
aspartic acid in a ratio of 1.5 : 1, independent of reaction
conditions. A dependence of the amide to acid ratio on
the substituents, however, has not been reported in the
literature so far.
Until now the reaction mechanism of n itrilase-catalyzed

hydrolysis has not been con®rmed experimentally. The
mechanism postulated [19,28,29,33] involves the donation
of a cysteine from the enzyme to the nitrile group to yield a
thioimidate, which s ubsequently forms a tetrahedral inter-
mediate A by addition of water. Generally, NH
3
is
eliminated from this intermediate A to give a thioester,
which reacts with a further w ater molecule to give the
carboxylic acid (Fig. 5). Therefore, the formation of the acid
amide from A logically arises from the elimination of
cysteine.
It has been shown for the chemical hydrolysis o f
thioimidate esters [34,35] that the formation of thiol ester
is favored in acidic medium (pH < 2.7), whereas at higher
pH values (pH > 2.7) the formation o f a mide d ominates.
This result was explained by a facilitated elimination of NH
3
caused by protonation of the a mino group in the tetrahedral
intermediate.
Although, a s m entioned, some p apers have dealt with t he
mechanism of the nitrilase-catalyzed hydrolysis of nitriles, a
relationship between the chemical structure of the substrate
and t he amount of acid amide formation has not so far b een
described. For A tNIT1-catalyzed nitrile hydrolysis, w e
could demonstrate for the ®rst time such a structural
Fig. 5. Postulated mechanism for acid amide formation in the n itrilase-
catalyzed hydrolysis of nitriles.
Ó FEBS 2002 Synthetic applications of recombinant AtNIT1 (Eur. J. Biochem. 269) 685
relationship, because the amide formation clearly d epends

on the kind of substituent. The preference for acid amide
formation by a-¯uoro substituents or by acceptor groups
(CN, NO
2
)inp-conjugated nitriles is clear evidence of an
electronically preferred formation and stabilization of the
tetrahedral intermediate A in the enzyme±substrate com-
plex. Becau se the crystal stru cture o f the active site of
AtNIT1 is not known, how the stabilization of the
tetrahedral intermediate assists the elimination of cysteine
to yield the acid amide cannot be explained.
CONCLUSIONS
Chemical hyd rolysis of many nitriles with labile substituents
catalyzed by acid or base is virtually impossible because of
the drastic reaction conditions required. Therefore, over the
last few y ears, b iocatalysts capable of hydrolyzing nitriles to
carboxylic acids have been intensively investigate d [36].
In most cases, however, nitrile hydratase±amidase s ystems
have been described, although not exclusively [36]. The
nitrilase AtNIT1 from A. thaliana is the ®rst plant nitrilase to
be investigated with respect to its synthetic potential. Because
of optimized expression, the enzyme is now accessible in
suf®cient quantities. Clear optimization of enzyme stability
under the reaction conditions, which is important for
practical a pplication, could be achieved b y addition of the
protease inhibitor EDTA (Table 2). Therefore, slowly
reacting nitriles can also be hydrolyzed without problem.
The most important criteria for practical applications,
however, are the substrate range and selectivity of an
enzyme. In contrast with other nitrile-hydrolyzing enzymes,

the nitrilase AtNIT1 stands out as having a very broad
substrate range (Table 3). Although longer-chain aliphatic
nitriles are the most effective substrates, hydrolysis of
aromatic nitriles is also catalyzed. Because of the clearly
improved enzyme stability, AtNIT1-catalyzed hydrolysis is
also applicable to aromatic nitriles. Moreover, AtNIT1
shows a very interesting stereoselectivity and chemoselec-
tivity. The in¯uence of substituents in the a position to the
nitrile function has already been mentioned. Because the
enzyme does not accept any substituents at the a position
except ¯uoro, compounds bearing several different cyano
groups can be selectively hydrolyzed. Hydrolysis of racemic
2-¯uoroarylacetonitriles proceeds enantioselectively [15]. In
dinitriles with chemically comparable cyano groups (e.g.
adiponitrile), only one cyano group is hydrolyzed exclu-
sively to give the corresponding cyanocarboxylic acids
[16,31,37], opening up interesting possibilities for organic
synthesis, for example the preparation of certain lactams
[31]. Furthermore, A tNIT1 e xhibits cis /trans selectivity w ith
a,b-unsaturated nitriles [38], as also reported for other
enzymes [19,39,40].
Because of i ts broad s ubstrate r ange on the one hand and
unusual regioselectivities and stereoselectivities, the nitrilase
AtNIT1 from A. thaliana is a very interesting biocatalyst in
organic synthesis.
ACKNOWLEDGEMENTS
This work was generously supported by the Fonds der Chemischen
Industrie. We acknowledge Dr K. Trummler for assistance in enzyme
puri®cation, Dr S. Fo
È

rster for fermentation, and Dr A. Baro for
preparing the manuscript.
REFERENCES
1. Legras, J.I., Chuzel, G ., Arnaud, A. & Galzy, P. (1990) Natural
nitriles and their metabolism. World J. Microbiol. Biotechnol. 6,
83±108.
2. Faber, K. (1995) Biotransformations in Organic Chemistry,2nd
edn. Springer, Berlin .
3. Drauz, K. & Waldmann, H. (1995) Enzyme Catalysis in Organic
Synthesis. Verlag Chemie, Weinheim.
4. Bartling, D., Seedorf, M., Mitho
È
fer, A. & Weiler, E.W. (1992)
Cloning and expression of an Arabidopsis nitrilase which can
convert indole-3-acetonitrile to t he plant hormone, indole-3-acetic
acid. Eur. J. Biochem. 205, 417±424.
5. Bartel,B.&Fink,G.R.(1994)Dierentialregulationofanauxin-
producing nitrilase gene family in Arabidopsis thaliana. Proc. Natl
Acad. Sci. USA 91, 6649±6653.
6. Schmidt, R.C., Mu
È
ller, A., H ain, R., Bartling, D. & Weiler, E.W.
(1996) Transgenic tobacco plants expressing the Arabidopsis
thaliana nitrilase II enzyme. Plant J. 9, 683±691.
7. Piotrowski, M., Sc ho
È
nfelder, S. & Weiler, E.W. (2001) The
Arabidopsis thaliana iso ge n e NIT4 and its orthologs in tobacco
encode b-cyano-
L

-alanine hydratase/nitrilase. J. Biol. Chem. 276,
2616±2621.
8. Tsunoda, H. & Yamaguchi, K. (1995) The cDNA sequence o f an
auxin-producing nitrilase homolog in t o bacco (GenBank D63331)
(PGR 95-058). Plant Physiol. 109, 339.
9. Vorwerk,S.,Biernacki,S.,Hillebrand,H.,Janzik,I.,Mu
È
ller, A.,
Weiler, E.W. & P iotrowski, M. (2 001) Enzymatic c haracterization
of the recombinant Arabidopsis thaliana nitrilase subfamily
encoded by the NIT2/NIT1/NIT3-gene cluster. Planta 212,
508±516.
10. Kende, H . (1989) Enzymes o f ethylene biosynthesis. Plant Physiol.
91, 1±4.
11. Nagasawa, T., Shim izu, H. & Yamada, H . (1 993) The superiority
of the third-generation c atalyst, Rhodococcus rhodochrous J1
nitrile hydratase, for industrial production of acrylamide. Appl.
Microbiol. Biotechnol. 40, 189±195.
12. Kobayashi, M., Nagasawa, T. & Yamada, H. (1992) Enzymic
synthesis of acrylamide: a success story not yet over. Trends
Biotechnol. 10, 402±408.
13. Layh,N.,Stolz,A.,Bo
È
hme,J.,Eenberger,F.&Knackmuss,H J.
(1994) Enantioselective hydrolysis of racemic naproxen nitrile
and naproxen amide to S-naproxen by new bacterial isolates.
J. Biotechnol. 33, 175±182.
14. Eenberger, F. & Graef, B.W. (1998) Chemo- and enantioselective
hydrolysis of nitriles and acid amides, respectively, with re sting
cells of Rhodococcus sp. C3II and Rhodococcus erythropolis MP50.

J. Biotechnol. 60, 165±174.
15. Eenberger, F. & Oûwald, S. (2001) Enantioselective hydrolysis of
(RS)-2-¯uoroarylacetonitriles using nitrilase from Arabidopsis
thaliana. Tetrahedron: Asymmetry 12, 279±285.
16.Eenberger,F.&Oûwald,S.(2001)Selectivehydrolysisof
aliphatic dinitriles to monocarboxylic acids by a nitrilase from
Arabidopsis thaliana. Synthesis 1866±1872.
17. Harper, D.B. (1977) Microbial metabolism of aromatic nitriles.
Enzymology of C±N cleavage by Nocardia sp. (Rhodococcus
group) N.C.I.B. 11216. Biochem. J. 165, 309±319.
18. Bhalla, T.C., Miura, A., Wakamoto, A., Ohba, Y. & Furuhashi,
K. (1992) Asymmetric hydrolysis of a-aminonitriles to optically
active amino acids by a nitrilase of Rhodococcus rhodochrous
PA-34. Appl. Microbiol. Biotechnol. 37, 184±190.
19. Stevenson,D.E.,Feng,R.,Dumas,F.,Groleau,D.,Mihoc,A.&
Storer, A.C. (1992) Mechanistic and structural studies on
Rhodococcus ATCC 39484 nitrilase. Biotechnol. Appl. Biochem. 15,
283±302.
20. Kobayashi, M., Yanaka, N ., Nagasawa, T. & Y amada, H. (1990)
Puri®cation and characterization of a novel nitrilase of
686 S. Osswald et al.(Eur. J. Biochem. 269 ) Ó FEBS 2002
Rhodococcus rhodochrous K22 that acts on aliphatic nitriles. J.
Bacteriol. 172, 4807±4815.
21. Bestwick, L.A., Gronning, L.M., James, D.C., Bones, A. &
Rossiter, J.T. (1993) Puri®cation and characterization of a nitrilase
from Brassica napus. Physiol. Plant. 89, 811±816.
22. Nagasawa, T., Mauger, J. & Yamada, H. (1990) A novel nitril ase,
arylacetonitrilase, of Alcaligenes faecalis JM3: puri®cation and
characterization. Eur. J. Biochem. 194, 765±772.
23. Kobayashi, M., Nagasawa, T. & Yamada, H . (1989) Nitrilase of

Rhodococcus rhodochrous J1. Puri®cation and characterization.
Eur. J. Bioc hem. 182, 349±356.
24. Bandyopadhyay, A.K ., Nagasawa, T., Asano, Y., Fujishiro, K.,
Tani, Y. & Yamada, H. (1986) Puri®cation and characterization
of benzonitrilases from Arthrobacter sp. strain J -1. Appl. Environ.
Microbiol. 51, 302±306.
25. Harper, D.B. (1977) Fungal degradation of aromatic nitriles.
Enzymology of C-N cleavage by Fusarium so lani. Biochem. J. 167,
685±692.
26. Stalker, D.M., Malyj, L.D. & McBride, K.F. (1988) Puri®cation
and properties of a nitrilase speci®c for the herbicide bromoxynil
and corresponding nucle otide sequence analysis of the bxn gene.
J. Biol. Chem. 263, 6310±6314.
27. Robinson, W. & Hook, R. (1964) Ricinine nitrilase. I. Reaction
product and substrate s peci®city. J. Biol. Chem. 239, 4257±4262.
28. Hook, R. & Robinson, W. (1964) Ricine nitrilase. II. Puri®cation
and properties. J. Biol. Che m. 239, 4263±4267.
29. Thimann, K.V. & Mahadevan, S. (1964) Nitrilase I. Occurrence,
preparation, and general properties of the enzym e. Arch. B iochem.
Biophys. 105, 133±141.
30. Layh, N ., Stolz, A., Fo
È
rster, S., Eenberger, F. & Knackmuss, H J.
(1992) Enantioselective hydrolysis of O-acetylmandelonitrile to
O-acetylmandelic acid by bacterial nitrilases. Arch. Microbiol. 158,
405±411.
31. Gavagan, J.E., Fager, S.K ., F allon, R.D., F olsom, P.W., Herkes,
F.E., Eisenberg, A., Hann, E.C. & DiCosimo, R. (1998) Chemo-
enzymic production of lactams from aliphatic a,x-dinitriles.
J. Org. Chem. 63, 4792±4801.

32. Goldlust, A. & Bohak, Z. (1989) Induction, puri®cation, and
characterization of the nitrilase of Fusarium oxysporum f. sp.
melonis. Biotechnol. Appl. Biochem. 11, 581±601.
33. Dufour, E., Storer, A .C. & Me
Â
nard, R. ( 1995) Engineering n itrile
hydratase a ctivity into a cysteine protease by a single mutation.
Biochemistry 34, 16382±16388.
34. Chaturvedi, R.K., MacMahon, A.E. & Schmir, G.L. (1967) The
hydrolysis of thioimidate esters. Tetrahedral intermediates and
general acid catalysis. J. Am. Chem. Soc. 89, 6984±6993.
35. Chaturvedi, R.K. & Schmir, G.L. (1969) The hydrolysis of
thioimidate esters. II. Evidence for the formation of three species
of the tetrahedral intermediate. J. Am. C hem. Soc . 91, 737±746.
36. Wieser, M. & Nagasawa, T. (2000) Stereoselective nitrile-con-
verting enzymes. In Stereoselective Biocatalysis (Patel, R.N ., ed.),
pp. 463±465. Marcel Dekker, New York.
37. Bengis-Garber, C. & Gutman, A.L. (1988) Bacteria in organic
synthesis: se lective conversion o f 1,3-dicyanobenzene into
3-cyanobenzoic acid. Tetrahedron Lett. 29, 2589±2590.
38. Eenberger, F. & Oûwald, S. (2001) E-Selective hydrolysis of
E,Z a,b-unsaturated nitrile s by the recombinant nitrilase A tN IT1
from Arabidopsis thaliana. Tetrahedron: Asymmetry 13, 2581±
2587.
39. Quiro
Â
s, M., Astorga, C., Rebolledo, F. & Gotor, V. (1995)
Enzymic selective transformations of diethyl fumarate. Tetra-
hedron 51, 7715±7720.
40. Klibanov, A.M. & Siegel, E.H. (1982) Geometric speci®city of

porcine liver carboxylesterase and its application for the produc-
tion of cis-arylacrylic esters. Enzyme Microb. T echnol. 4,
172±175.
Ó FEBS 2002 Synthetic applications of recombinant AtNIT1 (Eur. J. Biochem. 269) 687