Báo cáo khoa học: Altering the surface properties of baculovirus Autographa californica NPV by insertional mutagenesis of the envelope protein gp64 ppt

Altering the surface properties of baculovirus
Autographa californica
NPV by insertional mutagenesis of the envelope protein gp64
Alexandra Spenger, Reingard Grabherr, Lars To¨ llner, Hermann Katinger and Wolfgang Ernst
Institute of Applied Microbiology, University of Agricultural Sciences, Vienna, Austria
The envelope protein gp64 of the baculovirus Autographa
californica nuclear polyhedrosis virus is essential for viral
entry into insect cells, as the glycoprotein both mediates pH-
dependent membrane fusion and binds to host cell receptors.
Surface modification of baculovirus particles by genetic
engineering of gp64 has been demonstrated by various
strategies and thus has become an important and powerful
tool in molecular biology. To improve further the presen-
tation of peptides on the surface of baculovirus particles,
several insertion sites within the gp64 envelope protein were
selected by their theoretical maximum surface probability
and investigated for efficient peptide presentation. The
ELDKWA peptide of the gp41 of HIV-1, specific for the
human mAb 2F5, was inserted into 17 different positions of
the glycoprotein gp64. Propagation of viruses was successful
in 13 cases, mutagenesis at four positions did not result in
production of intact virus particles. Western blotting, FACS
analysis and ELISA were used for characterization of the
different binding properties of the mutants. Insertion of this
peptide into the native envelope protein resulted in high
avidity display on the surface of baculovirus particles. This
approach offers the possibility of effective modification of
surface properties in regard to host range specificity and
antigen display.
Keywords: Autographa californica nuclear polyhedrosis
virus; baculovirus; ELDKWA epitope; gp64 envelope pro-

tein; surface display.
The baculovirus Autographa californica nuclear polyhedro-
sis virus has been widely used as an expression system for
eukaryotic proteins in insect cell culture [1,2], for surface
display of various peptides and proteins [3,4], and more
recently, for the transduction of mammalian cells [5–8].
Baculoviruses are large, enveloped, double-stranded DNA
viruses that replicate in the nuclei of insect cells; their
infection cycle has been studied in detail [9–12]. The major
envelope protein gp64 consists of 512 amino acids [13] with
a signal peptide at the N terminus, which is responsible for
targeting the glycoprotein to the cell plasma membrane, and
a hydrophobic transmembrane domain near the C terminus
[14]. Transcription is regulated by a biphasic promoter,
resulting in synthesis peaks 12 and 24 h post-infection
[15,16]. After viral DNA replication and late gene expres-
sion, nucleocapsids assemble in the nucleus and migrate
through the cytoplasm to the plasma membrane, where
gp64 is concentrated. The glycoprotein is then acquired by
baculoviruses as they bud through the plasma membrane
[17].
Gp64 forms typical peplomeric structures consisting of
three homomeric polypeptide chains linked via disulfide
bonds. Oligomerization occurs post-translationally inside
the endoplasmic reticulum, and misfolded gp64 fails to
accumulate at the cell surface. Glycosylation appears to
occur cotranslationally and may be the rate-limiting step in
the process of gp64 maturation and transport [16]. Gp64 is
essential for viral entry into the host cell, as it mediates cell
receptor-binding activity as well as pH-dependent mem-

brane fusion [18–20]. It has further been shown that gp64 is
required for cell-to-cell transmission of infection in cell
culture and for efficient virion budding [19,21]. Although an
oligomerization and a fusion domain [22] as well as a
transmembrane domain [14] have been identified, no data
about the X-ray crystal structure of gp64 exist. However,
insights about the surface structure and function of the
baculovirus major envelope protein are of high relevance as
baculoviruses have been demonstrated to be a valuable tool
for surface display techniques, providing novel strategies for
ligand screening [23], antigen display [24] and altering the
viral host range [25,26]. Besides the possibility to display
proteins as fusions to a second copy of gp64 or its
membrane anchor sequence, Ernst et al. [23] have described
a novel strategy for efficient peptide display on the surface
of baculoviruses by engineering peptides directly into the
native envelope protein gp64. Thereby, no duplication of
the gp64 is necessary to target the foreign peptide to the
surface of baculoviruses because each copy of the gp64
contains the target sequence, providing high avidity of
inserted peptide. By efficiently displaying specific epitopes
on the viral surface, it becomes possible to modify
baculoviral tropism, e.g. for specific mammalian cell
transduction, and also to consider baculoviruses as an
Correspondence to W. Ernst, Institute of Applied Microbiology,
University of Agricultural Sciences, Muthgasse 18, A-1190 Vienna,
Austria. Fax: +43 13697615, Tel.: +43 136006 6242,
E-mail: , URL: />iam/baculo/
Abbreviations:AcMNPV,Autographa californica multicapsid
nuclear polyhedrosis virus; FCS, fetal calf serum; X-Gal, 5-bromo-

4-chloro-3-indolyl-b-
D
-galactoside; m.o.i., multiplicity of infection;
d.p.i., days post-infection; h.p.i., hours post-infection; AP, alkaline
phosphatase; PO, peroxidase; BCIP, 5-bromo-4-chloro-3-indolyl
phosphate; NBT, nitro blue tetrazolium; FITC, fluorescein
isothiocyanate.
(Received 17 May 2002, revised 11 July 2002,
accepted 25 July 2002)
Eur. J. Biochem. 269, 4458–4467 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03135.x
effective antigen presenting vehicle. To optimize further the
presentation of foreign peptides on baculovirus particles we
screened additional positions throughout the gp64 coding
region for insertion of a specific peptide epitope, without
removing virally encoded amino acid residues. We gener-
ated mutations carrying the peptide ELDKWA [27], specific
for the human mAb 2F5 [28,29], at positions with high
theoretical maximum surface probability, as determined by
computer analysis [30] (Figs 1 and 2). Propagation of
viruses was successful in 13 out of 17 cases. Titres of
recombinants ranged from 10
7
to 10
8
plaque forming units
(p.f.u.)ÆmL
)1
. In some cases we observed smaller plaque
phenotypes indicating a decreased viability. Surface local-
ization of the inserted peptide was demonstrated by flow

cytometry, Western blot analysis and ELISA. By increasing
the binding capacity of a foreign peptide to its ligand, we
were successful in providing an improved tool for applica-
tions, wherever modifications of the baculovirus surface
properties are of importance.
MATERIALS AND METHODS
Construction of transfer plasmids
Cloning procedures were performed according to Sam-
brook et al. [31], restriction enzymes and other modifying
enzymes were purchased either from Roche Diagnostics
(Mannheim, Germany) or MBI Fermentas (St Leon-Rot,
Germany) and used according to the manufacturer’s
recommendations. For PCR we used the DyNAzyme
TM
EXT DNA polymerase from Finnzymes (Espoo, Finland).
The plasmid used for homologous recombination at the
gp64 locus was p64flank [23], which contains the 7.576-bp
HindIII fragment A2 of Autographa californica multi-
capsid nuclear polyhedrosis virus (AcMNPV) including
the whole gp64 ORF (Entrez-Protein number NP_054158)
[32]. For generation of mutant vectors with insertion of the
ELDKWA motif at different positions in the gp64, different
cloning strategies were developed. The peptides were
inserted into the baculoviral envelope protein without
removing viral residues.
The plasmids pELD31, 43, 59, 148, 180, 234 were
constructed by inserting an altered NotI fragment into the
p64flank treated with NotI. The altered NotI fragments were
produced by two PCR reactions, amplifying two fragments
using 64-(-639)-NotI-back and a 64-ELD-SacI-for primer

for one reaction and a 64-ELD-SacI-back and 64-993-for
primer for the second, the template was p64flank in both
cases. After digestion with SacI the two fragments were
ligated and another PCR was carried out with the primers
64-(-639)-NotI-back and 64-939-for. The PCR product was
digested with NotI and after agarose gel electrophoresis the
insert was ligated into NotI-treated p64flank. Primers used
for construction of pELD31, 43, 59, 148, 180 and 234 are
listed in Table 1 (section A).
Plasmid constructs for ELDKWA-epitope insertions at
codon 277, 276, 275, 274, 271 of gp64, were made as
described by Ernst et al. [23] for pELD278. PCRs were
performed with 64-(-639)-NotI-back and primers 64-277-
ELD-NotI-for, 64-276-ELD-NotI-for, 64-275-ELD-NotI-
for, 64-274-ELD-NotI-for and 64-271-ELD-NotI-for,
respectively (Table 1, section B). Purified NotI-digested
fragments were inserted into the NotI-treated vector p64flank
thereby substituting the excised fragment for the particular
gp64 mutant construct (pELD277–pELD271).
The inserts for pELD279, pELD280, pELD281,
pELD282, pELD283, pELD290 were generated by ligation
of two fragments made by PCR with primers 64-394-SacII-
back and 64-ELD-SacI-for and 64-ELD-SacI-back and 64-
1536-BamHI-for (Table 1, section C). The two fragments
were treated with SacI, ligated, and afterwards another
PCR was carried out with the outer primers 64-SacII-394-
back and 64-1536-BamHI-for. This PCR fragment was
Fig. 1. Schematic map of the gp64 envelope protein. The AcMNPV
gp64 ORF encodes a protein of 512 amino acids, with an N-terminal
signal peptide (L), a hydrophobic transmembrane domain (TM) and a

cytoplasmic tail domain at the C terminus (CTD). In addition two
functional regions have been characterized, a fusion domain (F) and an
oligomerization domain (O) within a helical region (Helix) [22]. Gp64
contains five predicted N-glycosylation sites (Y). The epitopes of two
mAbs are indicated: B12D5 epitope from amino acid 277 to amino
acid 287 [22,35] and AcV5 epitope from amino acid 431 to amino acid
439 [22,36]. Insertion of the ELDKWA peptide at different positions
within the gp64 is indicated by numbers corresponding to the position
of amino acids in the gp64 envelope protein. Modification at positions
marked with asterisks did not succeed in production of progeny virus.
Fig. 2. Amino acids of gp64 flanking the inserted peptide ELDKWA.
Numbers correspond to the amino acid position in the gp64 envelope
protein (Entrez-Protein number NP_054158) [32]. The peptide was
inserted into the native envelope protein without the removal of viral
amino acids.
Ó FEBS 2002 Modification of the baculovirus envelope (Eur. J. Biochem. 269) 4459
digested with SacII and ApaI and inserted into p64flank
treated with SacII and ApaI replacing the corresponding
wild-type fragment in p64flank.
The insertions into the gp64 sequence were confirmed by
screening of bacterial colonies by PCR and subsequent
analysis of the fragments by 1.5% agarose gel electrophor-
esis. Primers used for amplification were 64-727-back and
64-939-for (for pELD271, pELD274, pELD275, pELD276,
pELD277, pELD279, pELD280, pELD283, pELD290), 64-
53-back and 64-206-for (for pELD31, pELD43, pELD59),
64-422-back and 64-568-for (pELD148, pELD180), 64-639-
back and 64-799-for (for pELD234) (Table 1, sectionD). All
PCR fragments were compared to the corresponding wild-
type fragment derived by amplifications using the above

primer combinations and p64flank as template. In addition
we sequenced 600-bp fragments of mutant p64flank, from
Table 1. Primers used for construction of gp64 mutants. (A) Primers for mutagenesis at amino acids position 31, 43, 59, 148, 180 and 234. (B) Primers
used for plasmids pELD271, pELD274, pELD275, pELD276 and pELD277. (C) Primers for plasmids pELD279, pELD280, pELD281, pELD282,
pELD 283 and pELD290. (D) Primers used for screening and sequencing.
A
64-939-for 5¢-GTTTTCGTACATCAGCTCCTC
64-(-639)-NotI-back 5¢-CGGGTTGGCGGCCGCATCGTTGCTATGAACG
64-31-ELD-SacI-back 5¢-GATGACGAGCTCGACAAATGGGCGCCGTACAAGATTAAAAACTTGGAC
64-31-ELD-SacI-for 5¢-GATGACGAGCTCACCCGTCTTCATTTGCGCGTTGC
64-43-ELD-SacI-back 5-GATGACGAGCTCGACAAATGGGCGAAGGAAACGCTGCAAAAGGAC
64-43-ELD-SacI-for 5-GATGACGAGCTCGGGCGGGGTAATGTCCAAG
64-59-ELD-SacI-back 5-GATGACGAGCTCGACAAATGGGCGTACAACGAAAACGTGATTATCGG
64-59-ELD-SacI-for 5-GATGACGAGCTCGTCCGTCTCCACGATGGTG
64-148-ELD-SacI-back 5-GATGACGAGCTCGACAAATGGGCGAATAACAATCACTTTGCGCACC
64-148-ELD-SacI-for 5-GATGACGAGCTCCTGCCGCTTCACCAACTCTTTG
64-180-ELD-SacI-back 5-GATGACGAGCTCGACAAATGGGCGACGGACGAGTGCCAGGTATAC
64-180-ELD-SacI-for 5-GATGACGAGCTCGTCGTCCTGGCACTCGAGC
64-234-ELD-SacI-back 5-GATGACGAGCTCGACAAATGGGCGAAAAATAACCCCGAGTCGGTG
64-234-ELD-SacI-for 5-GATGACGAGCTCGTCATCTTTAATGAGCAGACACG
B
64-277-ELD-NotI-for 5¢-GATGACGATTGCGGCCGCTTCGCCCATTTGTCGAGCTCCTTGACTCGGTGCTCGACTTTG
64-276-ELD-NotI-for 5¢-GATGACGATTGCGGCCGCTTCTTCGCCCATTGTCGAGCTCGACTCGGTGCTCGACTTTGCG
64-275-ELD-NotI-for 5¢-GATGACGATTGCGGCCGCTTCTTGACCGCCCATTTGTCGAGCTCTCGGTGCTC
GACTTTGCGTTTAATG
64-274-ELD-NotI-for 5¢-GATGACGATTGCGGCCGCTTCTTGACTCGCGCCCATTTGTCGAGCTCGTGCTC
GACTTTGCGTTTAATGC
64-271-ELD-NotI-for 5¢-GATGACGATTGCGGCCGCTTCTTGACTCGGTGCTCGACCGCCCATTTGTC
GAGCTCTTTGCGTTTAATGCATCTGTTAAAC
C

64-394-SacII-back 5¢-AACGAGGGCCGCGGCCAGTG
64-1536-BamHI-for 5¢-GCGGGATCCTTATTAATATTGTCTATTACGGTTTCTAATC
64-279-ELD-SacI-back 5¢-GATGACGAGCTCGACAAATGGGCGCCGCCCACTTGGCGCCAC
64-279-ELD-SacI-for 5¢-GATGACGAGCTCCCGCTTCTTGACTCGGTGC
64-280-ELD-SacI-back 5¢-GATGACGAGCTCGACAAATGGGCGCCCACTTGGCGCCACAACG
64-280-ELD-SacI-for 5¢-GATGACGAGCTCCGGCCGCTTCTTGACTCGG
64-281-ELD-SacI-back 5¢-GATGACGAGCTCGACAAATGGGCGACTTGGCGCCACAACGTTAG
64-281-ELD-SacI-for 5¢-GATGACGAGCTCGGGCGGCCGCTTCTTGAC
64-282-ELD-SacI-back 5¢-GATGACGAGCTCGACAAATGGGCGTGGCGCCACAACGTTAGAGC
64-282-ELD-SacI-for 5¢ GATGACGAGCTCAGTGGGCGGCCGCTTCTTG
64-283-ELD-SacI-back 5¢-GATGACGAGCTCGACAAATGGGCGCGCCACAACGTTAGAGCCAAG
64-283-ELD-SacI-for 5¢-GATGACGAGCTCCCAAGTGGGCGGCCGCTTC
64-290-ELD-SacI-back 5¢-GATGACGAGCTCGACAAATGGGCGTACACAGAGGGAGACACTGC
64–290-ELD-SacI-for 5¢-GATGACGAGCTCCTTGGCTCTAACGTTGTGGC
D
64-206-for 5¢-TTGTAGCCGATAATCACGTTTTCG
64-422-back 5¢-GCAAAGAGTTGGTGAAGCG
64-568-for 5¢-CCAAAATGTATACCTGGCACTC
64-639-back 5¢-CAAACAAAAGTCTACGTTCACC
64-799-for 5¢-ATCTGTTAAACTTGCAGTTCCAC
64-53-back 5¢-CCTTTGCGGCGGAGCACTG
64-939-for 5¢-GTTTTCGTACATCAGCTCCTC
64-727-back 5¢-CGCGAACACTGTTTGATTGAC
4460 A. Spenger et al. (Eur. J. Biochem. 269) Ó FEBS 2002
base pair 10 to 610 (for pELD31, pELD43, pELD59,
pELD148, p180ELD) or from base pair 390 to 990 (for
pELD234, pELD271, pELD274, pELD275, pELD276,
pELD277, pELD279, pELD280, pELD283, pELD290).
Cells and viruses
Cell line Sf9 (Spodoptera frugiperda, CRL 1711; ATCC) and

AcMNPV were propagated at 27 °CinIPL-41medium
(Sigma-Aldrich) supplemented with yeastolate and a lipid/
sterol cocktail containing optional 3% or 10% fetal calf
serum (FCS). Sf9
Op1D
stable transfected cells [33] were
cultivated in TNM-FH complete medium (Sigma-Aldrich)
containing 10% FCS and were used for propagation of
gp64 null virus (vAc64
–
) [19]. vAc64
–
and the cell line Sf
Op1D
were both established in the laboratory of G. Blissard
(Molecular Biology of Insect Viruses at the Boyce Thomp-
son Institute, Cornell University, Ithaca, NY, USA) and
kindly given to us.
Viruses were isolated by plaque purification and amplified
using standard procedures [1]. Budded viruses were prepared
by ultracentrifugation of supernatants [harvested 5 days
post-infection (d.p.i.)] over a 30% sucrose cushion. Pellets
were resuspended in phosphate buffered saline (NaCl/Pi)
(8 gÆL
)1
NaCl, 0.2 gÆL
)1
KCl, 1.44 gÆL
)1
Na

2
HPO
4
,
0.24 gÆL
)1
KH
2
PO
4
,pH7.4).
Generation of recombinant viruses
Cloning procedures yielded a set of transfer plasmids that
encoded mutant forms of the AcMNPV gp64 coding
regions containing the sequence for the ELDKWA peptide
at different positions. To generate recombinant viruses, Sf9
cells were plated in 25 mm
2
T-flasks (2 · 10
6
cells per flask)
and cotransfected with 100 ng Ac64
–
DNA and 500 ng
transfer plasmid by liposome-mediated transfection [34]
using the CellFECTIN
TM
transfection reagent (Life Tech-
nologies). Ac64
–

DNA, the parental viral DNA, lacking the
entire gp64 reading frame (it is substituted by a lacZ
expression cassette) was extracted and prepared from
Sf
Op1D
-infected cells.
Recombinant viruses were purified from the transfec-
tion supernatant by plaque assay. After 5 days petridishes
were overlaid with agarose containing 5-bromo-4-chloro-
3-indolyl-b-
D
-galactoside (X-Gal), for identification of
viruses lacking the lacZ expression cassette. White
plaques were amplified, and to confirm the insertions
into the gp64 envelope protein, viral DNA was
prepared from infected Sf9 cells. DNA fragments from
base 53 to base 939 were amplified by PCR and sequence
analyses were performed using primers 64-53-back and
64-939-for.
Western blotting of infected cells and budded virions
Samples were prepared for the Western blotting analysis in
the following manner. Sf9 cells were infected with a
multiplicity of infection (m.o.i.) of 10 and harvested 24 h
post-infection (h.p.i.), washed with NaCl/P
i
and lysed in
1 · sample buffer (100 m
M
Tris/HCl pH 6.8, 4% SDS,
0.2% Bromophenol blue, 20% glycerol, 200 m

M
b-merca-
ptoethanol) containing 2 · 10
5
cells per 10 l
L
. Budded
virus preparations were also diluted and mixed with sample
buffer resulting in 2 lgproteinper10l
L
(determined with
a Bio-Rad Protein assay). Samples were heated to 95 °C
for 10 min prior to SDS/PAGE (10% polyacrylamide).
Proteins were transferred to a PVDF-Membrane (Bio-
Rad) using a semidry transfer cell (Bio-Rad). Membranes
were blocked with 3% BSA in NaCl/P
i
including 0.1%
Tween-20 (TPBS) prior to gp64 and ELDKWA detection.
The native and the mutant gp64 proteins were probed with
B12D5 mAb [35] (1 : 1000) or with AcV5 mAb [36]
(1 : 1000). After several washing steps with TPBS, mem-
branes were incubated with goat anti-(mouse IgG) alkaline
phosphatase (AP) conjugate (Sigma) diluted 1 : 1000.
Reactive bands were detected by the addition of
5-bromo-4-chloro-3-indolyl phosphate (BCIP) and Nitro
blue tetrazolium (NBT) as substrate. The inserted epitope
ELDKWA was detected by human mAb 2F5 (1 lgÆmL
)1
)

and goat anti-(human IgG) AP conjugate (Sigma; 1 : 1000)
followed by detection with BCIP and NBT. Molecular
masses were estimated by comparing the reactive bands
with the bands from a prestained high range molecular
mass marker (Bio-Rad).
FACS analysis of infected cells
For FACS analysis 10
6
cells were infected in 6-well plates at
an m.o.i. 10 and harvested 24 and 48 h.p.i. After washing
with NaCl/P
i
cells were probed with specific antibodies
B12D5 (1 : 100) and 2F5 (10 lgÆmL
)1
) diluted in NaCl/P
i
containing 10% FCS for 1 h at room temperature. Cells
were washed with 1 mL NaCl/P
i
and after centrifugation
cells were resuspended in goat anti-(mouse IgG) fluorescein
isothiocyanate (FITC) conjugate (Sigma) (for B12D5 pre-
treated samples) or goat anti-(human IgG) FITC conjugate
(Sigma) (for 2F5-treated samples) diluted 1 : 50 in NaCl/P
i
containing 2% FCS. After 1 h of incubation with FITC
conjugates cells were washed again and resuspended in
300 l
L

NaCl/P
i
containing propidium iodide (1 lgÆmL
)1
)
for staining of dead cells. Labelled cells were analysed on a
FACS Calibur (Becton Dickinson). Data were analysed
with
CELLQUEST
software.
ELISA of budded virions
96-well-plates MaxiSorp
TM
(Nunc) were pre-coated with
100 l
L
human mAb 2F5 (5 lgÆmL
)1
) in coating buffer
(8.4 gÆL
)1
NaHCO
3
,4gÆL
)1
Na
2
CO
3
, pH 9.6) overnight at

4 °C. The plates were washed with TPBS and preparations
of budded viruses harvested at both 3 and 5 d.p.i. were
added and serially diluted 1 : 2–1 : 128 starting with
samples containing 2 lgÆmL
)1
protein in dilution buffer
(TPBS including 1% BSA). After incubation for 1 h at
room temperature, the plates were washed with TPBS and
100 l
L
B12D5 mAb (1 : 1000 in dilution buffer) per well
was added. After a further 1 h of incubation at room
temperature, the plates were washed and goat anti-(mouse
IgG) peroxidase (PO) conjugate (Sigma) was applied as
second antibody. Plates were incubated for a further 1 h
and after washing 100 l
L
of substrate (1 gÆL
)1
1.2-o-
phenylendiamindihydrochlorid in citrate buffer pH 5.0
containing 0.03% H
2
O
2
)wasaddedtoeachwell.The
reaction was stopped by the addition of 1.25
M
H
2

SO
4
and
the product was measured at 492 nm in a multichannel
photometer (EAR 400 AT, SLT).
Ó FEBS 2002 Modification of the baculovirus envelope (Eur. J. Biochem. 269) 4461
RESULTS
Construction of ELDKWA mutant viruses
The peptide epitope ELDKWA [27] derived from the HIV-1
glycoprotein gp41 specifically binds to the human mAb 2F5
[28,29]. This ligand binding interaction served as a model to
identify and compare several positions within the baculo-
virus major envelope protein for surface accessibility (Figs 1
and 2). Recombinant viruses were generated by cotransfec-
tion of Sf9 cells with transfer plasmids containing the
modified gp64 coding sequence and Ac64
–
DNA, a
baculovirus mutant where gp64 had been deleted by
insertion of a b-galactosidase expression cassette [19].
Thereby, only peptide insertions that maintained the
functionality of gp64 and thus, had restored the deletion,
produced virus progeny. Amplification of ELDKWA
presenting viruses was successful in most cases. The four
out of 17 positions that did not tolerate insertion of the
short peptide were amino acids 31, 43, 59 and 148. The fact
that no infectious virus could be generated in these four
cases was tested by repeated cotransfection of viral Ac64
–
DNA together with the corresponding transfer plasmid into

Sf9 cells. In addition, subsequent amplification of transfec-
tion supernatant did not lead to the production of virus
progeny either. Visual examinations of Sf9 cells following
transfection and amplification over a period of more than
14 days did not show any signs of virus growth. Successful
virus propagation could be achieved for insertions at
position 180, 234, 271, 274, 275, 276, 277, 279, 280, 281,
282, 283 and 290. These mutant viruses were amplified and
characterized further.
Virus growth
After transfections, plaque assays were performed to isolate
single virus clones. Mutants which had substituted the
b-galactosidase expression cassette were identified by over-
laying plates from plaque assays using X-Gal-containing
agarose. Recombinants with a white phenotype were used
for further amplification. Sequence analysis of PCR prod-
ucts from these mutant viruses confirmed the correct
insertion of the ELDKWA peptide into the gp64 gene. To
observe the growth of viral mutants on Sf9 cells, viruses
were amplified in two successive steps and subjected to
plaque assay for determining plaque forming units per mL
(p.f.u.ÆmL
)1
). Each viral stock was titrated twice and
medians of these two analyses are shown in Table 2. Titres
of the recombinants ranged from 5 · 10
6
to 1.7 · 10
8
p.f.u.ÆmL

)1
. The lowest number of p.f.u. in viral stocks
contained virus AcELD180; its titre was  30 times lower
than wild-type virus titre. Most viruses reached titres of
between 2 · 10
7
and 8 · 10
7
p.f.u.ÆmL
)1
. Insertions at
positions 234 and 275 had no effect on viral growth,
their stocks showed titres like that of wild-type AcMNPV
(1–2 · 10
8
p.f.u.ÆmL
)1
). In some cases we observed smaller
plaque phenotypes, indicating a decreased viability [26].
Stability of AcELD283
Because the ELDKWA peptide is inserted into the native
envelope protein gp64, all viruses produced contain the
insertion in their envelope protein. In order to investigate
the generation of progeny virions over multiple passages, we
sequentially passed one representative mutant, AcELD283,
through Sf9 cells by infection of 10
7
cells with 500 lLofthe
previous virus stock and thereby produced five successive
virus stocks. These stocks were examined for virus titre and

surface expression of the ELDKWA peptide on infected
cells using FACS (Fig. 3). For FACS, triplicate infections of
10
6
cells were performed, using 500 lL of each virus stock,
which corresponds to an m.o.i. ranging from 10
(AcELD283 stock 5) to 20 (AcELD283 stock 2). Titres
remained similar over five passages (Table 3); in addition,
as concluded from FACS histograms the amount of
ELDKWA on the surface of infected cells only varied
slightly approving the stable insertion of the ELDKWA
peptide into the native envelope protein gp64 (Fig. 3A).
Staining with B12D5 mouse mAb showed no binding
demonstrating the disruption of the epitope of this mouse
mAb and the absence of any wild-type gp64 (Fig. 3B).
Expression of recombinant gp64 in infected insect cells
The expression levels of recombinant gp64 were first
compared using Western blot analysis. Sf9 cells were infected
at an m.o.i. of 10, harvested 24 h post-infection, and
subjected to SDS/PAGE. After blotting, the membranes
were probed either with the mouse mAb B12D5 specific for
gp64 (Fig. 4A), or with the human mAb 2F5, which
recognizes the ELDKWA epitope (Fig. 4B). It was shown
that gp64 expression levels of recombinants were comparable
to gp64 levels expressed by wild-type AcMNPV (Fig. 4A).
Constructs with insertions at positions 279–283 showed no or
only weak reactive bands indicating that modification at
these positions leads to disruption of the specific epitope.
Monsma and coworkers [22] have mapped the mouse mAb
B12D5 epitope to 11 amino acids spanning positions

277–287 of the AcMNPV gp64 sequence. Our experiment
revealed that amino acids 277 and 278 are not required for
antibody binding. By using a Western blot stained with 2F5
we could demonstrate that all constructs that yielded
infectious progeny showed a reactive band at 64 kDa
confirming the successful insertion of the ELDKWA peptide
into the native envelope protein (Fig. 4B).
Table 2. Virus stock titres of recombinant viral mutants and wild type
AcMNPV determined by plaque assay on Sf9 cells.
Titer (p.f.u.ÆmL
)1
)
AcELD180 6 · 10
6
AcELD234 1.7 · 10
8
AcELD271 3.8 · 10
7
AcELD274 1.6 · 10
7
AcELD275 1.1 · 10
8
AcELD276 1.7 · 10
7
AcELD277 1.0 · 10
7
AcELD278 2 · 10
7
AcELD279 2.2 · 10
7

AcELD280 6.2 · 10
7
AcELD281 6 · 10
7
AcELD282 3.2 · 10
7
AcELD283 8 · 10
7
AcELD290 4 · 10
7
AcMNPV 1 · 10
8
4462 A. Spenger et al. (Eur. J. Biochem. 269) Ó FEBS 2002
Presentation of the ELDKWA on surface of infected cells
The presentation of the inserted epitope ELDKWA on the
surface of infected cells was determined by FACS analysis
24 and 48 h.p.i. For this purpose Sf9 cells were infected
three times, independently with an m.o.i. of 10 using 6-well
plates and 10
6
cells per well. Fig. 5 shows ELDKWA
detection using the human mAb 2F5 and goat anti-human
IgG FITC conjugate. Nearly all constructs gave a higher
fluorescence signal than the construct containing the
insertion at position 278, previously described by Ernst
et al. [23], indicating a better presentation or exposition of
the inserted peptides. The relative fluorescence intensity
determined by FACS was three to six times higher in the
constructs AcELD180, AcELD271, AcELD274,
AcELD283 and AcELD290. We also analysed cells

48 h.p.i. for ELDKWA expression (data not shown).
Results were similar to analyses 24 h.p.i., confirming that
viruses AcELD180, AcELD271, AcELD274, AcELD283
and AcELD290 were the best candidates for surface
presentation of the ELDKWA peptide.
gp64 levels were measured by FACS using the mouse
mAb B12D5. Ac64
–
, the gp64 knockout mutant served as
negative control. These results showed that most viruses
expressed comparable amounts of gp64. Lower binding
capacity was detected for constructs AcELD279 and
AcELD280. Viruses AcELD281, AcELD282 and
Fig. 3. Stability of AcELD283. Virus
AcELD283 was sequentially passed through
Sf9 cells and thereby five successive virus
stocks were produced (AcELD283/1–
AcELD283/5). These stocks were investigated
for ELDKWA expression and virus titre.
ELDKWA expression of infected cells was
investigated with FACS. (A) Staining with
human mAb 2F5, specific for the ELDKWA
and anti-human FITC conjugate (histogram
1–4). (B) staining with mouse mAb B12D5,
which is specific for the viral glycoprotein gp64
and anti-mouse FITC conjugate (histogram
5–8). AcELD283 virus stocks are depicted in
blue, the AcMNPV control virus is shown in
black. Selected histograms are representative
of three independent experiments.

Table 3. Virus stock titres of recombinant viral mutants and wild type
AcMNPV determined by plaque assay. Results shown are the means of
two analyses. Depending on the virus titre m.o.i. ranged from 10
(AcELD283 stock 5) to 20 (AcELD283 stock 2).
Titer (p.f.u.ÆmL
)1
)
AcELD283/1 4.5 · 10
7
AcELD283/2 3.8 · 10
7
AcELD283/3 5.5 · 10
7
AcELD283/4 4.8 · 10
7
AcELD283/5 2.0 · 10
7
Ó FEBS 2002 Modification of the baculovirus envelope (Eur. J. Biochem. 269) 4463
AcELLD283 showed no binding to the mouse mAb B12D5
confirming the results obtained from Western blot analysis.
Expression on viral particles
Recombinant viral constructs which gave the highest signals
of ELDKWA on the surface of virally infected Sf9 cells
were selected for further investigations. These constructs
were AcELD180, AcELD271, AcELD274, AcELD281,
AcELD283 and AcELD290.
The packaging and uptake of modified gp64 into the viral
particle was investigated by immunoblot analysis of budded
virus preparations. Blots were probed with the gp64-specific
antibodies mouse mAb B12D5 and mouse mAb AcV5, and

the ELDKWA specific human mAb 2F5 (Fig. 6A–C).
AcMNPV served as positive control for gp64 detection.
Corresponding to the results obtained from infected cells
AcELD281 and AcELD283 showed no reactivity with
mouse mAb B12D5, but gp64 could be detected by using
mouse mAb AcV5 which binds to denatured gp64 recog-
nizing amino acids 431–439 [22] (Fig. 6A and B).
The binding capacity of ELDKWA was highest in viral
constructs AcELD274, AcELD283 and AcELD290
(Fig. 6C). For further analysis, virus preparations were
subjected to ELISA plates precoated with human mAb 2F5.
Detection of bound virus was done using mouse mAb
B12D5 and anti-mouse IgG PO conjugate. As mouse mAb
B12D5 no longer recognized AcELD281 and AcELD283,
these viruses could not be analysed. Highest binding
capacity was detected for AcELD274 (Fig. 7).
DISCUSSION
Modification of virus envelope proteins often results in the
loss of infection as envelope proteins are required for spread
of infection. In the baculovirus AcMNPV, the envelope
glycoprotein gp64 is responsible for viral entry into the host
cell, has receptor binding activity and is required for efficient
budding of viral particles. However, targeted surface
modification of infectious particles is a desired goal in
molecular biology, as this may result in novel presentation
and delivery tools. Baculovirus surface display holds a great
potential for drug screening, investigations of protein–
protein interactions, antigen presentation and altering cell
tropism. To exploit fully the possibilities of the baculovirus
surface display system, it becomes necessary to understand

and investigate the functional and structural domains of the
baculovirus major envelope protein. Insertional mutagene-
sis by Monsma and coworkers [22] have previously revealed
an oligomerization domain, which is located within an
alpha-helical region, and a fusion domain of gp64. Further,
a transmembrane domain has been mapped to the C
terminus of the glycoprotein [14]. Most attempts to display
foreign proteins on the surface of baculovirus virions and
infected insect cells were done by expressing the target
protein as a N-terminal fusion to a second copy of gp64 [37–
39]. Boublik et al. [37] suggested that incorporation of the
target protein was a result of co-oligomerization of the gp64
fusion proteins with wild-type gp64. Additionally, they
Fig. 4. Western blot analysis of infected insect cells. (A) Immuno-
staining of infected cells with mAb B12D5, which is specific for the
envelope protein gp64: 2 · 10
5
infected cells were used per lane. Ac64
–
the gp64 deletion mutant (lane 2) showed no reactivity with B12D5.
Additionally, constructs AcELD279 to AcELD283 (lane 11, 12, 13, 15,
16) did not react with B12D5, indicating B12D5 epitope destruction by
insertion of ELDKWA. Other recombinants (lane 3, 4, 5, 6, 7, 8, 9, 10,
17) and wild-type AcMNPV (lane 1, 14) showed binding to B12D5. (B)
Detection of ELDKWA epitope in the gp64 envelope protein with
human mAb 2F5: Reactive bands at 64 kDa confirm the expression of
ELDKWA presenting envelope protein. AcMNPV and Ac64
–
did not
react with 2F5 antibody.

Fig. 5. FACS analysis of ELDKWA epitope in infected insect cells. A
total of 10
6
cells were infected with mutant viruses at an m.o.i. 10 and
harvested 24 h.p.i. Three independent infections were made for each
virus and stained separately with human mAb 2F5, which is specific for
the ELDKWA epitope, and anti-human FITC conjugate. A total of
10 000 events were measured for FACS analysis. Dead cells stained
with propidium iodide were gated out. Uninfected Sf9 cells and cells
infected with AcMNPV served as negative control for ELDKWA
detection. On the Y-axis the mean intensity of fluorescence for infected
Sf9 cells, expressed as the median of fluorescence of three independent
infections, is shown. Error bars correspond to the SD of the medians of
three independent infections.
4464 A. Spenger et al. (Eur. J. Biochem. 269) Ó FEBS 2002
could not rule out the possibility that some fusions with
gp64 may affect virus growth. These data suggest that levels
displayed on the surface of viral particles depend on the
amino acid sequence, the length of the insertion and
secondary structure. If gp64 fusion proteins are not able to
build a secondary structure that allows oligomerization with
wild-type gp64, the viral particle presents only low levels or
even fails to display the target protein on the viral surface;
however, growth of the resulting viruses is not affected. To
circumvent these problems of low level presentation on viral
particles, we established a method for display of target
peptides, that allows incorporation into the viral envelope
only when modification does not inhibit functional homo-
oligomerization of the gp64 envelope fusion protein [23], the
main basis for viral infectivity. The strategy was to modify

the native envelope protein itself so that only modifications
which do not affect the essential functions of the glycopro-
tein would result in production of viral particles. We could
demonstrate that direct insertion into the native gp64 leads
to high avidity display of short peptides on the surface of
virions and infected cells [23]. To gain further insight into
the structural properties of gp64 and to increase the
accessibility of peptide insertions to their ligands, we
inserted the peptide epitope ELDKWA, specific for the
human mAb 2F5, at 17 different positions within the
baculovirus major envelope protein. Of these, 13 positions
yielded infectious virus progeny. Four insertions apparently
were lethal, indicating that these positions (31, 43, 59 and
148) are located within an essential domain, that is either
directly responsible for some specific interaction or is
structurally important for the protein’s function.
Presentation of the ELDKWA peptide was shown to be
best in constructs modified at positions 274 and 283. In
comparison, AcELD283 had better growth characteristics,
as virus titres and plaque phenotypes were comparable to
thoseofwild-typeAcMNPV.ThetitreofAcELD274was
 10 times lower and plaques were considerably smaller. In
conclusion, efficient surface display of desired epitopes on
the surface of baculovirus particles can be achieved,
however, for the price of somewhat slower growth and
lower virus titres. N-terminal fusions into a second copy of
gp64 have frequently been proven to be useful for efficient
display of various proteins [37–39] on infected insect cells,
however, N-terminal insertion into the singular wild-type
copy of gp64 must not necessarily be expected to result in

the production of infectious virus. In the course of our
research we generated viruses containing a streptag peptide
at the N terminus of the native envelope protein, which grew
up to 2 · 10
7
p.f.u.ÆmL
)1
, but ligand display on the virus
surface was weaker than constructs containing the streptag
Fig. 6. Western blot analysis of budded virions. (A) Immunoblotting of
virus samples with gp64-specific mAb B12D5. Two lgprotein
(determined with Bio-Rad Protein assay) were loaded per lane. For
AcELD281 and AcELD283 (lane 6 and 7) no reactivity with B12D5
could be detected, confirming the disruption of the B12D5 epitope. (B)
All recombinant viral mutants showed reactive bands at 64 kDa
probed with mAb AcV5, which recognizes amino acids 431–439 within
the gp64 envelope protein. (C) Detection of ELDKWA epitope in viral
samples was carried out with human mAb 2F5. Lane 1 represents
AcMNPV as control. Reactive bands of viral clones at 64 kDa are
marked by arrows.
Fig. 7. ELISA of mutant viruses. Purified ELDKWA-containing viri-
ons (AcELD180, AcELD 271, AcELD274, AcELD278, AcELD281,
AcELD283, AcELD290) and AcMNPV were applied to 2F5 pre-
coated plates and bound virions were detected by the anti-gp64 specific
mAb B12D5 and an anti-mouse peroxidase conjugate. Two virus
preparations, harvested 3 and 5 d.p.i., were analysed independently.
The mean optical density of these two analyses is plotted on the Y-axis.
Error bars correspond to the SD. As the B12D5 has no reactivity with
AcELD281 and AcELD283 ELDKWA surface levels of these con-
structs could not be determined in this assay.

Ó FEBS 2002 Modification of the baculovirus envelope (Eur. J. Biochem. 269) 4465
at position 278 (data not shown). Hence, in this study
only insertions within the gp64 coding region and not a
N-terminal fusion construct were taken into account and
were investigated.
The principle feasibility of linear peptide insertion could
be successfully demonstrated in this approach. A general
validity of this concept can be concluded from ongoing
experiments where more complex structures were inserted
into selected sites 274 and 283 which had been identified
during the course of this project. Further examples include
the insertion of a 17-amino acid epitope of mAb 3D6 [40],
containing a loop structure between two cysteine residues, at
position 274, and a 23-amino acid portion of the envelope
protein of the Foot and mouth disease virus into site 283 of
native gp64 (unpublished results). Both insertions were
compatible with the function of the gp64 envelope protein
as we concluded from viral titres and kinetics of recombin-
ant peptide expression on the surface of infected Sf9 cells.
Having identified sites within the baculovirus major
envelope protein gp64, that allow insertions of target
peptides and provide efficient surface presentation without
loosing infectivity and/or normal propagation, these candi-
dates may serve for various useful applications in molecular
biology. Surface presentation of relevant epitopes for in vivo
antigen presentation requires proper presentation and high
accessibility. Peptides that bind certain mammalian cell
receptors or mediate cell entry through the membrane may
serve to improve baculoviral vectors for mammalian cell
transduction. Evaluation of other peptides designed for

specific functions, e.g. virus targeting to selected tissues,
extension of host range or enhancement of transduction
efficiency of nonpermissive cells are envisaged as future aims
and therefore would go beyond the scope of this present
study. Also larger proteins could be presented on the
baculovirus surface, by fusion to protein which binds to the
epitope present in the major envelope protein. Preliminary
experiments have shown that this strategy leads to a drastic
increase in avidity of proteins as compared to previously
described methods (unpublished results).
ACKNOWLEDGEMENTS
The authors thank G. Blissard for providing the cell line Sf
Op1D
and
gp64null virus vAc64
–
. We thank R. Voglauer and N. Borth for FACS
analysis. This project was funded by the FWF (Fonds zur Fo
¨
rderung
der wissenschaftlichen Forschung) project Nr P14538 MOB.
REFERENCES
1. O’Reilly, D.R., Miller, L.K. & Luckow, V.A. (1992) Baculovirus
Expression Vectors. A Laboratory Manual. W.H. Freeman,
New York.
2. Jones, I. & Morikawa, Y. (1996) Baculovirus vectors for expres-
sion in insect cells. Curr. Opin. Biotechnol. 7, 512–516.
3. Grabherr, R., Ernst, W., Oker-Blom, C. & Jones, I. (2001)
Developments in the use of baculoviruses for the surface display of
complex eukaryotic proteins. Trends Biotechnol. 19, 231–236.

4. Grabherr, R. & Ernst, W. (2001) The baculovirus expression
system as a tool for generating diversity by viral surface display.
Comb Chem High Throughput Screen 4, 185–192.
5. Hofmann, C., Sandig, V., Jennings, G., Rudolph, M., Schlag, P. &
Strauss, M. (1995) Efficient gene transfer into human hepatocytes
by baculovirus vectors. Proc.NatlAcad.Sci.USA92, 10099–
10103.
6. Boyce, F.M. & Bucher, N.L. (1996) Baculovirus-mediated gene
transfer into mammalian cells. Proc. Natl. Acad. Sci. USA 93,
2348–2352.
7. Condreay, J.P., Witherspoon, S.M., Clay, W.C. & Kost, T.A.
(1999) Transient and stable gene expression in mammalian cells
transduced with a recombinant baculovirus vector. Proc. Natl
Acad. Sci. USA 96, 127–132.
8. Kost, T.A. & Condreay, J.P. (1999) Recombinant baculoviruses as
expression vectors for insect and mammalian cells. Curr. Opin.
Biotechnol. 10, 428–433. Review.
9. Volkman, L.E. (1986) The 64 k envelope protein of budded
Autographa californica nuclear polyhedrosis virus. Curr. Topics
Microbiol. Immunol. 131, 103–118.
10. Volkman, L.E., Summers, M.D. & Hsieh, C.H. (1976) Occluded
and nonoccluded nuclear polyhedrosis virus grown in
Trichoplusia ni: comparative neutralization, comparative
infectivity, and in vitro growth studies. J. Virol. 63, 1393–1399.
11. Volkman, L.E. & Summers, M.D. (1977) Autographa californica
nuclear polyhedrosis virus: comparative infectivity of the
occluded, alkali-liberated, and nonoccluded forms. J. Invert.
Pathol. 30, 102–103.
12. Keddie, B.A. & Volkman, L.E. (1985) Infectivity difference
between the two phenotypes of Autographa californica nuclear

polyhedrosis virus. Importance of the 64K envelope glycoprotein.
J.Gen.Virol.66, 1195–1200.
13. Whitford, M., Stewart, S., Kuzio, J. & Faulkner, P. (1989) Iden-
tification and sequence analysis of a gene encoding gp67, an
abundant envelope glycoprotein of the Autographa californica
nuclear polyhedrosis virus. J. Virol. 63, 1393–1399.
14. Blissard, G.W. & Rohrmann, G.F. (1989) Location, sequence,
transcriptional mapping and temporal expression of the gp64
envelope glycoprotein gene of the Orgyia pseudotsugata multi-
capsid nuclear polyhedrosis virus. Virology 170, 537–555.
15. Jarvis, D.L. & Garcia, A. Jr (1994) Biosynthesis and processing of
the Autographa californica nuclear polyhedrosis virus gp64 pro-
tein. Virology 205, 300–313.
16. Oomens, A.G., Monsma, S.A. & Blissard, G.W. (1995) The
baculovirus GP64 envelope fusion protein: synthesis, oligomer-
ization, and processing. Virology 209, 592–603.
17. Volkman, L.E., Goldsmith, P.A., Hess, R.T. & Faulkner, P.
(1984) Neutralization of budded Autrographa californica NPV by
a monoclonal antibody: identification of the target antigen.
Virology 133, 354–362.
18. Blissard, G.W. & Wenz, J.R. (1992) Baculovirus gp64 envelope
glycoprotein is sufficient to mediate pH-dependent membrane
fusion. J. Virol. 66, 6829–6835.
19. Monsma, S.A., Oomens, A.G.P. & Blissard, G.W. (1996) The
gp64 envelope fusion protein is an essential baculovirus protein
required for cell-to-cell transmission of infection. J. Virol. 70,
4607–4616.
20. Hefferon, K.L., Oomens, A.G., Monsma, S.A., Finnerty, C.M. &
Blissard, G.W. (1999) Host cell receptor binding by baculovirus
GP64 and kinetics of virion entry. Virology 258, 455–468.

21. Oomens, A.G. & Blissard, G.W. (1999) Requirement for gp64
to drive efficient budding of Autographa californica multicapsid
nucleopolyhedrosisvirus. Virology 254, 297–314.
22. Monsma, S.A. & Blissard, G.W. (1995) Identification of a
membrane fusion domain and a oligomerization domain in
the baculovirus gp64 envelope fusion protein. J. Virol. 69, 2583–
2595.
23. Ernst, W.J., Spenger, A., Toellner, L., Katinger, H. & Grabherr,
R.M. (2000) Expanding baculovirus surface display. Modification
of the native coat protein gp64 of Autographa californica NPV.
Eur. J. Biochem. 267, 4033–4039.
24. Lindley, K.M., Su, J L., Hodges, P.K., Wisely, G.B., Bledsoe,
R.K.,Condreay,J.P.,Winegar,D.A.,Hutchins,J.T.&Kost,T.A.
(2000) Production of monoclonal antibodies using recombinant
4466 A. Spenger et al. (Eur. J. Biochem. 269) Ó FEBS 2002
baculovirus displaying gp64-fusion proteins. J. Immunol. Methods
234, 123–135.
25.Ojala,K.,Mottershead,D.G.,Suokko,A.&Oker-Blom,C.
(2001) Specific binding of baculoviruses displaying gp64 fusion
proteins to mammalian cells. Biochem. Biophys. Res. Commun.
284, 777–784.
26. Mangor, J.T., Monsma, S.A., Johnson, M.C. & Blissard, G.W.
(2001) A gp64-null baculovirus pseudotyped with vesicular sto-
matitis virus G protein. J. Virol. 75, 2544–2556.
27. Muster, T., Steindl, F., Purtscher, M., Trkola, A., Klima, A.,
Himmler, G., Ru
¨
ker, F. & Katinger, H. (1993) A conserved
neutralizing epitope on gp41 of human immunodeficiency virus
type 1. J. Virol. 67, 6642–6647.

28. Buchacher, A., Predl, R., Strutzenberger, K., Steinfellner, W.,
Trkola, A., Purtscher, M., Gruber, G., Tauer, C., Steindl, F.,
Jungbauer, A. & Katinger, H. (1994) Generation of human
monoclonal antibodies against HIV-1 proteins; electrofusion and
epstein-barr virus transformation for peripheral blood lymphocyte
immortalization. AIDS Res. Hum. Retroviruses 10, 359–369.
29. Purtscher, M., Trkola, A., Gruber, G., Buchacher, A., Predl, R.,
Steindl,F.,Tauer,C.,Berger,R.,Barrett,N.,Jungbauer,A.&
Katinger, H. (1994) A broadly neutralizing human monoclonal
antibody against gp41 of human immunodeficiency virus type 1.
AIDS Res. Hum. Retroviruses 10, 1651–1658.
30. Emini, E.A., Hughes, J.V., Perlow, D.S. & Boger, J. (1985)
Induction of hepatitis A virus-neutralizing antibody by a virus-
specific synthetic peptide. J. Virol. 55, 836–839.
31. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular
Cloning: A Laboratory Manual, Vol. 3, 2nd edn. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, New York.
32. Ayres, M.D., Howard, S.C., Kuzio, J., Lopez-Ferber, M. &
Possee, R.D. (1994) The complete DNA sequence of Autographa
californica nuclear polyhedrosis virus. Virology 202, 586–605.
33. Plonsky, I., Cho, M S., Oomens, A.G., Blissard, G. & Zimmer-
berg, J. (1999) An analysis of the role of the target membrane on
the gp64-induced fusion pore. Virology 253, 65–76.
34.Groebe,D.R.,Chung,A.E.&Ho,C.(1990)Cationic
lipid-mediated co-transfection of insect cells. Nucl. Acids Res. 18,
4033.
35. Keddie, B.A., Aponte, G., W. & Volkman, L.E. (1989) The
pathway of infection of Autographa californica nuclear poly-
hedrosis virus: importance of the 64K envelope glycoprotein.
J.Gen.Virol.66, 1195–1200.

36. Hohmann, A.W. & Faulkner, P. (1983) Monoclonal antibodies to
baculovirus structural proteins: determination of specificities by
western blot analysis. Virology 125, 432–444.
37. Boublik, Y., DiBonito, P. & Jones, I.M. (1995) Eukaryotic virus
display: engineering the major surface glycoprotein of the Auto-
grapha californica nuclear polyhedrosis virus (AcNPV) for the
presentation of foreign proteins on the virus surface. Bio/Tech-
nology 13, 179–184.
38. Grabherr, R.M., Ernst, W.J., Doblhoff-Dier, O., Sara, M. &
Katinger, H. (1997) Expression of foreign proteins on the surface
of Autographa californica nuclear polyhedrosis virus. Bio/Tech-
niques 22, 730–735.
39. Mottershead, D., van der Linden, I., von Bonsdorff, C H.,
Keina
¨
nen, K. & Oker-Blom, C. (1997) Baculoviral display of the
green fluorescent protein and rubella virus envelope proteins.
Biochem. Biophys. Res. Commun. 238, 717–722.
40. Stigler, R D., Ru
¨
ker,F.,Katinger,D.,Elliott,G.,Hohne,W.,
Henklein, P., Ho, J.X., Keeling, K., Carter, D.C., Nugel, E.,
Kramer, A., Porstmann, T. & Schneider-Mergener, J. (1995)
Interaction between a Fab fragment against gp41 of human
immunodeficiency virus 1 and its peptide epitope: characterization
using a peptide epitope library and molecular modeling. Protein
Eng. 8, 471–479.
Ó FEBS 2002 Modification of the baculovirus envelope (Eur. J. Biochem. 269) 4467