Báo cáo Y học: Engineering and use of 32P-labeled human recombinant interleukin-11 for receptor binding studies docx

Engineering and use of
32
P-labeled human recombinant interleukin-11
for receptor binding studies
Xiao-Ming Wang
1
, Jean-Marc Wilkin
1
, Olivier Boisteau
2
, Dimitri Harmegnies
1
, Chrystel Blanc
3
,
Paul Vandenbussche
1
,Fe
Â
lix A. Montero-Julian
3
, Yannick Jacques
2
and Jean Content
1
1
Institut Pasteur de Bruxelles, Belgium;
2
Groupe Recherche Cytokines/Re
Â
cepteurs, Unite

Â
, Institut de Biologie, Nantes, France;
3
Immunotech, A Beckman-Coulter Company, Marseille, France
Human interleukin-11 (hIL-11) is a pleiotropic cytokine
that is involved in numerous biological activities such as
hematopoiesis, osteoclastogenesis, neurogenesis and female
fertility. IL-11 is o bviously a key reagent to study the IL-11
receptors. However, conventional radio-iodination techni-
ques lead to a loss of IL-11 b ioactivity. H ere, we report the
construction and the production of a new recombinant
human IL-11 (FPDIL-11). I n this molecule, a speci®c
phosphorylation site ( RRASVA) h as been intr oduced at
the N -terminus of rhIL-11. It can be speci®cally phos-
phorylated b y bovine heart protein kinase a nd accordingly,
easily radiolabeled with
32
P. A high radiological s peci®c
activity (250 000 c.p.m.Áng
)1
of protein) was obtained with
the retention of full biological activity of the protein. The
binding of
32
P-labeled FPDIL-11 to B a/F3 cells stably
transfected with plasmids encoding human IL-11 receptors
a and b chains (IL-11Ra and gp130) was s peci®c and
saturable w ith a high anity as determined from Scatchard
plot analysis. Availability of this new ligand should prompt
further studies on IL-11R structure, expression and regu-

lation.
Keywords: interleukin-11; cytokines; phosphorylation;
radiolabeling; re ceptor b inding.
Interleukin-11 (IL-11) i s a pleiotropic cytokine that has been
shown to exhibit multiple effects o n hematopoietic and
nonhematopoietic systems, includin g the liver , gastrointest-
inal tract, lung, heart, central nervous system, bone, joint,
and immune system [1]. IL-11 has hematopoietic and
thrombocytopoietic activities: in vivo IL-11 administration
stimulates megakaryocyte maturation and increases p eriph-
eral plate let counts [2] as well as accelerating recovery f rom
chemotherapy-induced or bone-marrow t ransplantation-
induced thrombocytopenia [2±6]. Numerous experiments
on animal models and clinical trials in patients suffering
from acute and chronic i n¯ammatory d iseases, including
rheumatoid arthritis [7±9], in¯ammatory liver disease [10],
in¯ammatory bowel disease [11±13], mucositis [14], a nd
psoriasis [15], have revealed that IL-11 is a lso an anti-
in¯ammatory and mucosal protective agent. Another
important role of IL-11 played in female fertility h as be en
evidenced by the fact that female mice lacking IL-11
receptor are infertile due to a failure of trophoblast
implantation [16].
IL-11 belongs to the gp130 family of cytokines that
includes interleukin-6 (IL-6), viral I L-6 (vIL-6), ciliary
neurotropic factor (CNTF), leukemia inh ibitory factor
(LIF), oncostatin M (OSM), cardiotrophin-1 (CT-1), and
novel neurotr ophin-1/B cell-stimulating f actor-3 (NNT-1/
BSF-3) [17±20]. These cytokines use the c ommon r eceptor
subunit g p130 for signal transduction by which Janus

kinases (Jaks) and transcription factors of the STAT family
are activated [21]. IL-6 uses a homodimer of gp130
transducer, whereas CNTF, LIF, OSM, CT-1 and NNT-
1/BSF-3 assemble a heterodimer of gp130 and another
protein LIFR. OSM can also recruit a heterodimer of gp130
and OSMR [22]. Both LIF and OSM can directly induce
heterodimerization of gp130 and L IFR or OSMR, whereas
IL-11, IL-6, CNTF a nd CT-1 mu st ®rst bind to their
speci®c, nonsignaling receptor (named a chain) before
inducing d imerization of signal-transducing receptor sub-
units (named b chain). In contrast with IL-6, vIL-6 can
directly activate g p130 in the absence of IL-6R [23,24]. T he
stoichiometry of t he ligand±receptor complex is still unclear
for IL-11. Actually, two models have been described. One i s
a tetrameric complex model s uggested by Gro
È
tzinger et al .
[25] in which one molecule of IL-11 b inds to its s peci®c
a-receptor via site I of the cytokine and a t l ow con centration
of IL-11±IL-11R complexes, IL-11 recruits two molecules of
gp130 through i ts sites II and II I. At high IL-11/IL-11R
concentrations, it is proposed that the tetramer is able to
bind an additional IL-11±IL-11R c omplex, forming a
hexameric, but nonsignaling complex [26]. According to
in vitro studies based on immunoprecipitation using d ifferen-
tially tagged forms of ligand a nd soluble r eceptor compo-
nents, a hexameric complex has also been proposed in which
two molecule s o f IL-11, two molecules o f I L-11R, e ither o ne
molecule of gp130 and another still unidenti®ed gp130-type
component are involved [ 27], or two m olecules of gp130 as

Correspondence to J. Content, Institut Pasteur de Bruxelles, rue
Engeland 642, B-1180, Brussels, Belgium. Fax: + 32 2373 32 91,
Tel.: + 32 2373 34 16, E-mail: or X M. Wang,
Fax: + 3 2 2373 32 91, Tel.: + 32 2373 32 28,
E-mail:
Abbreviations: IL, interleukin; IL-11R, interleukin-11 receptor; vIL-6,
viral IL-6; CNTF, c iliary neurotropic factor; LIF, leukem ia inhibitory
factor; OSM, oncostatin M; CT-1, cardiotrophin-1;
NNT-1/BSF-3, novel neurotrophin-1/B cell-stimulating factor-3;
DMEM, Dulbecco's modi®ed Eagle's medium; Jaks, Janus kinase.
(Received 19 July 2001, revised 22 October 2001, accepted 22 October
2001)
Eur. J. Biochem. 269, 61±68 (2002) Ó FEBS 2002
recently proposed by Barton et al . [28]. Which one is the
active signalling receptor c omplex? This question will not be
answered until much more infor mation i s available on the
situation within intact cells.
The effects of IL-11 must be mediated by the IL-11Ra
and the latter provides ligand speci®city in a functional
multimeric signal transduction complex with gp130. Two
isoforms of the human IL-11R a-chain have been identi-
®ed and cloned [29]. They share identical extracellular
and transmembrane do mains but differ in their C-terminus.
One isoform has a cytoplasmic domain, whereas the second
lacks the entire cytoplasmic domain. Both these isoforms
[30] and the soluble I L-11Ra, lacking both the transmem-
brane and cytoplasmic domains [31], were shown to have
similar functional properties, suggesting the dispensability
of these two domains for s ignaling. Structurally, the
extracellular region of the IL-11Ra could be divided into

three domains: an I g-like domain (D1) and two ®bro nectin-
type II I-like ( FNIII) domains (D2 and D3). Recently, most
of the amino-acid residues in IL-11Ra involved in ligand
binding were identi®ed in D3 [32].
In order to provide a convenient IL-11 reagent for the
study of IL-11 cell surface receptors, we describe in this
paper t he construction and t he production of a new hIL-11
molecule FP DIL-11 and its use to study cell receptor binding
as well as other potential applications provided by this new
reagent.
MATERIALS AND METHODS
Bacterial strains, enzymes and chemicals
Escherichia coli DH5 a was f rom Life BioTechnologies.
BL21(DE3) and pET-22b(+) were from Novagen. The
catalytic s ubunit of cAMP-indepentent protein kinas e from
bovine heart muscle was obtained from Sigma. Human
E. co li re combinant IL-11 was from PeproTech Inc.
(London, UK). Mouse monoclonal anti-(human gp130) Ig
(B-R3) was f rom Diaclone Research (BesancË on, France).
MAB628 and polyclonal anti-(hIL-11) Ig (BAF218) were
from R&D S ystems. [c-
32
P]ATP, with a speci®c radio-
activity of % 3000 CiÁmmol
)1
, w as obtained from Amer-
sham; acrylamide a nd N,N¢-methylenebisacrylamide w ere
from Bio-Rad; SDS and monoclonal anti-Flag Ig (M2) were
from Sigma. RPMI-1640, Dulbecco's modi®e d Eagle's
medium (DMEM), glutamine, a nd fetal bovine serum were

from Gibco-BRL.
Construction of expression plasmids for recombinant
human IL-11
EcoRI and NotI s ites were ®rst introduced by P CR at two
ends of the hIL-11 gene using two primers G310
(5¢-ATCCGGAATTCCCTGGGCCACCACCTGGCCC
CCCT-3¢) and G311 (5¢-ATAGTTTAGCGGCCGCT
TACAGCCGAGTCTTCAGC-3¢) and pIL-11/1 as tem-
plate plasmid. To generate the Eco RI±NotICPDIL11
fragment, which contains an N-terminal Cys (C) and a
bovine heart kinase phosphorylation site ( P) as well as a
modi®ed IL-11 lacking the ®rst 10 amino acids (DIL11),
another PCR was performed using two oligonucleotides
YIL11TAG (5¢-ATCCGGAATTCGGTTGTGGTCGT
CGTGCATCTGTTGCATCCCCAG-3¢) and YIL11/Not
I(5¢-ATAGTTTAGCGGCCGCTTACAGCCGAGTCTT
CAG-3¢). This fragmentwasinserted in the vector YepFlag-1
(Kodak Scienti®c Imaging S ystem) just next to the Flag tag at
the restriction site EcoRI to generate plasmid YepFlag-
CPDIL11. T he fragment NdeI±No tI(Flag-CPDIL-11) was
obtained b y the third PCR using two primers G353 (5¢-
GGAATTCCATATGGACTACAAGGATGACGATG
ACAAG-3¢) and G354 (5¢-ATAGTTTAGCGGCCGCT
CACAGCCGAGTCTTCAG-3¢) and the above plasmid as
template. The expression plasmid pET-FCPDIL1 1 was
constructed b y insertion in phase of the fragment NdeI±
NotI into the vector pET-22b(+) (N ovagen) at the sites NdeI
and NotI. Because the recombinant protein FCPDIL-11
forms a dimer via the r esidue Cys a nd loses t he binding
activity on cells, another plasmid pET-FPDIL11 was c reat ed

by a PCR using two oligonucleotides G390 (5¢-
pGGTCGTCGTGCATCTGTTGC-3¢) and G391 ( 5¢-
pCTTGTCATCGTCATCCTTGTAG-3¢)asprimersand
the template plasmid pET-FCP DIL11. In this last construct,
the Cy s re sidue and the EcoRI site have been deleted. All
constructs were con®rmed by DNA sequencing.
Production and puri®cation of the human
recombinant IL-11
The plasmid pET-FPDIL11 was transformed into
BL21(DE3) cells. E. coli cells were cultured in Luria±
Bertani m edium containing 100 lgÁmL
)1
of ampicillin at
37 °C. When the absorbance o f growing cells at 600 nm
reache d % 0.6±0.8, the expression of the recombinant
protein was induced by addition of 1 m
M
isopropyl thio-
b-
D
-galactoside for 2 h. E. coli cells were then harvested and
lyzed by sonication for 5 min at an intensity of level 5 using a
microprobe (Vibra Cell, Sonics Materials Inc. Danburg,
Connecticut, USA) in the presence of 0.1% Triton X-100
and 150 lgÁmL
)1
of lysozyme in 50 m
M
Hepes, pH 7.4
buffer. Afte r two centrifugation cycles at 13 000 g for

25 min at 4 °C, the supernatant was precipitated with
(NH
4
)
2
SO
4
at a concentration o f 60% s aturation in order to
concentrate crude proteins. Salts were eliminated by dialysis
against 5 0 m
M
Hepes, pH 7.4 buffer b efore the puri®cation
of samples by c hromatography. T wo puri®cation protocols
were used. In the ®rst one, a small amount of pure FPDIL-11
was obtained after puri®cation on a Mono-S HR5/5 column
(Amersham P harmacia Biotech) using a 50 m
M
Hepes
buffer, pH 7.4, and a 0±1
M
NaCl gradient. This pure
protein was used for labeling and binding assays. Another
protocol combining chromatography on an SP-Sepharose
column using a 5 0 m
M
Hepes buffer, pH 7.4, and a 0±1
M
NaCl gradient, and af®nity chromatography on an anti-
Flag Ig column allowed t he puri®cation of larger amounts of
FPDIL-11. We used this preparation to maintain the

transfected IL-11-dependent Ba/F3 cells and 7TD1 cells. It
was also used as competitor in cell receptor binding studies.
SDS/PAGE and Western blot
SDS/PAGE with 15% polyacrylamide gels was carried out
as described previously [33]. After the transfer of proteins
from gels onto nitrocellulose ®lte rs. FPDIL-11 was detected
by incubation both w ith polyclonal anti-(hIL-11) Ig BAF218
and w ith m onoclonal a nti-Flag Ig (M2), and ®nally revealed
with the alkaline phosphatase system (Sigma).
62 X M. Wang et al. (Eur. J. Biochem. 269) Ó FEBS 2002
Cell culture
B13Ra1 and B13Ra2 c ells are a murine pro-B lymphocyte
line Ba/F3 stably transfected with plasmids cont aining two
genes t hat e ncode t he hIL-11 receptor a and b chains [30].
Cells were maintained in a culture medium RPMI-1640
supplemented with 10% fetal bovine serum, 1% glutamine,
0.8 m gÁmL
)1
G418 (Sigma), 5 lgÁmL
)1
puromycin (Sigma)
and 5 ngÁmL
)1
human IL-11 at 37 °Cand5%CO
2
.Murine
7TD1 hybridoma cells were cultivated as described
previously [34,35]. THP-1 monocytic leukaemia cells
(provided by M. K alai, Ghent University-VIB, B elgium),
K562 chronic m yelogenous leukaemia cells (provided by

H. Verschueren, Pasteur Institute of Brussels, Belgium), and
CESS myelomonocytic leu kaemia cells were maintained in
RPMI-1640 (with glutamine) containing 10% (v/v) fetal
bovine serum. MG-63 osteosarcoma cells, A375 metastatic
melanoma cells, HeLa epithelial carcinoma cells, RD
rhabdomyosarcoma cells, and SK-N-MC neuroblastoma
cells (provided by H. Verschueren) were maintained in
DMEM containing 10% fetal bovine serum and 2 m
M
glutamine. All cell lines were maintained at 37 °Cand5%
CO
2
.
IL-11 bioassay
IL-11 activity was measured using the IL-11-dependent
mouse hybridoma cell line 7 TD1. These cells were cultivated
in ¯at-bottom m icrotiter plate that contained 2 ´ 10
3
cells
per well in the presence of twofold dilutions of IL-11
(2 lgÁmL
)1
). After 7 days of cultu re, the number o f
surviving cells was determined by a c olorimetric assay of
hexosaminidase. I n this assay, the absorbance is propor-
tional to the number of cells present in each culture [35].
Each sample was tested in triplicate.
Labeling of FPDIL-11 with [c-
32
P]ATP

FPDIL-11 was labeled through protein phosphorylation
with [c-
32
P]ATP in the presence of bovine heart kinase.
Brie¯y, 1 lg of puri®ed FPDIL-11 was incubated at 30 °C
for 1 h with 0.5 mCi o f [ c-
32
P]ATP (% 3000 CiÁmmol
)1
,
Amersham Corp.) and 6 U of t he catalytic sub unit of
protein kinase from bovine h eart (Sigma) in 80 lLof
20 m
M
Tris/HCl, p H 7.5, 100 m
M
NaCl, 1 2 m
M
MgCl
2
,
and 1 m
M
dithiothreitol. The reaction was stopped by
adding 420 lLof1mgÁmL
)1
BSA in a buffer (PPE)
containing 10 m
M
sodium phosphate, 10 m

M
sodium
pyrophosphate, and 10 m
M
EDTA, pH 7.0 at 4 °C. The
32
P-labeled FPDIL-11 was dialyzed against 3 L of PPE
overnight at 4 °C and then against 1 L of NaCl/P
i
buffer for
4 h . Incorporation of radioactivity into FPDIL- 11 was
measured with a liquid scintillation spectrometer after
precipitation of the p rotein with 10% trichloroacetic acid.
SDS/PAGE of [
32
P]FPDIL-11 w as performed o n a slab gel
by the method of Laemmli [33]. The purity of [
32
P]FPDIL-
11 was c hecked after drying a nd exposi ng t he gel to an
X-ray ®lm (Kodak XAR) for autoradiography.
Binding of [
32
P]FPDIL-11 to cells
Cells (1 ´ 10
6
) were preincubated i n culture medium lack-
inggrowthfactorfor2handwerewashedthreetimes
with NaCl/P
i

, pH 7 .4. For binding studies, radiolabeled
FPDIL-11 at the indicated concentration in NaCl/P
i
containing 0.5% BSA was added to cells. The mixture
was incubated at 4 °C for the appropriate time and bound
radiolabeled FP DIL-11 was separated from the free r adio-
activity by centrifugation at 3000 g for 1 min through a 0.2-
mL layer of a mixture o f 40% dioctyl phthalate and 60%
dibutyl phthalate (Janssen Chimica, Beerse, Belgium). After
quick freezing, the tip o f each tube containing the cell p ellet
was cut-off and r adioactivity was counted with a Beckman
b-counter. Nonspeci®c binding was determined by incubat-
ing cells with radiolabeled FPDIL-11 in the presence of a
200-fold molar excess o f unlabeled FPDIL-11. The number
of receptors on cells and dissociation c onstant (K
d
)were
determined with Scatchard plot analysis a ccording to
speci®c binding data.
RESULTS AND DISCUSSION
Construction and puri®cation of recombinant
human IL-11 (FPDIL-11)
Radiolabeled hIL-11 is a useful and very sensitive r eagent to
study the hIL-11 r eceptors. Human IL-11 labeling with
125
I
has been reported [36], but our numerous attempts to
iodinate hIL-11 were unsuccessful due to a l oss of
bioactivity a fter labeling. As it had been shown that t he
incorporation of a phosphorylation site into s everal

proteins, such as IFN-a and diphtheria toxin, r esulted in a
high speci®c radioactivity after
32
P-labeling and had no
signi®cant effect on their biological activity [37±39], we
therefore decided to adopt a similar strategy f or IL-11. This
strategy is illustrated in Fig. 1. The N-terminal nucleotides
encoding the ®rst 10 amino acids of IL-11 w ere deleted and
replaced by a s equence encoding a F lag tag (Asp-Tyr-Lys-
Asp-Asp-Asp-Asp-Lys) followed by a consensus amino-
acid sequence (Arg-Arg-Ala-Ser-Val-Ala) that can be
recognized and phosphorylated on the serine residue by
the bovine heart kinase [37]. The Flag tag was introduced at
the end of the molecule to facilitate its puri®cation by
af®nity chromatography and immunological detection
[40±42]. The ®rst 10 amino acids of hIL-11 were deleted i n
order to keep the size o f the recombinant FPDIL-11 similar
to that of hIL-11 and to avoid the p roblem of expression
that may arise in E. coli because of the presence of many
consecutive p roline r esidues at the N-terminus. This d eletion
was made possible because the ®rst 13 N-terminal amino
acids a re not necessary for its biological activity and not part
of the s ites, a s identi®ed by molecular modelling and
site-directed mutagenesis, involved in receptor binding
[18,43±45].
Fig. 1. Nucleotide a nd amino acid se quences of the N -terminus of human
IL-11 and FP DIL-11. The Flag tag is boxed. The ®rst 10 amino acids of
hIL-11 are bold. The phosphorylation site recognized by the bovine
heart protein kinase catalytic subunit created in FP DIL-11 is under-
lined.

Ó FEBS 2002 Creation of a phosphorylatable recombinant hIL-11 (Eur. J. Biochem. 269)63
The puri®cation of FPDIL-11 from bacteria consisted of
three main s teps: ( a) ex traction of the recombinant protein,
(b) cation-exchange chromatography, and (c) af®nity
chromatography with anti-F lag Ig c oupled to Sepharose
beads. One liter of bacterial cell culture yielded 1±2 mg of
puri®ed FPDIL-11. The protein was stable during puri®ca-
tion and no d egradation was observed a fter several months
storag e at )20 °C. The FPDIL-11 protein was pure as
assessed by S DS/PAGE analysis (Fig. 2) and Western blots
using antibodies against hIL-11 and Flag peptide (data not
shown). Its apparent molecular mass was % 25 kDa, a value
somewhat higher than its real molecular mass (20 kDa)
determined by mass spectroscopy (data not shown). This
difference could be due to the presence within the Flag tag
and t he ph osphorylation s ite o f numerous charged residues
(1Glu, 5Asp, 2Arg and 2Ly s) (Fig. 1).
Biological activity of FPDIL-11
The availability of the puri®ed recombinant IL-11 protein
enabled us to t est i ts biological activities in vitro. The murine
hybridoma cell line 7TD1 formed by fusion of the mouse
myeloma cell line Sp2/0-Ag14 with spleen cells from a
C57BL/6 mouse was used for t his purpose. This cell line is
known to respond to picogram amounts of IL-6 [35], b ut
has a lso a proliferating r esponse t o nanogram a mounts of
IL-11 [31]. As shown in Fig. 3, the recombinant FPDIL-11
had a biological activity very similar to that o f wild-type
hIL-11 with an IC
50
of % 0.8 ngÁmL

)1
, con®rming that the
®rst 10 amino acids are dispensable for the biolo gical
activity of IL-11 a nd in dicating that the presence of the Flag
tag as w ell as t he phosphorylation site at the N-terninus
have no detectable effect on the IL-11 functionality.
Labeling of FPDIL-11
FPDIL-11 was labeled with [c-
32
P]ATP using bovine heart
protein kinase. Autoradiography of the labeled ligand
con®rmed the success of the phosphorylation. Speci®c
radioactivity attained about 250 000 cpmÁng
)1
of protein,
which corresponds to a nearly complete radiophosphate
labeling of the IL-11 molecules. Speci®city of the labeling
was demonstrated using both E. coli bacteriophage k
protein phosphatase and wild-type hIL-11. Bacteriophage
k phosphatase can hydrolyze phosphate groups on serine,
threonineor tyrosine-histidine residues.Incubating[
32
P]inter-
leukin with this enzyme resulted i n the complete loss of its
radioactive label (Fig. 4A). Human IL-11, which does n ot
contain any putative phosphorylation site, could not be
radiolabeled under similar conditions (data not shown).
Previous observations have shown that t he appar ent
molecular masses o f phosphorylated and nonphosphory-
lated proteins are slightly different on SDS/PAGE [46].

FPDIL-11 that was phosphorylated with cold ATP in the
same conditions as with [c-
32
P]ATP showed an apparent
molecular mass s lightly higher than its nonphosphorylated
counterpart (Fig. 4 B), con®rming once more its complete
phosphorylation. [
31
P]FPDIL-11 h ad a biological activity
similar to that of wild-type hIL-11, indicating that
phosphorylation does not affect the IL-11 functional
activity (Fig. 3).
Binding of [
32
P]-FPDIL-11 to cells
B13Ra1 and B13Ra2 cells were used to test FPDIL-11
binding to human IL-11 receptors. B13Ra1 a nd B13Ra2are
Ba/F3 cells stably transfected with human gp130 and,
Fig. 2. SDS/PAGE of FPDIL-11. Lane 1, 60 lgoftheextractpro-
teins from transformed BL21(D3) cells induced by 1 m
M
isopropyl
thio-b-
D
-galactoside for 2 h; lane 2, 2 lg of puri®e d F PDIL-11. Pro-
teins were s tained with Coomassie blue.
Fig. 3. Proliferation assay o f interleukin-11 on 7TD1 cells. IL-11
activity was measured using the mouse hybridoma cell line 7TD1.
Brie¯y, 7TD1 cells were cultivated in ¯at-bottom microwell plates
containing 2 ´ 10

3
cells per well in the presence of serial dilutions of the
cytokine. After 7 days of culture , the num be r of s urviving cells was
determined by a colorimetric assay of he xo saminidase. I n t his a ssay,
the a bsorbance is proportional t o the number of cells p resent in each
well. Each sample was t ested in triplicate.
64 X M. Wang et al. (Eur. J. Biochem. 269) Ó FEBS 2002
respectively, full length hIL-11Ra and hIL-11R a lacking the
cytoplasmic domain [30]. All binding experiments were
carried out at 4 °C to p revent cell internalization of the
ligand.
No speci®c binding of [
32
P]FPDIL-11 could be detected
on parental Ba/F3 cells. The kinetics of the association of
radiolabeled FP DIL-11 with B13Ra1 cells revealed that the
radioligand r eached its maximum association to cells after
1-h i ncubation at 4 °C. In subsequent equilibrium binding
studies, [
32
P]FPDIL-11 was therefore i ncubated with cells
for 90 min.
The dose±response curve of [
32
P]FPDIL-11 binding to
B13Ra1 cells is shown in Fig. 5. Nonspeci®c binding
component, determined b y adding a 200-fo ld molar excess
of unlabeled FPDIL-11, was low (less than 5 % of the total
association). A nalysis of t he speci®c binding data by the
method of Scatchard indicated the existence of a single class

of bind ing sites. B 13Ra1cellshave% 10 550 r eceptors per
cell with an apparent dissociation constant ( K
d
) of 0.372 n
M
(Fig. 5 , inset), which is consistent with that described
previously for o ther cell lines (K
d
 300±800 p
M
) [36,47±
49]. Similar results were obtained for B13Ra2 cells (data not
shown). We c ould only detect high af®nity receptors on
these cells. This suggests e ither that in these cells gp130 is in
excess or that the af®nity of the a subunit is too low to b e
detected. The IL-11 receptor a chain is a transmembrane
protein, but its membrane-spanning and cytoplasmic
domains are unnecessary for I L-11-induced signal transduc-
tion [30,31]. As expected, the receptor b inding on B13R a2
cells revealed that the cytoplasmic domain is also dispen-
sable for ligand binding.
Competition experiments betw een radiolabeled and
unlabeled FPDIL-11 gave an experimental K
i
of 0.377 n
M
,
which is similar to the calculated K
d
value obtained from

Scatchard analysis (Fig. 6). I L-6 was used as a negative
control a s this cytokine and IL-11 do not compete for the
same receptors [47]. When wild-type hIL-11 and
[
31
P]FPDIL-11 were used as competitors, similar results
were obtained, suggesting that addition of the Flag t ag and
phosphorylation site, and phosphorylation of this site at the
serine residue as well as deletion of the ®rst 10 amino a cids,
have no effect on IL-11 binding to the human IL-11Ra and
gp130 receptor complex.
When 7TD1 cells were used for r eceptor binding assay,
Scatchard a nalysis o f the data revealed that these cells have
% 550 r eceptors pe r cell with a K
d
around 0.97 n
M
.Human
IL-11Ra can i nteract with murine gp130 and this provides a
speci®c high-af®nity binding site for hIL-11 [49]. The
binding of [
32
P]FPDIL-11±7TD1 cells expressing both
murine IL-11R a and murine gp130 demonstrated that the
interaction between hIL-11 and murine IL-11Ra and
murine gp130 was also of h igh a f®nity. Taken t ogether,
these observations suggest that human and murine IL-11
Fig. 5. Binding o f radiolabeled ligand to B13Ra1cells.The b in ding of
[
32

P]FPDIL-11 to B13Ra1 cells was performed as described under
Materials and me thod s. Speci®c binding (.) represents the dierence
between total binding (r) a nd nonspeci®c binding ( m). Nonspeci®c
binding represents the binding in the presence of excess unlabeled
FPDIL-11. Values wer e the means of trip licates from two independent
experiments. Standard errors of the means were less than 5%. Inset:
Scatchard analysis of FPDIL-11 binding according to speci®c binding
data (bound molecules of FPDIL-11 w ere p lotted v s. bound FPDIL-
11/free FPDIL-11). B
max
 10 55 0  200 sites p er cell; K
d
 0.372 
0021 n
M
.
Fig. 4. Phosphorylation of FPDIL-11. (A) [
32
P]FPDIL-11 (0.8 ng) with 2500 CiÁmmol
)1
was treated with or without 5 U of E. coli lambda
phosphatase for 75 min at 30 °C were separated on SDS/PAGE (15%). After electrophoresis, the gel was d ried onto a sheet o f W ha tman 3 paper
and it was then e xposed for 10 min to a Kodak X-Omat ®lm (Kodak c ompany) for a utoradiography. (B) Lane 1, 100 ng of FPDIL-11 phos-
phorylated with c old
31
P; lane 2, 1 lg of unphosphorylated FPDIL-11 were separated on a SDS/PAGE ( 15%). Proteins w ere coloured b y the silver
staining method.
Ó FEBS 2002 Creation of a phosphorylatable recombinant hIL-11 (Eur. J. Biochem. 269)65
receptors are interchangeable for c ytokine binding. I ndeed,
human IL- 11Ra shares 82% i dentity with its murine

homolog [29,36]. Although both cytokines display relatively
poor homology i n the D1 domain, domains D2 and D3 a re
well conserved. The Ig-like domain (D1) i s n ot required for
ligand b inding as the presence of IL-11 and IL-11R-D2,3 is
suf®cient to induce b iological activity [50]. The residues
responsible for the ligand binding are mainly located in the
D3, and D2 plays only a minor role [32].
Several human hematopoietic and nonhematopoietic
cell lines (THP-1 monocytic leukaemia cells, K562 chronic
myelogenous leukaemia cells, CESS myelomonocytic
leukaemia cells, MG-63 osteosarcoma cells, A375 meta-
static melanoma cells, He La e pithelial carcinoma cells,
RD r habdomyosarcoma cells, and SK-N-MC n euroblas-
toma cells) h ave been tested using [
32
P]FPDIL-11 to
obtain information about the expression of human IL-11
receptors. S peci®c binding was observed in THP-1 and
MG-63 cells and Scatchard plot analysis revealed that
they have, % 600 a nd 800 receptors, r espectively, per cell
(data not shown). This is t he ®rst time that cell surface
expression of human IL-11 receptors is shown directly in
human cells by use of a radioligand. We found the
presence of IL-11Ra on THP-1 cells. This is consistent
with previous observations that IL-11 is involved in the
regulation of production of pro-in¯ammatory cytokines
such as TNF-a,IL-1b,IFN-c and I L-12 by monocytes
[55,56], and that the IL-11 receptor analysis on human cell
lines by ¯ow cytometry using monoclonal anti-IL-11Ra Ig
has also r evealed t he expression of IL-11Ra on these cells

[54]. In contrast with previous reports describing IL-11Ra
mRNA dete ction i n K562 cells and skeletal m uscle [ 29],
we did not observe th e expression of IL-11Ra on these
cells nor on RD cells. MG-63 cells have been shown to
have both IL-11Ra mRNA and the expression of this
receptor [29,54,57]. Detection of IL-11R on these cells, in
this study, is in accordance with the fact t hat IL-11 is able
to induce the formation of osteoclasts in bone morrow
and able to stimulate bone resorption [58].
Inhibition of ligand binding by monoclonal antibodies
Monoclonal anti-(IL-11) Ig, anti-gp130 Ig and anti-
(IL-11R) Ig were used for antibody competition experi-
ments t o test whether they would affect FPDIL-11 binding.
H2 and H56 ar e two neutrali zing anti-(IL-11) Ig that
recognize a n epitope localized at s ite II of the cytokine, being
the c ontact point with gp130. T hese two mAbs were shown
to have an inhibitory effect on IL-11-induced proliferation
of B13R a1withanIC
50
around 3 n
M
for H2 a nd 5 n
M
for
H56 (C. Blanc, I. Tacken, J M. Wilkin, P. Vuzio, G. M uller-
Newen, P.C. Heinrich, Y. Jacques, J. Gro
È
tzinger, J. Content
& F.A. Montero-Julian, unpublished results). Similarly,
they can a lso inhibit F PDIL-11 receptor binding with an

IC
50
of 0.34 n
M
for H 2 and 0.58 n
M
for H 56 (Fig. 6 A). It
should be noted that H2 and H56 are not competitive
inhibitors of cytokine binding but rather interfere w ith the
formation of the IL-11±IL-11R±gp130 complex. The IC
50
values of both antibodies that inhibit I L-11-induced
proliferation of B13Ra1 cells (3 n
M
for H2 and 5 n
M
for
H56) were 10-fold higher than the antibodies concentrations
that inhibit [
32
P]FPDIL-11-receptor b inding on the s ame
cells (0.34 n
M
for H2 and 0.58 n
M
for H56). T hese results a re
nevertheless not contradictory because IC
50
values a re not
intrinsic constants a s t hey d epend o n th e concentration o f

ligand used; the higher c oncentration of l igand used, the
larger concentration of inhibitor t o compete for 50% of the
activity w ill be needed.
B-R3 and MAB628 are two anti-(human gp130) mAbs
that interfere with the biological effects o f all known
cytokines u sing gp13 0 as transducing element [30,51±53].
Figure 6B shows that B-R3 a nd MAB628 mAbs inhibit the
radioligand binding with IC
50
values of 0.47 n
M
and
0.20 n
M
, respectively. Several mAbs against the human
interleukin-11 receptor a-chain have rece ntly been raised [54].
I7.4, D14.7, B24.3, D16.1, E24.2, C8.7, and A 3.4 recognize
the domain III (D3) of I L-11R [54]. N one of these mAbs are
inhibitory of IL-11-induced proliferative response. These
mAbs were tested in the FPDIL-11-receptor b inding assay. In
Fig. 6. Binding of [
32
P]FPDIL-11 t o B 13Ra1 cells competed with d i erent in terleuk in-11 (A) and inhibited by antihuman IL-11 and a ntihuman gp130
neutralizing antibodies (B). Cells were incubated with t he indicated concentrations of, in panel A, unlabeled rhIL-11 (m), unlabe led FPDIL-11 (j),
cold labeled [
31
P]FPDIL-11 (s), an d I L-6 (r) a s a negative control; in panel B, anti human I L-11 monoclonal antibodies H2 (.)andH56(e)and
antihuman gp 130 monoclonal an tibodies MAB628 (h)andB-R3(n). Data points represen t th e m eans of triplicate determination s e xpressed as a
percentage of maximum speci®c binding. K
i

was calculated to be about 0.252 n
M
for rhIL-11, 0.377 n
M
for FPDIL-11, and 0.337 n
M
for
[
31
P]FPDIL-11. These v alues were o btained by the me thod of Ch eng & Pruso [59]. I C
50
wascalculatedtobe% 0.3 4 n
M
for H2, 0.5 8 n
M
for H56,
0.20 n
M
for MAB628, a nd 0.47 n
M
for B-R3.
66 X M. Wang et al. (Eur. J. Biochem. 269) Ó FEBS 2002
agreement w ith t he proliferation data, none of them had any
inhibitory effect on FPDIL-11 binding (data not shown), thus
reinforcing t he conclusion that the e pitopes recognized by all
these antibodies are distinct from t he ligand binding site.
The i ntroduction of a phosphorylation site into IL-11 and
other proteins p rovides a convenient and simple m ethod to
label the proteins to high speci®c radioactivities. If multiple
phosphorylation sites wer e introduced into proteins, much

higher spe ci®c radioactivities c ould b e generated and
accordingly, this would render the radioligand-detection
much more easier. T his is a quite useful tool especially in the
case where the expression of certain receptors on the cell
surface is lower. T he en zymatic labeling b y phosphorylation
is a relatively g entle way to radiolabel ligands as compared to
chemical methods that can destroy t he biological activity to
some extent. Because of its high radioactivity and biological
activity,
32
P-labeled IL-11 should be a useful reagent for
the characterization and assay o f the IL-11 r eceptors,
pharmacokinetics, diagnostic imaging, a nd many other uses.
ACKNOWLEDGEMENTS
This work was supported by grants from the European Community
(BIO4 CT 972010), the F und f or Medical S cienti®c Research (contract
3.4611.97, Belgiu m), the ÔFondation Rose et Jean HoguetÕ and ÔLes amis
de lÕInstitut Pasteur de B ruxel lesÕ.
REFERENCES
1. Schwertschlag, U.S., Trepicch io, W.L., D ykstra, K.H., Keith,
J.C., Turner, K.J. & Dorner, A.J. (1999) Hematopoietic,
immunomodulatory and epithelial eects of interleukin-11. Leu-
kemia 13 , 1307±1315.
2. Teramura, M., Kobayashi, S., Yoshinaga, K., Iwabe, K. &
Mizoguchi, H. (199 6) Eect of interleukin 11 on normal and
pathological t hrombopoiesis. Cancer. Chemother. P harmacol. 38,
S99±S102.
3. Leonard, J.P., Q uint o, C.M., Ko zitza, M.K., Neben, T.Y. &
Goldman, S.J. (1994 ) Recombinant human i nterleukin-11 s timu-
lates multilineage hematopoietic recovery in mice after a myelo-

suppressive regimen of sublethal irradiation and carboplatin.
Blood 83 , 1499±1506.
4. Schlerman, F.J., Bree, A.G., K aviani, M., N agle, S.L., Donnelly,
L.H., Mason, L.E., S ch aub, R.G., Grupp, S.A. & Go ldman, S.J.
(1996) Thrombopoieti c activity of recombinant human interleukin
11 (rHuIL-11) in normal and myelosuppressed nonhuman
primates. S tem Cells. 14, 517±532.
5.Tepler,I.,Elias,L.,Smith,J.W.,nd,Hussein,M.,Rosen,G.,
Chang,A.Y.,Moore,J.O.,Gordon,M.S.,Kuca,B.,Beach,K.J.,
Loewy, J.W., Garnick, M.B. & Kaye, J .A. (1996) A randomized
placebo-controlled trial of recombinant human interleukin -11 in
cancer patients with severe th romb ocytopenia due to chemother-
apy. Blood 87, 3607±3614.
6. Isaacs, C., Robert, N.J., Baile y, F.A., Schuster, M.W., O ver-
moyer,B.,Graham,M.,Cai,B.,Beach,K.J.,Loewy,J.W.&
Kaye, J.A. (1997) Randomized placebo-controlled study of
recombinant human interleukin-11 to prevent chemotherapy-
induced thrombocytopenia in patients w ith breast cancer r eceivin g
dose-intensive cyclophosphamide and doxorubicin. J. Clin. Oncol.
15, 336 8±3377.
7. Anguita, J., Barthold, S.W., Samanta, S ., Ryan, J. & Fikrig, E.
(1999) Selective anti-in¯ammatory action of interleukin-11 in
murine Lyme disease: arthritis decreases while carditis persists.
J. Infect. Dis. 179, 734±737.
8. Walmsley, M., Butler , D .M., Marinova-Mutafchieva, L. &
Feldmann, M. (1998) An anti-in¯ammatory role for interleukin-11
in established murine collagen-induced a rthritis. Imm unolo gy 95 ,
31±37.
9. Trontzas, P ., Kamper , E.F., Potamianou, A., Kyriazis, N .C.,
Kritikos, H. & Stav ridis, J. (1998) Comparative s tudy of serum

and synovial ¯uid i nterleukin -11 levels i n patients w ith variou s
arthritides. Clin. B iochem. 31 , 673±679.
10. Bozza, M., Bliss, J.L., Maylor, R., Erickson, J., Donnelly, L.,
Bouchard,P.,Dorner,A.J.&Trepicchio,W.L.(1999)Inter-
leukin-11 reduces T-cell-dependent experimental liver injury in
mice. Hepatology 30, 1441±1447.
11. Sands, B.E., Bank, S., Sninsky, C.A., Robinson, M., Katz, S.,
Singleton, J.W., Miner, P.B., Safdi, M.A., Galandiuk, S .,
Hanauer, S.B ., et al. (1999) Preliminary e valuation of safety and
activity of recombinant human interleukin 11 in patients with
active Crohn's disease. Gastroenterology 117 , 58±64.
12. Peterson,R.L.,Wang,L.,Albert,L.,Keith,J.C.&Dorner,A.J.
(1998) Molecular e ects of r ecombinant human i nt erleukin-11 in
the H LA-B27 rat mod el of in¯ammatory bowel disease. Labora-
tory Invest. 78, 1503±1512.
13. Greenwood-Van Meerveld, B., Tyler, K. & Keith, J.C. (2000)
Recombinant human interleukin-11 mo du lates ion transport and
mucosal in¯ammation in the small intestine a nd colon. Laboratory
Invest. 80 , 1269±1280.
14. Sonis, S.T., Van Vugt, A.G., McDonald, J., Dotoli, E.,
Schwertschlag, U., Szklut, P. & Keith, J. (1997) Mitigating eects
of interleukin 11 on consecutive courses of 5-¯uorouracil-induced
ulcerative mucositis in hamsters. Cytokine 9, 605 ±612.
15.Trepicchio,W.L.,Ozawa,M.,Walters,I.B.,Kikuchi,T.,
Gilleaudeau, P., Bliss, J.L., Schwertschlag, U., Dorner, A.J. &
Krueger, J.G. (1999) Interleukin-11 therapy selectively down-
regulates type I cytokine proin¯ammatory pathways in psoriasis
lesions. J. Clin. Invest. 104, 1527±1537.
16. Robb, L., L i, R., Hartley, L ., Nandurkar, H.H., Koentgen, F. &
Begley, C.G. (1998) Infertility in female mice lacking the r eceptor

for interleukin 11 is due to a defective uterine resp onse to
implantation. Nat. M ed. 4, 303±308.
17. Kalai, M., Montero-Julian, F.A., Gro
È
tzinger, J., Fontaine, V.,
Vandenbussche, P., Deschuyteneer, R., Wollmer, A., Brailly, H. &
Content, J. (1997) A nalysis of t he IL-6/IL-6R bi nding i nterface at
the amino acid level: proposed mechanisms of interaction. Blood
89, 1319 ±1333.
18. Jacques, Y ., Minvielle, S., Mul ler-Newen, G., Heinrich, P.C.,
Gro
È
tzinger, J., M ontero-Julian, F.A., Brailly, H ., Wilkin, J.M. &
Content, J. (1998) T he interleukin-11/receptor complex: rational
design of agonists/antagonists and immunoassays potentially
useful in h uman therapy. Res. Immunol. 149, 737±740.
19. Senaldi, G ., Varnum, B.C., Sarmiento, U., Starnes, C ., Lile, J.,
Scully, S., Guo, J., Elliott, G., Mcninch, J., Shaklee, C.L., Free-
man,D.,Manu,F.,Simonet,W.S.,Boone,T.&Chang,M.S.(1999)
Novel neurotrophin-1/B cell-stimulating factor-3: a cytokine of the
IL-6 family. Proc. Natl A cad. Sci. USA 96, 11458±11463.
20. Neipel, F., Albrecht, J.C., Ensser, A., Huang, Y.Q., Li, J.J.,
Friedmanklein, A.E. & Fleckenstein, B. (1997) Human herpes-
virus 8 encodes a homolog of interleukin-6. J. Vir o l. 71, 839±842.
21. Heinrich, P.C., Behrman n, I., Mul ler-Newen , G., Sch aper, F. &
Graeve, L. (1998) Interleukin-6-type cytokine signalling through
the gp130/Jak/STAT pathway. Biochem. J. 334 , 297±314.
22. Taga, T. & Kishimoto, T. (1997) gp130 and the interleukin-6
family of c ytokines. Annu. Rev . Immunol. 15 , 797±819.
23. Wan, X .Y., Wang, H.L. & Nicholas, J. (1999) Human herpesvirus

8 interleukin-6 (VIL-6) signals through gp 130 but has structural
acid receptor-binding properties distinct from those of human
IL-6. J. Virol. 73, 826 8±8278.
24. Mullberg, J., Geib, T., Jostock, T ., Ho ische n, S.H ., Vo llmer, P.,
Voltz, N., Heinz, D., Galle, P.R., Klouche, M. & Rose-John,
S. (2000) IL-6 receptor independent s timulation of human gp130
by viral IL-6. J. Immunol. 16 4, 4672±4677.
Ó FEBS 2002 Creation of a phosphorylatable recombinant hIL-11 (Eur. J. Biochem. 269)67
25. Gro
È
tzinger, J., Kurapkat, G., Wollmer, A., Kalai, M. & Rose-
John, S. ( 1997) The family of the IL-6-type cytokines: speci®city
and promiscuity of th e receptor complexes. Protein 27 , 96±109.
26. Gro
È
tzinger, J., K ernebeck, T., K allen, K.J. & Rose-John, S. (1999)
IL-6 type cytokine receptor co mplexes: hexamer, tetramer or
both? Biol. C hem. 380, 803±813.
27. Neddermann, P., Gr aziani, R ., Cil iberto, G . & Paonessa, G.
(1996) Functional e xpression of soluble human inte rleukin-11
(IL-11) receptor alpha and s toichio metry of in vitro I L-11 receptor
complexes with gp130. J. Biol. C he m. 271, 30986±30991.
28. Barton, V.A., Hall, M.A., Hudson, K.R. & Heath, J.K. (2000)
Interleukin-11 signals through the formation of a hexameric
receptor complex. J. Biol. Chem. 275, 36197±36203.
29. Cherel, M., So rel, M., Lebeau, B., Dubois, S., Moreau, J.F.,
Bataille, R., Minvielle, S. & Jacques, Y. (1995) Molecular cloning
of two i soforms of a re ceptor for the hu man hematopoietic cyto-
kine interleukin-11. Blood 86, 2534±2540.
30. Lebeau, B ., Montero-Julian, F.A., W ijdenes, J., Muller-Newen, G.,

Dahmen, H., Cherel, M., Heinrich, P.C., Brailly, H., Hallet, M.M.,
Godard, A., Minvielle, S. & Jacques, Y. (1997) Reconstitution
of two isoforms of the human interleukin-11 receptor and com-
parison of t heir functional properties. FEBS Lett. 407, 141±147.
31.Karow,J.,Hudson,K.R.,Hall,M.A.,Vernallis,A.B.,Taylor,
J.A., G ossler, A. & Heath, J.K. (1996) Media tion of interleukin -
11-dependent biological responses b y a soluble f orm of t h e inter-
leukin-11 r eceptor. Biochem. J. 318, 489 ±495.
32. Schleinkofer, K., D ingley, A., T acke n, I., F ederwisc h, M., M uller-
Newen, G., H einrich, P.C., V usio, P., Jacques, Y. & Gro
È
tzinger, J.
(2001) Identi®cation of t he domain in the human interleukin-11
receptor that mediates ligand binding. J. Mol. Biol. 306, 263±274.
33. Laemmli, U.K. (1970) Cleavage of structural p roteins during the
assembly of the head of bacteriophage T4. Nature 227, 6 80±685.
34. Fontaine, V., Savino, R., Arcone, R., De Wit , L., Brakenho, J.P.,
Content, J. & Ciliberto, G. ( 1993) Involvement of the Arg179 in
theactivesiteofhumanIL-6.Eur. J. Biochem. 211, 749±755.
35. Van Snick, J., Cayphas, S., Vink, A., Uyttenhove, C., Coulie,
P.G., Rubira, M .R. & Simpson, R.J. (1986) Puri®cation a nd NH
2
-
terminal amino acid sequence of a T -cell- derived lymphokine with
growth factor activity for B -cell hybridomas. Proc . Natl Acad. Sci.
USA 83, 9679±9683.
36. Hilton, D.J., Hilton, A.A., Raicevic, A., Rakar, S., Harrison-
Smith, M., Gough, N.M., Begley, C.G., Metcalf, D., Nicola, N.A.
& Willson, T .A. (1994) Cloning of a murine IL-11 receptor a lpha-
chain; re qu irement for gp130 for high anity bin ding and signal

transduction. EMBO J. 13, 4765±4775.
37. Li, B .L., Langer, J .A., Schwartz, B. & Pestka, S. (1989) Creation
of p ho sphorylation sites i n proteins: construction of a phosphor-
ylatable human interferon a lpha. Proc.NatlAcad.Sci.USA
86, 558±562.
38. Mohanraj, D., W ahlsten, J.L. & Ramakrishnan, S. (1996)
Expression and r adiolabeling of recombinant p roteins containing
a phosphorylation motif. Protein Expr. Purif. 8, 175±182.
39. Pestka, S ., Lin, L ., Wu, W. & Izotova, L. (1999) Introduction of
protein kinase recognition sites into proteins: a review of their
preparation, advantages, and applications. Pr otein Expr. Purif. 17,
203±214.
40. Prickett, K.S., Amberg, D.C. & Hopp, T.P. (1989) A calcium-
dependent a ntibody f or identi®cation and puri®cation of recom-
binant proteins. Bi otechniques 7, 580±589.
41. Blanar, M.A. & Rutter, W.J. (1992) Interaction cloning: identi®-
cation of a helix-loop-helix zipper pro tein that i nteracts with
c-Fos. Science 25 6 , 1014±1018.
42. Zhang, X.K., Homann, B., Tran, P.B., Graupner, G. & Pfahl,
M. (1992) Retinoid X receptor is a n auxiliary p rotein for thyroid
hormone and retinoic acid r ece ptors. Nature 355 , 441±446.
43. Czupryn, M., Bennett, F., Dube, J., Grant, K., Scoble, H.,
Sookdeo, H. & Mc Coy, J.M. (199 5) Alanine-scanning mutagen-
esis of human interleukin-11: identi®c ation of regions impo rtant
for biological a ctivity. Ann. NY Acad. Sci. 762, 152±164.
44. Tacken, I., Dahmen, H., Boisteau, O ., Minvielle, S., Jacques, Y.,
Gro
È
tzinger,J.,Kuster,A.,Horsten,U.,Blanc,C.,Montero-Ju-
lian, F .A., Heinrich, P.C. & Muller-Newen, G. (1999) De®nition

of receptor bin ding sites on human interleukin-11 by mole cular
modeling-guided mutagenesis. Eur. J. Biochem. 265, 645±655.
45. Barton, V.A., H udson, K.R. & Heath, J.K. (1999) Ide nti®cation
of three distinct receptor binding site s of m urine interleukin-11.
J. Biol. Chem. 274, 5 755±5761.
46. Schaper, F., Gen do, C., E ck, M., Schmitz, J., G rimm, C.,
Anhuf, D., K err, I.M. & Heinrich, P.C. (1998) Activation of the
protein tyrosine phosphatase SHP2 via the interleukin-6 signal
transducing receptor protein gp130 requires tyrosine kinase Jak1
and limits acute-phase proteine xpression. Biochem. J. 335, 557±565.
47. Yang, Y .C. & Yin, T.G. (1992) Interleukin-11 and its receptor.
Biofactors 4, 15±21.
48. Yin, T.G., Miyazawa, K. & Y ang, Y.C. (1992) Characterization of
interleukin-11 receptor and protein tyrosine phosphorylation
induced by interleuk in-11 in mouse 3T3-L1 cells. J. Biol. Chem.
267, 8347±8351.
49. Nandurkar, H.H., H ilton, D.J., Nathan, P., Willson, T., Nicola,
N. & Begley, C.G. (1996) The human IL-11 receptor requires
gp130 for signalling: demonstration by molecular cloning of the
receptor. Oncogene 12 , 585±593.
50. P¯anz, S., Tacken, I., G rotzinger, J., J acques, Y., Minvielle, S.,
Dahmen, H., Heinrich, P .C. & Muller-Newen, G . ( 1999) A fusion
protein of in terleukin-11 a nd soluble interleukin-11 receptor acts as
a superagonist on cells expressing gp130. FEBS Lett. 450, 117±122.
51. Wijdenes, J., Heinrich, P .C.M., Mu
È
ller-Newen, G., Roche, C., Gu,
Z.J., Clement, C . & Klein, B. (1995) Interleukin-6 signal t rans-
ducer gp130 has speci®c binding sites for dierent c ytokines as
determined by a ntagonistic and agonistic anti-gp130 monoclonal

antibodies. Eur. J. Immunol. 25, 3 474±3481.
52. Chevalier, S., Fourcin, M., Robledo, O., W ijdenes, J., Pouplard-
Barthelaix, A. & Gascan, H . ( 1996) Inter leukin-6 f amily of cyto-
kines induced activation of dierent functional sites expre ssed by
gp130 transducing protein. J. Biol. Chem. 271 , 14764±14772.
53. Gu, Z.J., Wijdenes, J., Zhang, X.G., Hallet, M.M., Clement, C. &
Klein, B. (1996) Anti-gp130 transducer monoclonal antibodies
speci®cally i n hibiting ciliary neurotrophic factor, interleukin-6,
interleukin-11, l euke mia i nhibitory f actor or oncostatin M.
J. Immunol. Meth. 190, 21±27.
54. Blanc, C., Vusio, P., Schleinkofer, K., Bois teau, O., P¯anz, S.,
Minvielle, S., Grotzinger, J., M uller-Newen, G., Heinrich, P.C.,
Jacques, Y. & Montero-Julian, F.A. (2000) Monoclonal a nti-
bodies against t he human interleukin-11 r ec eptor a lp ha-chain
(IL-11R alpha) a n d their use in studies of h um an mononuclear
cells. J. Immunol. Methods 241, 43±59.
55. Trepicchio,W.L.,Bozza,M.,Pedneault,G.&Dorner,A.J.(1996)
Recombinant human IL-11 atte nuates the in¯ammatory r esponse
through down-regu lation of p roin¯am matory cytokine rele ase and
nitric oxide p roductio n. J. Immu nol. 157, 3627±3634.
56. Leng, S.X. & Elia s, J.A. (1997) Interleukin-11 inhibits macrophage
interleukin-12 production. J. Immunol. 159, 2 161±2168.
57. Bellido, T., S tahl, N., Farruggella, T.J., Borba, V., Yancopoulos,
G.D. & Manolagas, S.C. ( 1996) Detection of r eceptors for inter-
leukin-6, interleukin-11, leu kemia inhibitory f actor, oncostatin M,
and ciliary neurotrophic factor in bone marrow stromal/osteo-
blastic cells. J. Clin. Invest. 97 , 431±437.
58. Girasole, G., Passeri, G ., Jilka, R .L. & M anolagas, S.C. (1994)
Interleukin-11: a new cyto kine critical f or osteoclast developm ent.
J. Clin. I nvest. 93, 151 6±1524.

59. Cheng, Y. & Pruso, W.H. (1973) R elationship b etween the
inhibition constant (K1) and the concentration of inhibitor which
causes 5 0 per c ent inhibition ( I50) of an e nzym atic reaction.
Biochem. Pha rmacol. 22, 3099±3108.
68 X M. Wang et al. (Eur. J. Biochem. 269) Ó FEBS 2002