Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt

Biochemical evidence for conformational changes in
the cross-talk between adenylation and peptidyl-carrier
protein domains of nonribosomal peptide synthetases
Joachim Zettler and Henning D. Mootz
Technische Universita
¨
t Dortmund, Germany
Introduction
A myriad of bioactive peptides is assembled by non-
ribosomal peptide synthetases (NRPSs). Examples of
such nonribosomal peptides (NRPs) include the immu-
nosuppressant cyclosporine A, the antibiotic vancomy-
cin, and the iron-chelating siderophore enterobactin.
During the stepwise biosynthesis of the NRP, the
intermediates are covalently attached to the NRPS
template [1–4]. Genetic and biochemical analysis of
NRPSs have revealed the modular organization of
these multifunctional mega-enzymes. The incorpora-
tion of one building block into the growing peptide
chain requires one module consisting of several spe-
cialized catalytic domains [2–4]. Figure 1A shows the
interplay of individual domains during a catalytic cycle
at an elongation module. In step 1, the adenylation
(A) domain selects a cognate amino acid and activates
it by forming the corresponding amino acyl adenylate.
Then, as shown in step 2, the 4¢-phosphopantetheine
moiety (Ppant) of the peptidyl-carrier protein (PCP)
domain binds the activated acyl group as a thioester.
Keywords
A-domain inhibitor; conformational change;
domain interaction; nonribosomal peptide

synthetase (NRPS); peptide antibiotics
Correspondence
H. D. Mootz, Technische Universita
¨
t
Dortmund, Fakulta
¨
t Chemie – Chemische
Biologie, Otto-Hahn-Str. 6, 44227 Dortmund,
Germany
Fax: +49 0 231 755 5159
Tel: +49 0 231 755 3863
E-mail:
(Received 31 August 2009, revised 15
December 2009, accepted 16 December
2009)
doi:10.1111/j.1742-4658.2009.07551.x
Nonribosomal peptide synthetases serve as multidomain protein templates
for producing a wealth of pharmaceutically important natural products.
For the correct assembly of the desired natural product the interactions
between the different catalytic centres and the reaction intermediates bound
to the peptidyl carrier protein must be precisely controlled at spatial and
temporal levels. We have investigated the interplay between the adenylation
(A) domain and the peptidyl carrier protein in the gramicidin S synthetase I
(EC 5.1.1.11) via partial tryptic digests, native PAGE and gel-filtration
analysis, as well as by chemical labeling experiments. Our data imply that
the 4¢-phosphopantetheine moiety of the peptidyl carrier protein changes
its position as a result of a conformational change in the A domain, which
is induced by the binding of an amino acyl adenylate mimic. The produc-
tive interaction between the two domains at the stage of the amino acyl

transfer onto the 4¢-phosphopantetheine moiety is accompanied by a highly
compact protein conformation of the holo-protein. These results provide
the first biochemical evidence for the occurrence of conformational changes
in the cross-talk between A and peptidyl carrier protein domains of a multi-
domain nonribosomal peptide synthetase.
Abbreviations
A domain, adenylation domain; ANL, aryl and acyl CoA synthetases, NRPS A domains and firefly luciferases; A-PCP(D-4Cys), the gramicidin S
synthetase I A domain and the PCP domain (C60F, C331A, C376S, C473A); A-PCP, the gramicidin S synthetase I A domain and the
PCP domain; ApCpp, adenosine-5¢-[(a,b)-methyleno] triphosphate; C domain, condensation domain ; E domain, epimerisation domain;
eq., equivalent; GrsA, gramicidin S synthetase I; NRP, nonribosomal peptide; NRPS, nonribosomal peptide synthetase; PCP domain, peptidyl
carrier protein domain; Ppant, 4¢-phosphopantetheine moiety; PP
i,
pyrophosphate; Sfp, 4¢-phosphopantetheine transferase involved in surfactin
production; TAMRA, tetramethyl-rhodamine; TE domain, thioesterase domain; TycA, tyrocidine synthetase I; TycB, tyrocidine synthetase II.
FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS 1159
During steps 3 and 4, peptide-bond formation is cata-
lyzed at the acceptor position of an upstream conden-
sation (C) domain and at the donor position of a
downstream C domain. In the case of an initiation
module, the upstream C domain is omitted, whereas in
the case of the last module of an NRPS assembly line
a thioesterase (TE) domain usually replaces the down-
stream C domain. Additional domains can be included
within a module to achieve further diversification (e.g.
epimerization, N-methylation and oxidation domains).
For most NRPSs, the arrangement of the modules
on the primary sequence is co-linear with the assem-
bled NRP. However, modules can also be used itera-
tively, or the relationship between the module and
domain compositions and the NRP can be more

complex [5].
Crystallographic studies and NMR investigations
have revealed the 3D structures of representative
members of each essential NRPS domain in an iso-
lated form [6–11]. For example, A domains belong,
together with acyl-CoA synthetases, aryl-CoA synthe-
tases and firefly luciferases, to the ANL superfamily
of adenylating enzymes. Congeners of this class con-
tain two subdomains, the larger N-terminal sub-
domain (A
N
) (400–500 amino acids in size) and the
smaller C-terminal subdomain (A
C
) (100–150 amino
acids in size). Consistent with this enzyme class, crys-
tallographic and mutational studies (for a review see
[12]) have revealed that A domains probably adopt
three different conformations during the catalytic
cycle and use large-scale domain rotations [12] to
catalyze the two half reactions, namely amino acyl
adenylate formation and thioesterification onto the
Ppant group of the C-terminal PCP (steps 1 and 2 in
Fig. 1A and see Fig. S1A for representative structures
of the different conformations) [12–15]. These three
conformations include an open conformation with lit-
tle contact between the subdomains when no sub-
strates are present [12,13]. Binding of ATP and the
amino acid substrate results in a rotation of the
subdomains towards the ‘adenylation conformation’

and closes the active site from bulk solvent [12,13].
Breaking of the a,b-phosphodiester bond of ATP,
and the subsequent release of pyrophosphate, induces
a 140° rotation of A
C
with respect to A
N
, giving a
conformation where thioester formation takes place
[12,13]. However, a structure of an A domain in this
‘thioester-conformation’ with an interacting PCP is
not available.
PCP domains can also exist in different, intercon-
verting conformations [8]. Previous studies have shown
that the structure of the PCP domain is dependent not
AB
Fig. 1. (A) Scheme of the reactions catalyzed by a minimal NRPS elongation module. From a functional perspective, the PCP is the central
domain in each module. The 4¢-phosphopantetheine prosthetic group (Ppant) must interact in a minimal elongation cycle with the A-domain
to become acylated by the amino acyl adenylate intermediate, with the upstream C domain receiving the amino acyl or peptidyl group from
the preceding module for peptide bond formation, and with the downstream C domain, or alternatively with the TE domain at the last mod-
ule of the NRPS template, to deliver the peptidyl moiety and free the Ppant for the next elongation cycle. Additionally, optional domains,
which also need to specifically interact with the amino acylated PCP, might be incorporated in the module. (B) Chemical structures of the
A-domain inhibitors used in this study (5¢-O-[N-(
L-phenyl)-sulfamoyl] adenosine) (1) and (5¢-O-[N-(L-prolyl)-sulfamoyl] adenosine) (2).
Biochemical studies of NRPS domain interactions J. Zettler and H. D. Mootz
1160 FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS
only on its post-translational state (apo or holo) but
also on the presence or absence of PCP-interacting
domains or external enzymes [8,16] (for reviews see
[17,18]). Besides these intradomain dynamics, different

intramodular positions of the PCP domain, relative to
other NRPS domains, seem likely considering the over-
all architecture of an NRPS module. Marahiel and
co-workers [19] recently reported a crystal structure of
the 144 kDa termination module, SrfA–C, involved in
the biosynthesis of surfactin, which is composed of
four domains (C-A-PCP-TE). In this structure, the
C domain and the A
N
form a structured platform onto
which the A
C
and the PCP domain are tethered. Fur-
thermore, this SrfA–C construct lacks the attachment
site of the Ppant group (S1003A mutant) and shows
the PCP on the acceptor site of the C-domain. The dis-
tance of the S1003A residue to the active-site histidine
of the C-domain is 16 A
˚
, making it within the reach of
the missing Ppant arm (capable of reaching 20 A
˚
dis-
tance at full linear extension). However, the distances
to the other catalytic centres of the SrfA–C module,
namely the A domain and the TE domain, are 57 and
43 A
˚
, respectively, too large to support the proposed
‘swinging arm model’. This model suggests that the

length and flexibility of the 18–20 A
˚
Ppant arm is itself
sufficient to translocate the intermediates into active
sites from a central position [20,21]. This finding sug-
gested that, in order to interact with another domain,
the PCP domain needs to translate relative to the
C–A
N
platform. Similar domain translocations have
been suggested for the fatty acid synthase acyl carrier
proteins, which share a similar four a-helix bundle
topology with the PCPs [22]. During catalysis, these
ACPs must travel distances of 50–80 A
˚
between the
active centers [23–25]. Although the conformational
changes of the PCP domains seem convincing and
were postulated in previous studies, to our knowledge
no direct biochemical evidence for these PCP move-
ments in a minimal elongation or initiation module
could be obtained until now.
In this work, we provide the first biochemical evi-
dence for conformational changes of the PCP domain
relative to the A domain, which were dependent on the
reaction stage of the latter in an NRPS initiation mod-
ule. We have investigated an A–PCP didomain model
construct by partial proteolytic digestion, gel filtration
and native gel electrophoresis, and studied the accessi-
bility of the sulfhydryl group of the Ppant-PCP from

the bulk solvent. Taken together, our results support
significant conformational changes in the crosstalk
between A domains and PCP domains that reflect dif-
ferent states of the PCP domain in the catalytic cycle
of an NRPS module.
Results
Amino acyl sulfamoyl adenosine inhibitors
induce conformational changes in the A-PCP
protein that are comparable to the effect of the
native substrates
To investigate conformational changes in a catalyti-
cally competent NRPS protein, we chose, as a model
protein, a truncated construct of gramicidin S synthe-
tase I (GrsA; EC 5.1.1.11), which consisted of the first
two functional domains, namely the phenylalanine-
specific A domain and the PCP domain. The terminal
E domain was excised (the exact amino acid composi-
tion of the investigated protein is shown in Fig. S1B).
With this protein, referred to herein as A-PCP, the
first two reaction steps shown in Fig. 1A can be
studied [26]. The latter reaction step must involve a
productive domain–domain interaction between the
A domain and the PCP domain. To trap the holo-
enzyme in such a conformation, the natural substrates
ATP and phenylalanine are not suitable because their
use would lead to the formation of the amino acyl
thioester on the Ppant of the PCP domain and prime
the enzyme for the next step in the reaction sequence.
Therefore, we turned to the sulfamoyl-based inhibi-
tor 1, which is a nonhydrolyzable analog of the phen-

ylalanyl adenylate (see Fig. 1B) and probably arrests
the enzyme in a state destined for the productive
interaction. Previous studies determined the K
i
values
of this inhibitor class to be in the nanomolar range
[27,28]; hence, NRPS A domains bind these cognate
inhibitors around two to three orders of magnitude
more tightly than their amino acid or ATP substrates
[29].
We first aimed to establish that binding of 1 induced
similar effects on the conformation of the A domain in
solution as the substrates ATP and l-Phe. To this end,
we used a partial proteolytic digest, previously
reported by Dieckmann et al. [30] for the investigation
of the highly homologous protein tyrocidine synthetase
I (TycA) in its apo-form. They found that the addition
of the substrates slowed down the proteolysis of the
protein, mostly by decreasing the rate of cleavage
between the two subdomains of the A domain. These
findings were later explained with the structural model
that the smaller subdomain A
C
of the A domain
rotates upon substrate binding and changes from an
open conformation to a more compact one [11,12].
To identify the resulting protein fragments obtained
from the partial tryptic digest, we performed in-gel
tryptic digests and subsequent MALDI-TOF MS of
the major protein bands (see Table S1). Additionally,

J. Zettler and H. D. Mootz Biochemical studies of NRPS domain interactions
FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS 1161
we prepared a tetramethyl-rhodamine (TAMRA)-
loaded holo-protein through the Sfp-catalyzed reaction
of TAMRA-CoA with apo-A-PCP [31–33] (see the
Materials and methods). Because of the fluorescent
labeling of the PCP domain, the PCP-containing frag-
ments of the tryptic digest (A
C
-PCP and PCP) can be
visualized under UV illumination (see Fig. S3). In
agreement with this previous work [30], we found that
trypsin cleaved the apo-A-PCP construct predomi-
nantly between the two subdomains of the A domain
(see Fig. S2). The addition of the substrates ATP and
l-Phe dramatically changed the susceptibility of the
apo-protein to proteolysis by decreasing the rate of
cleavage, indicating that the complex with the amino
acyl adenylate shows less accessibility for the protease-
recognition sites at the solvent-exposed linkers (see
Fig. S2). Control reactions revealed that addition of
pyrophosphate, AMP, or ATP alone changed neither
the rate nor the pattern of the proteolysis to a detect-
able extent (data not shown). The latter finding also
indicated that the protein preparations used in this
study were free of residual bound phenylalanine [34].
Addition of l-Phe slowed down the rate of the proteol-
ysis, an effect that was enhanced in the additional
presence of AMP and the nonhydrolyzable ATP
analog adenosine-5¢-[(a,b)-methyleno] triphosphate

(ApCpp) (data not shown).
A comparison of the effect of compound 1 with that
of the natural substrates ATP and l-Phe on the apo-
and holo-forms of the A-PCP construct in the partial
tryptic digest is shown in Fig. 2. The apo-form and the
holo-form yielded similar results in this assay, but sig-
nificant differences were observed in the absence of
substrates (Fig. 2A), and in the presence of ATP and
l-Phe or compound 1 (Fig. 2B & C, respectively). The
addition of 1 resulted in tryptic digest patterns that
were qualitatively similar to those observed for ATP
and l-Phe addition (compare Fig. 2B and 2C). Inter-
estingly, however, we had to increase the amount of
trypsin four-fold to observe a reasonable degree of
degradation in the former case. These findings indi-
cated, within the resolution of this assay, that 1
induced the same conformational changes as the sub-
strates ATP and l-Phe, and is therefore suitable to
mimic the amino acyl adenylate. The significantly
higher resistance to proteolysis of the protein–inhibitor
complex could be a result of the low K
i
=61nm of
compound 1 [27] that results in a more effective freez-
ing of the conformation of the A domain in a com-
pact, closed state. As the inhibitor lacks the b and c
phosphate groups, and release of the pyrophosphate
(PP
i
) is believed to precede domain alternation from

the adenylation into the thioester conformation, this
closed state is probably the thioester-forming confor-
mation [13].
Although similar digest patterns were observed for
the apo- and holo-forms of A–PCP we cannot rule out
a potentially different orientation or localization of the
PCP domain relative to the A domain from these
results. The trypsin assay is probably not suitable to
resolve such differences because the effect of the modi-
fication on the susceptibility of trypsin-cleavage sites
between the two domains might be too small. Further-
more, the fast degradation of the A domain into the
two subdomains in the absence of substrates compli-
cated quantitative interpretations with regard to the
cleavage site(s) between the A domain and the PCP
domain, because a PCP-domain fragment can originate
from a complete didomain protein or from a previ-
ously generated A
C
-PCP fragment.
Evidence for different conformational states of
the PCP domain relative to the A domain
obtained from native PAGE and gel-filtration
analysis
Next, we developed new assays, based on native
PAGE and gel-filtration analysis, to monitor larger
conformational changes, such as those predicted from
the domain-alternation mechanism [12,13] in the
A-PCP protein. In contrast to the partial tryptic digest,
these assays leave the protein intact. Native PAGE can

resolve different conformational states of a protein if
these states exhibit different electrophoretic mobilities
and are sufficiently stable under the electrophoretic
conditions used. Similarly, conformational changes can
be monitored via gel-filtration experiments if the over-
all size and shape of the protein changes. Before the
analysis, we incubated the apo- and the holo-forms of
the A-PCP protein with inhibitor 1, or without any
ligand. As shown in Fig. 3, in the absence of ligands
the electrophoretic mobility in native PAGE was
slightly higher for the holo-form than for the apo-form
(left lanes). This difference might reflect minor confor-
mational changes but could also be explained by con-
sidering the different chemical composition of the
proteins. Modification with Ppant introduces an extra
negative charge into the protein, which should result in
a higher electrophoretic mobility (the calculated charge
of the apo-protein under the conditions of the native
PAGE is approximately )20). Gel-filtration experi-
ments supported the latter explanation because the
apo-protein and the holo-protein eluted within the
error margins at identical retention times (see Table 1;
see Fig. S5 for representative gel-filtration chromato-
grams). Importantly, pre-incubation of the proteins
Biochemical studies of NRPS domain interactions J. Zettler and H. D. Mootz
1162 FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS
with the cognate inhibitor 1 changed the migration
and retention behaviors of the complexes compared
with the free proteins in the native PAGE and in the
gel-filtration assays, respectively. The binding of 1 to

the A domain was tight enough to survive both sepa-
ration processes (data not shown). In the native
PAGE, both complexes with the inhibitor, apo- and
holo-, migrated significantly faster than the ligand-free
protein (Fig. 3, middle lanes). In the gel-filtration anal-
ysis, the complexes clearly eluted later (see Table 1).
Thus, the binding of 1 seemed to cause a conforma-
tional change leading to a more compact folding of
A-PCP. This conformational change probably includes
the closing of the A
C
subdomain relative to the A
N
subdomain, previously suggested in the literature
[12,13] and in agreement with our data from the par-
tial proteolytic digests. The native PAGE assay and
the gel-filtration analysis are thus useful means to
monitor these changes with intact proteins in solution.
Furthermore, a close inspection of the results showed
differences between the apo-protein and the holo-pro-
tein. Interestingly, the presence of 1 led to a larger
increase in the electrophoretic mobility of the holo-
form compared to the effect seen for the apo-form
(Fig. 3, compare left and middle lanes). Likewise, in
the gel-filtration experiments the elution volume of the
holo-protein in the presence of 1 was significantly lar-
ger than the corresponding value of the apo-form in
the presence of 1 (t-test with a significance level of
5%). The calculated shift differences to higher elution
A

B
C
Fig. 2. Partial tryptic digests of apo-A-PCP
and holo-A-PCP under different conditions.
Digests are shown for the apo-A-PCP (left)
and holo-A-PCP (right). (A) Reactions were
performed in the absence of substrates at a
protein ⁄ protease ratio of 250:1 (w ⁄ w), (B)
under saturating conditions (2 m
M each) of
ATP and
L-Phe at a protein ⁄ protease ratio of
100:1 (w ⁄ w), and (C) in the presence of
inhibitor 1 (100 l
M) at a protein ⁄ protease
ratio of 25 : 1 (w ⁄ w).
J. Zettler and H. D. Mootz Biochemical studies of NRPS domain interactions
FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS 1163
volumes were 0.172 ± 0.034 mL for the apo-A-PCP
and 0.209 ± 0.029 mL for the holo-A-PCP. Taken
together, these findings suggest that binding of the
inhibitor to the holo-form caused an additional confor-
mational change that further decreased the Stokes’
radius of the protein compared with the apo-form.
This conformational change could be the result of the
PCP adopting a different position relative to the
A domain where the Ppant moiety is positioned to
reach the amino acyl adenylate and renders the overall
structure of the protein more compact. This interpreta-
tion is in accordance with the logic of the nonriboso-

mal synthesis that only a Ppant-PCP is a substrate for
an A domain and also with the idea that binding of
the PCP to the A domain in a productive manner
increases the compactness of the protein.
Further control reactions with a noncognate inhibi-
tor 2 of the A domain [(5¢-O-[N-(L-prolyl)-sulfamoyl]
adenosine) see Fig. 1B] showed that this molecule had
no effect either on the electrophoretic mobilities in
native PAGE (Fig. 3, compare left and right lanes) or
on the elution volume in the gel filtration (see
Table 1). Furthermore, a similar construct from a
truncated proline-activating module, tyrocidin synthe-
tase II (TycB1), A
Pro
-PCP, was subjected to native
PAGE after incubation with 1 or 2. In this case, only
inhibitor 2 changed the electrophoretic mobility of this
didomain protein (data not shown). Pre-incubation of
apo-A-PCP and holo-A-PCP with l-Phe, together with
ATP, AMP or ApCpp, did not change the electropho-
retic mobilities of the proteins in the native PAGE
(data not shown), presumably because the complexes
formed are not stable under the electrophoretic condi-
tions.
Chemical modification reveals different spatial
localizations of the Ppant, depending on the reac-
tion state of the A domain
The model deduced from the above results suggested
that the inhibitor 1 induced a significant conforma-
tional change that leads to a compact holo-A-PCP

protein. Here, the holo-PCP domain interacts in a pro-
ductive way with the A domain. We decided to further
test this model through the use of thiol-modifying
agents. In the productive conformation the Ppant is in
the active site and therefore its thiol-group should be
less accessible to the bulk solvent compared with a
conformation in which the PCP is not destined to
interact with the A domain. A less-accessible Ppant
moiety should be less prone to chemical modification
by thiol-modifying agents and therefore react more
slowly. To avoid undesired background labeling of
sulfhydryl groups of cysteines, we first eliminated all
cysteines in the protein by site-directed mutagenesis.
The PCP domain in our construct was free of cyste-
ines; however, the A domain of GrsA contained four
cysteine residues. A sequence alignment with related
A domains revealed that two cysteine residues (Cys60
and Cys331) are not conserved in related A domains.
We mutated Cys60 to phenylalanine because this is the
most prominent residue at this position in the closely
related A domains of the tyrocidine and bacitracin
NRPS. Cys331 is part of the binding pocket of the
amino acid in the active site [11]. The mutation
Cys331Leu decreased the activity of the isolated GrsA
A domain to 26% compared with the wild-type protein
[35]. We performed the mutation Cys331Ala, which
probably does not alter the activity or the specificity
dramatically. Cys376 is part of the sequence motif A6
and is conserved among NRPS A domains [2]. How-
ever, mutation of the corresponding cysteine residue to

serine in the highly homologous TycA NRPS had no
Table 1. Elution volumes and apparent molecular weights of
different incubated A-PCP constructs in gel-filtration experiments.
Protein Elution volume (mL) m
apparent
(kDa)
apo-A-PCP 14.560 ± 0.028 74.2
holo-A-PCP 14.567 ± 0.023 73.9
apo-A-PCP + 1 14.732 ± 0.019 67.8
holo-A-PCP + 1 14.776 ± 0.017 66.3
apo-A-PCP + 2 14.567 ± 0.013 73.9
holo-A-PCP + 2 14.551 ± 0.015 74.5
Fig. 3. Electrophoretic mobility of A-PCP monitored by native
PAGE. A-PCP in the apo-form and in the holo-form was pre-incu-
bated without inhibitor or with compounds 1 and 2 (at 100 l
M
each) and then subjected to native PAGE. The gel was stained with
Coomassie Brilliant Blue. Inh., inhibitor.
Biochemical studies of NRPS domain interactions J. Zettler and H. D. Mootz
1164 FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS
effect on activity in previous studies [36]. Therefore,
we also introduced a serine at this position. Finally,
Cys473 is located in the subdomain A
C
of the
A domain and is moderately conserved. Tyrosine and
alanine are the other amino acids frequently found at
this position; therefore, the mutation Cys473Ala was
used.
Introduction of the four mutations (C60F, C331A,

C376S and C473A) had little effect on the activity of
the A domain, as determined by the ATP ⁄ PP
i
exchange assay. As shown in Table 2, the K
m
of the
resulting construct A-PCP(D-4Cys) for l-Phe was
increased by  two-fold, while the k
cat
was reduced by
 1.5-fold. Importantly, the mutant protein, A-PCP
(D-4Cys), also showed a tryptic digest pattern compa-
rable to the reference construct A-PCP (data not
shown) and behaved similarly in native PAGE as the
reference construct (see Fig. S4). Together, these
results indicated that the four mutations in A-PCP
(D-4Cys) had only a minor effect and thus this protein
was suitable for our studies.
The only thiol group in holo-A-PCP(D-4Cys) belongs
to the Ppant moiety. Addition of fluorescein-maleimide
and fluorescein-iodacetamide showed fast and quantita-
tive labeling, both when the protein was pre-incubated
with inhibitor 1 as well as in the absence of the small
molecule, indicating that the reactions were too fast to
observe any differences (data not shown). We therefore
tested the chemically less reactive and sterically more
demanding Texas-Red bromoacetamide, which indeed
resulted in differences in labeling velocity (see Fig. 4).
The degree of labeling was determined from the inten-
sity of the fluorescent signal on an SDS ⁄ PAGE gel. MS

analysis confirmed that the chemical labeling took place
at the Ppant moiety (see Fig. S6A). The chemical modi-
fication with the fluorophore proceeded most quickly
for holo-A-PCP(D-4Cys), without any ligands, and was
used as a relative reference. In striking contrast, in the
presence of 1, the labeling reaction occurred at a signifi-
cantly slower rate (compare lanes 2 and 3 in Fig. 4A at
the different reaction time-points and see Fig. 4B for
the time-courses of the reactions). Substitution of 1
with substrates ATP and l-Phe led to only a low degree
of labelling, which was consistent with the formation of
the l-Phe-thioester blocking the Ppant group. Each of
the two substrates alone decreased the labeling velocity
only slightly, with l-Phe having a slightly stronger
effect than ATP. This finding is in agreement with the
observed effect of these substrates in our partial
proteolysis experiments (see above). A negative control
with the noncognate inhibitor 2 showed that this
molecule had no effect. In another negative control,
incubation of apo-A-PCP(D-4Cys) with Texas-Red
bromoacetamide resulted only in the expected back-
ground incorporation of the fluorophore, presumably
because of minor unspecific reactions of the bromo-
acetamide with other residues such as His or Met side
chains.
We conducted a further control experiment to rule
out another possible mechanism of chemical labeling
of the Ppant thiol group. Given a potential affinity of
the aromatic fluorophore to the ATP-binding pocket,
Table 2. Kinetic parameters of the ATP-PP

i
exchange reaction for
L-Phe.
Enzyme K
m
(lM) k
cat
(min
)1
)
A-PCP (reference) 6.2 ± 0.7 23 ± 1
A-PCP(D-4Cys) 14.6 ± 0.8 15 ± 1
A
B
Fig. 4. Chemical labeling of apo-A-PCP(D-4Cys) and holo-A-PCP
(D-4Cys) with Texas-Red
â
C
5
Bromoacetamide. (A) A representa-
tive SDS gel of the labeling reaction at different time-points under
UV-light (top) and stained with Coomassie Brilliant Blue (below).
Lane 1: apo-A-PCP(D-4Cys); lane 2: holo-A-PCP(D-4Cys); lane 3:
holo-A-PCP(D-4Cys) + 100 l
M 1; lane 4: holo-A-PCP(D-4Cys) + 7.5
m
M ATP and L-Phe; lane 5: holo-A-PCP(D-4Cys) + 100 lM 2.
(B) Densitometric analysis of band intensities after normalization
with the total protein content.
J. Zettler and H. D. Mootz Biochemical studies of NRPS domain interactions

FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS 1165
as observed for the smaller fluorescein [37], it was con-
ceivable that the alkylation reaction itself took place in
the active site of the A domain (instead of in the freely
accessible solvent). In this case, the effect of inhibitor 1
would only be competitive (displacing the labeling
reagent) and conclusions would be complicated. As a
control we therefore performed the labeling assay in
the absence of inhibitor or substrates, but in the pres-
ence of increasing amounts of the free Texas-Red
fluorophore, which should compete with the Texas-
Red bromoacetamide for the binding site and slow
down the modification reaction. However, the addition
of up to 16 eq. of Texas-Red (compared with the label-
ing reagent) had no influence on the reaction velocity
of the labeling reaction (see Fig. S6B), thus excluding
this alternative interpretation.
From these experiments it cannot be completely
ruled out that the difference in accessibility of the
Ppant thiol group for the chemical labeling reagent
was a result of alternative pathways (e.g. the opening
and closing of protein channels leading to the active
site without the necessity of PCP movement). How-
ever, considering the bulkiness of the labeling reagent,
such an interpretation seems very unlikely. Taken
together, these results support the idea that the Ppant
sulfhydryl group is in two distinct locations, which are
dependent on the reaction stage of the A domain.
Discussion
The interaction of the PCP with its neighbouring

domains in NRPS systems is crucial in the catalytic
cycle and in the directed product assembly in these
complex biosynthetic machineries. How these interac-
tions are controlled has just recently begun to emerge
and the complete picture is still far from being under-
stood. Mutational analysis, Ala-scanning mutagenesis
and directed protein evolution determined the residues
participating in the recognition interfaces on the PCP
domain for the interaction with the Ppant transferase,
adjacent TE domain and upstream C domain [38–41].
The same techniques were used to investigate the rec-
ognition interface of PCP domains with in trans-acting
A domains of siderophore-producing NRPS and
revealed a region of about eight amino acids N-termi-
nal to the Ppant attachment site as part of this interac-
tion [39]. Interactions of the PCP domain with the TE
domain, as well as the trans-acting Ppant transferase
and TEII enzymes, were also studied by NMR spec-
troscopy [8,16–18]. These latter studies showed that
the PCP domain is intrinsically mobile and can adopt
multiple conformations, also dependent on the pres-
ence or absence of its post-translational modification.
For the interaction with another domain or external
enzyme, one of these pre-existing conformational states
is selected and stabilized. It can be assumed that such
conformational changes also play an important role in
the productive interaction between the A domain and
the PCP domain.
The recently reported crystal structure of a termina-
tion module from the surfactin NRPS, consisting of

the domains C-A-PCP-TE, suggested that a movement
of the PCP is required to bridge the 57 A
˚
distance
between the Ppant attachment site on the PCP and the
catalytic centre of the A domain; too far for the 18–
20 A
˚
Ppant moiety [19]. This structure also revealed a
long linker of 15 amino acids, with little secondary
structure, between the A domain and the PCP, which
probably allows the PCP to travel between different
catalytic centres. In fact, this linker constituted the
only connection between the two domains in the
observed structure as there is no common protein–
protein interaction surface. A potential caveat for the
interpretation of these structural findings is that the
investigated termination module was crystallized in its
inactive apo-form and that it provides only a single
snapshot during the catalytic cycle.
In this work, we have therefore collected biochemi-
cal data from catalytically competent proteins in solu-
tion. Our key findings are that (a) in our holo-A-PCP
protein the thiol group of the Ppant cofactor can be
present in at least two different environments that
strongly differ in terms of the accessibility from bulk
solvent, and that (b) the switch between these two
positions is dependent on the reaction stage of the
A domain. In the enzyme primed for amino acyl trans-
fer, the Ppant thiol group is more shielded from the

solvent. Based on these data, we propose the following
model. Binding of inhibitor 1 induces the thioester
conformation of the A domain, and the solvent-
protected Ppant thiol points simultaneously into the
catalytic centre of the A domain awaiting amino acyl
transfer. To adopt this conformation, the PCP domain
has to dock on the A domain in an orientation
whereby the Ppant attachment site faces the channel
for this prosthetic group. This specific conformation of
the two domains is a highly compact form observed
for the holo-form in our native PAGE and gel-filtra-
tion analyses. In contrast, in the absence of inhibitor 1,
the Ppant moiety is labeled significantly faster,
probably because it is oriented towards the bulk
solvent. This represents the open conformation of
the A domain. An open conformation of an A domain
was observed in the above-mentioned structure of the
C-A-PCP-TE module [19]. Here, the residue corre-
sponding to the Ppant attachment site points away
Biochemical studies of NRPS domain interactions J. Zettler and H. D. Mootz
1166 FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS
from the A domain, consistent with the idea that the
Ppant arm should be accessible to bulk solvent.
Furthermore, we collected evidence that the apo-PCP
domain does not interact in the same way with an
A domain poised for thioester formation, as if the bind-
ing interface between A and PCP domains is only cre-
ated for the holo-PCP. This would be in agreement with
a critical contribution of the Ppant in the interaction of
A and PCP domains, as well as with the model of differ-

ent conformational states of the PCP domain predicting
that only one holo-state can support the binding to the
A domain [17]. However, because this interpretation is
based on the difficult-to-resolve differences observed in
assays that only interrogate the globular structure of
the proteins, alternative techniques will be required in
the future to further investigate this point.
Taken together, this work presents, to our knowl-
edge, the first biochemical evidence that changing the
reaction stage of the A domain (achieved by binding
of an inhibitor) affects the relative conformation of the
in cis interacting PCP domain. It is conceivable that
most of this change is coordinated through a common
movement with the A
C
subdomain during the closing
of the subdomains. However, the flexible linker
between the A
C
subdomain and the PCP domain, and
the absence of a contact surface between these two
folded units [19], argue for a certain degree of flexibil-
ity and mobility of the PCP domain relative to the
A domain. Understanding these conformational changes
with higher atomic resolution will require further
structural or spectroscopic studies using catalytically
competent proteins. We used a tightly binding inhibi-
tor of the A domain to achieve synchronization of the
protein ensemble. This strategy appears to be promis-
ing for capturing the proteins at the desired stage in

the reaction cycle. Recently, the synthesis of hydrolyti-
cally stable phosphopantetheinyl analogs was reported
[42]. These analogs might prove useful in fixing the
next reaction stage in the catalytic cycle of an initia-
tion or elongation module (i.e. the interactions
between the PCP and condensation or modifying
domains) in multidomain NRPS enzymes.
Materials and methods
General
Standard procedures were applied for PCR amplification,
purification of DNA fragments and cloning of recombinant
DNA [43]. Oligonucleotides were from Operon (Cologne,
Germany). Unless otherwise stated, chemicals were pur-
chased from Applichem GmbH (Darmstadt, Germany) and
Roth (Karlsruhe, Germany). Inhibitors 1 (5¢-O-[N-(l-phenyl)-
sulfamoyl] adenosine) and 2 (5¢-O-[N-(l-prolyl)-sulfamoyl]
adenosine) were kind gifts of M. Hahn and M. Marahiel
[27].
Plasmid construction
The gene fragment encoding GrsA A-PCP was PCR ampli-
fied from the genomic DNA of Bacillus brevis ATCC 9999
using the primers P1 (5¢- tatccatggtaaacagttctaaaagtatattg)
and P2 (5¢- tatagatctctcacttcttcttttactatc). The PCR product
was subcloned into a pQE60 vector using NcoI and BglII
sites to introduce a C-terminal His
6
-Tag. The NcoI–HindIII
fragment of this vector was then ligated into pET16b, result-
ing in vector pJZ06. Site-directed mutagenesis was performed
according to the Quick change protocol (Stratagene, La

Jolla, CA, USA). Plasmid pJZ06 served as a template for
two successive point mutations. C60F and C473A were intro-
duced using primers P4 (5¢-atgtagccattgtatttgaaaatgagcaact)
and P5 ( 5¢- agttgctcattttcaaatacaatggctacat), and P6 (5¢- gaacagc
cgtatttggccgcttattttgtatc) and P7 (5¢- gatacaaaataagcggccaaa
tacggctgttc), respectively, to give pJZ12. In the same manner,
the plasmid pJZ11, encoding the mutations C331A and
C376S, was generated using primers P8 (5¢-ccctacggaaacaac
gatcgctgcgactacatgggta) and P9 (5¢-tacccatgtagtcgcagcgatcg
ttgtttccgtaggg), and P10 (5¢-tgaagctggtgaattatcgattggtggagaa
ggg) and P11 (5¢-cccttctccaccaatcgataattcaccagcttca), respec-
tively. In order to combine all four mutations, an NdeI
fragment containing the two mutations was excised from
pJZ11 and ligated into pJZ12 to replace the corresponding
NdeI fragment. The resulting plasmid, pJZ13, encoded the
A-PCP(D-4Cys) construct. The correctness of the muta-
tions in pJZ13 was confirmed by DNA sequencing (GATC,
Konstanz, Germany) of the entire insert.
Protein overproduction
Escherichia coli BL21 (DE3) cells were transformed with
the expression plasmids described above. The expression
and purification of the C-terminally His
6
-tagged apo-pro-
teins were conducted as previously described [44]. As
judged by SDS ⁄ PAGE, the proteins could be purified to
apparent homogeneity by a single Ni
2+
-affinity chromatog-
raphy step. Fractions containing the recombinant proteins

were pooled and dialysed against assay buffer [50 mm HE-
PES (pH 8.0), 100 mm NaCl, 1 mm EDTA, 10 mm MgCl
2
].
After the addition of 10% glycerine, the proteins were
shock-frozen in liquid nitrogen and stored at )80 °C. The
protein concentrations were determined using the calculated
extinction coefficient at 280 nm.
Synthesis of TAMRA-CoA
The modification of CoA was carried out in accordance
with a previously reported protocol [45]. In short, 17.3 mg
J. Zettler and H. D. Mootz Biochemical studies of NRPS domain interactions
FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS 1167
CoA trilithium salt dihydrate (21 lmol, 2.1 eq.) was dis-
solved in 2 mL of a 100 mm phosphate buffer (pH 7.0).
Five milligrams of tetramethylrhodamine-5-maleimide
(10 lmol, 1 eq.; purchased from Anaspec Inc., Fremont,
CA, USA) was dissolved in 800 lL of dimethylsulfoxide.
The solutions were combined and the reaction mixture was
agitated at room temperature for 1 h in the dark followed
by purification with preparative HPLC on a reverse-phase
C18 column with a gradient of 5–50% acetonitrile in
0.05% trifluoracetic acid ⁄ water over 30 min. The purified
compound was lyophilized, and the identity was confirmed
by MALDI-TOF MS (negative mode): [M-H]
)
calculated
1247.3 gÆmol
)1
, observed 1247.5 gÆmol

)1
.
Post-translational modification of the enzymes
Conversion of the apo-enzymes into the holo-enzyme or the
Ppant-TAMRA modified form was carried out in vitro by
adding 40 eq. of CoA or 5 eq. of TAMRA-CoA in the pres-
ence of 10 mm MgCl
2
and 0.02 eq. of the Bacillus subtilis
Ppant-transferase Sfp [46] overnight at 4 °C. The excess of
CoA ⁄ TAMRA-CoA was removed through dialysis.
ATP-PP
i
exchange reaction
The ATP-PP
i
exchange assay was used to confirm the ade-
nylation domain activity [35]. Reaction mixtures (final vol-
ume 100 lL) contained 50 mm HEPES (pH 8.0), 100 mm
NaCl, 1 mm EDTA, 5 mm MgCl
2
, 400 nm apo-enzyme and
1 lm–10 mml-Phe. After 10 min of incubation at 37 °C,
the reaction was started by the addition of 5 mm ATP,
25 lm Na
4
P
2
O
7

and 0.015 lm Ci [
32
P-Na
4
P
2
O
7
] (Perkin
Elmer, Boston) and incubated at 37 °C for 45 s. Reactions
were quenched by adding 0.5 mL of a stop mix [1.2%
(w ⁄ v) activated charcoal, 0.1 m Na
4
P
2
O
7
and 0.35 m per-
chloric acid]. Subsequently, the charcoal was pelleted by
centrifugation, washed twice with 1 mL of water and resus-
pended in 0.5 mL of water. After the addition of 3.5 mL of
liquid scintillation fluid (Roth, Karlsruhe, Germany), the
charcoal-bound radioactivity was determined by liquid scin-
tillation counting using a 1900CA TriCarb liquid scintilla-
tion analyzer (Packard, Meriden, CT, USA). The measured
values were corrected using the value of the negative con-
trol (without amino acid) and the maximal counts of the
radioactive pyrophosphate used. Assuming that the amount
of radioactive PP
i

could be neglected compared with nonra-
dioactive PP
i
, the initial velocities of the reactions were cal-
culated. The obtained values were analysed using a
Michaelis–Menten approach.
Partial tryptic digest
The proteolysis reactions of the apo- and the holo-NRPS
proteins (6–12 lm) were performed in assay buffer at 37 °C
following a pre-incubation step of 10 min with substrates
(ATP and l-Phe at a final concentration of 1 mm) or inhib-
itors (final concentration 100 lm). The digest was started
with the addition of a trypsin solution (0.08 lgÆlL
)1
of
modified trypsin; Promega, Madison, WI, USA) at a final
protease ⁄ protein ratio of 1 : 250 (w ⁄ w). Aliquots were with-
drawn at different time-points and the digest was stopped
by the addition of SDS loading buffer. To yield a reason-
able digest in the presence of the cognate inhibitor 1, the
protease ⁄ protein ratio was raised to 1 : 25 (w ⁄ w). A control
experiment using the unrelated protein, Sfp, for digestion
with trypsin in the absence or presence of 1 ruled out that
trypsin itself might be inhibited by 1 (data not shown).
Native PAGE
Discontinuous native gel electrophoresis was performed
similarly to the standard Laemmli SDS ⁄ PAGE protocol,
only without SDS [47]. A 5% stacking gel and an 8% sepa-
ration gel were used. Before the loading buffer was added,
proteins were pre-incubated for 15 min at 37 °C with or

without substrates ⁄ inhibitors. The samples were not boiled
before loading on the gel.
Gel-filtration experiments
A Superdex 200 10 ⁄ 300 GL column (GE Healthcare, Chal-
font St Giles, UK) was equilibrated with assay buffer
[50 mm HEPES (pH 8.0), 100 mm NaCl, 1 mm EDTA,
2mm dithiothreitol, 10 mm MgCl
2
]. Following pre-incuba-
tion with or without inhibitors for 10 min at 37 °C, 200 lL
of a 20 lm protein solution was applied onto the column
and the absorption at 280 nm was recorded. Column cali-
bration was performed using the Gel Filtration Calibration
Kit – Low Molecular Weight (GE Healthcare).
Chemical labeling of holo-A-PCP(D-4Cys)
A 7.5-lm enzyme solution was mixed in assay buffer [50 mm
HEPES (pH 7.0), 100 mm NaCl, 1 mm EDTA, 10 mm
MgCl
2
] with 2 mm tris(2-carboxyethyl) phosphine (TCEP)
and either 1 mm of substrates (ATP and ⁄ or l-Phe) or
100 lm of the different inhibitors. This mixture was pre-incu-
bated for 10 min at 37 °C, and then incubated for 10 min at
25 °C. The reaction was started through the addition of 8 eq.
(compared to the enzyme) of Texas-Red C
5
Bromoacetamide
(purchased from Invitrogen, Carlsbad, CA, USA; 1 mm
stock solution in dimethylsulfoxide) and conducted at 25 °C.
Aliquots were withdrawn at various time-points and the

reaction was stopped with SDS ⁄ PAGE loading buffer
containing 20% (v ⁄ v) mercaptoethanol. The amount of
incorporated fluorophore was visualized by UV-illumination
of the resulting SDS gel and analysed densitometrically using
the program scion image (). The
Biochemical studies of NRPS domain interactions J. Zettler and H. D. Mootz
1168 FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS
values obtained were corrected for the intensities obtained
from the Coomassie Brilliant Blue-stained gels, which were
also analysed using scion image.
MALDI-TOF-MS analysis
After separation by SDS ⁄ PAGE, the protein band was
excised and incubated in 300 lL of washing solution
(200 mm NH
4
HCO
3
, 50% acetonitrile) for 30 min at 37 °C
in an Eppendorf tube under shaking conditions. The wash-
ing solution was removed and the gel band freeze-dried.
Approximately 10 lL of the digest solution (0.02 lgÆlL
)1
of modified Trypsin, 40 mm NH
4
HCO
3
, 10% acetonitrile,
pH 8.1) was added to the gel band and incubated at room
temperature for 45 min. After removal of a possible excess
of digest solution, the gel band was kept for 16–18h at

37 °C. Diffusion solution (10% acetonitrile, 1% trifluoro-
acetic acid; 15 lL) was added and the sample was ultra-
sonicated for 45 min. The resulting solution was applied to
MALDI-TOF-MS analysis.
Acknowledgements
We thank Martin Hahn and Mohamed Marahiel for
the kind gift of the sulfamoyl inhibitors, Helena Jan-
zen for help with statistical analysis and Tulika Dhar
for proof-reading of the manuscript. Funding was pro-
vided by the DFG and the Fonds der Chemischen
Industrie.
References
1 Perham RN (2000) Swinging arms and swinging
domains in multifunctional enzymes: catalytic machines
for multistep reactions. Annu Rev Biochem 69,
961–1004.
2 Marahiel MA, Stachelhaus T & Mootz HD (1997)
Modular Peptide Synthetases Involved in Nonribosomal
Peptide Synthesis. Chem Rev 97, 2651–2674.
3 Schwarzer D, Finking R & Marahiel MA (2003)
Nonribosomal peptides: from genes to products. Nat
Prod Rep 20, 275–287.
4 Fischbach MA & Walsh CT (2006) Assembly-line
enzymology for polyketide and nonribosomal Peptide
antibiotics: logic, machinery, and mechanisms. Chem
Rev 106, 3468–3496.
5 Mootz HD, Schwarzer D & Marahiel MA (2002) Ways
of assembling complex natural products on modular
nonribosomal peptide synthetases. Chembiochem 3,
490–504.

6 Keating TA, Marshall CG, Walsh CT & Keating AE
(2002) The structure of VibH represents nonribosomal
peptide synthetase condensation, cyclization and
epimerization domains. Nat Struct Biol 9, 522–526.
7 Weber T, Baumgartner R, Renner C, Marahiel MA &
Holak TA (2000) Solution structure of PCP, a proto-
type for the peptidyl carrier domains of modular
peptide synthetases. Structure 8, 407–418.
8 Koglin A, Mofid MR, Lohr F, Schafer B, Rogov VV,
Blum MM, Mittag T, Marahiel MA, Bernhard F &
Dotsch V (2006) Conformational switches modulate
protein interactions in peptide antibiotic synthetases.
Science 312, 273–276.
9 Bruner SD, Weber T, Kohli RM, Schwarzer D, Marah-
iel MA, Walsh CT & Stubbs MT (2002) Structural
basis for the cyclization of the lipopeptide antibiotic
surfactin by the thioesterase domain SrfTE. Structure
10, 301–310.
10 Samel SA, Wagner B, Marahiel MA & Essen LO (2006)
The thioesterase domain of the fengycin biosynthesis
cluster: a structural base for the macrocyclization of a
non-ribosomal lipopeptide. J Mol Biol 359 , 876–889.
11 Conti E, Stachelhaus T, Marahiel MA & Brick P (1997)
Structural basis for the activation of phenylalanine in
the non-ribosomal biosynthesis of gramicidin S. EMBO
J 16, 4174–4183.
12 Gulick AM (2009) Conformational Dynamics in the
Acyl-CoA Synthetases, Adenylation Domains of Non-
ribosomal Peptide Synthetases, and Firefly Luciferase.
ACS Chem Biol 4, 811–827.

13 Yonus H, Neumann P, Zimmermann S, May JJ,
Marahiel MA & Stubbs MT (2008) Crystal structure of
DltA. Implications for the reaction mechanism of
non-ribosomal peptide synthetase adenylation domains.
J Biol Chem 283, 32484–32491.
14 Gulick AM, Starai VJ, Horswill AR, Homick KM &
Escalante-Semerena JC (2003) The 1.75 A crystal struc-
ture of acetyl-CoA synthetase bound to adenosine-5¢-
propylphosphate and coenzyme A. Biochemistry 42,
2866–2873.
15 Reger AS, Wu R, Dunaway-Mariano D & Gulick AM
(2008) Structural characterization of a 140 degrees
domain movement in the two-step reaction catalyzed
by 4-chlorobenzoate:CoA ligase. Biochemistry 47,
8016–8025.
16 Frueh DP, Arthanari H, Koglin A, Vosburg DA,
Bennett AE, Walsh CT & Wagner G (2008) Dynamic
thiolation-thioesterase structure of a non-ribosomal
peptide synthetase. Nature 454, 903–906.
17 Koglin A & Walsh CT (2009) Structural insights into
nonribosomal peptide enzymatic assembly lines.
Nat Prod Rep 26, 987–1000.
18 Weissman KJ & Muller R (2008) Protein-protein inter-
actions in multienzyme megasynthetases.
Chembiochem
9, 826–848.
19 Tanovic A, Samel SA, Essen LO & Marahiel MA
(2008) Crystal structure of the termination module of a
nonribosomal peptide synthetase. Science 321, 659–663.
J. Zettler and H. D. Mootz Biochemical studies of NRPS domain interactions

FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS 1169
20 Kleinkauf H & von Dohren H (1987) Biosynthesis of
peptide antibiotics. Annu Rev Microbiol 41, 259–289.
21 Kleinkauf H & von Dohren H (1990) Nonribosomal
biosynthesis of peptide antibiotics. Eur J Biochem 192,
1–15.
22 Holak TA, Kearsley SK, Kim Y & Prestegard JH
(1988) Three-dimensional structure of acyl carrier pro-
tein determined by NMR pseudoenergy and distance
geometry calculations. Biochemistry 27, 6135–6142.
23 Jenni S, Leibundgut M, Boehringer D, Frick C,
Mikolasek B & Ban N (2007) Structure of fungal fatty
acid synthase and implications for iterative substrate
shuttling. Science 316, 254–261.
24 Maier T, Jenni S & Ban N (2006) Architecture of mam-
malian fatty acid synthase at 4.5 angstrom resolution.
Science 311, 1258–1262.
25 Maier T, Leibundgut M & Ban N (2008) The crystal
structure of a mammalian fatty acid synthase. Science
321, 1315–1322.
26 Stachelhaus T & Marahiel MA (1995) Modular struc-
ture of peptide synthetases revealed by dissection of
the multifunctional enzyme GrsA. J Biol Chem 270 ,
6163–6169.
27 Finking R, Neumuller A, Solsbacher J, Konz D,
Kretzschmar G, Schweitzer M, Krumm T & Marahiel
MA (2003) Aminoacyl adenylate substrate analogues
for the inhibition of adenylation domains of nonriboso-
mal peptide synthetases. Chembiochem 4, 903–906.
28 Ferreras JA, Ryu JS, Di Lello F, Tan DS & Quadri LE

(2005) Small-molecule inhibition of siderophore biosyn-
thesis in Mycobacterium tuberculosis and Yersinia
pestis. Nat Chem Biol 1, 29–32.
29 Cisar JS, Ferreras JA, Soni RK, Quadri LE & Tan DS
(2007) Exploiting ligand conformation in selective inhi-
bition of non-ribosomal peptide synthetase amino acid
adenylation with designed macrocyclic small molecules.
J Am Chem Soc 129, 7752–7753.
30 Dieckmann R, Pavela-Vrancic M, von Dohren H &
Kleinkauf H (1999) Probing the domain structure and
ligand-induced conformational changes by limited pro-
teolysis of tyrocidine synthetase 1. J Mol Biol 288,
129–140.
31 La Clair JJ, Foley TL, Schegg TR, Regan CM &
Burkart MD (2004) Manipulation of carrier proteins
in antibiotic biosynthesis. Chem Biol 11, 195–201.
32 George N, Pick H, Vogel H, Johnsson N & Johnsson K
(2004) Specific labeling of cell surface proteins with
chemically diverse compounds. J Am Chem Soc 126 ,
8896–8897.
33 Yin J, Liu F, Li X & Walsh CT (2004) Labeling
proteins with small molecules by site-specific post-
translational modification. J Am Chem Soc 126,
7754–7755.
34 Miller LM, Mazur MT, McLoughlin SM & Kelleher
NL (2005) Parallel interrogation of covalent intermedi-
ates in the biosynthesis of gramicidin S using high-
resolution mass spectrometry. Protein Sci 14,
2702–2712.
35 Stachelhaus T, Mootz HD & Marahiel MA (1999)

The specificity-conferring code of adenylation domains
in nonribosomal peptide synthetases. Chem Biol 6,
493–505.
36 Gocht M & Marahiel MA (1994) Analysis of core
sequences in the D-Phe activating domain of the multi-
functional peptide synthetase TycA by site-directed
mutagenesis. J Bacteriol 176, 2654–2662.
37 Pavela-Vrancic MPE, Schro
¨
der W, von Do
¨
hren H &
Kleinkauf H (1994) Identification of the ATP Binding
Site in Tyrocidine Synthetase 1 by Selective Modifica-
tion with Fluorescein 5¢-Isothiocyanate. J Biol Chem
269, 14962–14966.
38 Mofid MR, Finking R & Marahiel MA (2002) Recogni-
tion of hybrid peptidyl carrier proteins ⁄ Acyl carrier
proteins in nonribosomal peptide synthetase modules by
the 4 ‘-phophopantetheinyl transferases AcpS and Sfp.
J Biol Chem 277, 17023–17031.
39 Zhou Z, Lai JR & Walsh CT (2007) Directed evolution
of aryl carrier proteins in the enterobactin synthetase.
Proc Natl Acad Sci U S A 104, 11621–11626.
40 Lai JR, Fischbach MA, Liu DR & Walsh CT (2006)
Localized protein interaction surfaces on the EntB car-
rier protein revealed by combinatorial mutagenesis and
selection. J Am Chem Soc 128 , 11002–11003.
41 Lai JR, Fischbach MA, Liu DR & Walsh CT (2006)
A protein interaction surface in nonribosomal peptide

synthesis mapped by combinatorial mutagenesis and
selection. Proc Natl Acad Sci U S A 103, 5314–5319.
42 Liu Y & Bruner SD (2007) Rational manipulation of
carrier-domain geometry in nonribosomal peptide
synthetases. Chembiochem 8, 617–621.
43 Sambrook J, Fritsch EF & Maniatis T (1989) Molecular
Cloning: A Laboratory Manual. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
44 Stachelhaus T, Mootz HD, Bergendahl V & Marahiel
MA (1998) Peptide bond formation in nonribosomal
peptide biosynthesis - Catalytic role of the condensation
domain. J Biol Chem 273, 22773–22781.
45 Yin J, Straight PD, McLoughlin SM, Zhou Z, Lin
AJ, Golan DE, Kelleher NL, Kolter R & Walsh CT
(2005) Genetically encoded short peptide tag for
versatile protein labeling by Sfp phosphopantetheinyl
transferase. Proc Natl Acad Sci U S A 102,
15815–15820.
46 Reuter K, Mofid MR, Marahiel MA & Ficner R (1999)
Crystal structure of the surfactin synthetase-activating
enzyme Sfp: a prototype of the 4 ‘-phosphopantetheinyl
transferase superfamily. EMBO J 18, 6823–6831.
47 Laemmli UK (1970) Cleavage of Structural Proteins
during Assembly of Head of Bacteriophage-T4. Nature
227, 680–685.
Biochemical studies of NRPS domain interactions J. Zettler and H. D. Mootz
1170 FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS
Supporting information
The following supplementary material is available:
Fig. S1. Structures of the ANL superfamily.

Fig. S2. Partial tryptic digest of apo-A-PCP.
Fig. S3. Partial tryptic digests of Ppant-TAMRA mod-
ified A-PCP.
Fig. S4. Electrophoretic mobility of A-PCP(D-4Cys)
monitored by native PAGE.
Fig. S5. Gelfiltration runs of apo- and holo-A-PCP(D-
4Cys).
Fig. S6. Control experiments of the chemical labeling
reaction.
Table S1. Identification of the protein fragments result-
ing from the partial tryptic digest in solution.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
J. Zettler and H. D. Mootz Biochemical studies of NRPS domain interactions
FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS 1171