Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc

Aspergillus nidulans a-galactosidase of glycoside
hydrolase family 36 catalyses the formation of
a-galacto-oligosaccharides by transglycosylation
Hiroyuki Nakai
1
, Martin J. Baumann
1
, Bent O. Petersen
2
, Yvonne Westphal
3
, Maher Abou Hachem
1
,
Adiphol Dilokpimol
1
, Jens Ø. Duus
2
, Henk A. Schols
3
and Birte Svensson
1
1 Enzyme and Protein Chemistry, Department of Systems Biology, Technical University of Denmark, Lyngby, Denmark
2 Carlsberg Laboratory, Valby, Denmark
3 Laboratory of Food Chemistry, Wageningen University, The Netherlands
Keywords
acceptor specificity; carbohydrate structural
analysis; transglycosylation; a-galacto-
oligosaccharides; a-galactosidase
Correspondence
B. Svensson, Enzyme and Protein

Chemistry, Department of Systems Biology,
Technical University of Denmark, Søltofts
Plads, Building 224, DK-2800 Kgs. Lyngby,
Denmark
Fax: +45 4588 6307
Tel: +45 4525 2740
E-mail:
(Received 17 May 2010, revised 2 July
2010, accepted 5 July 2010)
doi:10.1111/j.1742-4658.2010.07763.x
The a-galactosidase from Aspergillus nidulans (AglC) belongs to a phyloge-
netic cluster containing eukaryotic a-galactosidases and a-galacto-oligosac-
charide synthases of glycoside hydrolase family 36 (GH36). The
recombinant AglC, produced in high yield (0.65 gÆL
)1
culture) as His-tag
fusion in Escherichia coli, catalysed efficient transglycosylation with
a-(1 fi 6) regioselectivity from 40 mm 4-nitrophenol a-d-galactopyranoside,
melibiose or raffinose, resulting in a 37–74% yield of 4-nitrophenol
a-d-Galp-(1 fi 6)-d-Galp, a-d-Galp-(1 fi 6)-a-d-Galp-(1 fi 6)-d-Glc p and
a-d-Galp-(1 fi 6)-a-d-Galp-(1 fi 6)-d-Glcp-(a1 fi b2)-d-Fruf (stachyose),
respectively. Furthermore, among 10 monosaccharide acceptor candidates
(400 mm) and the donor 4-nitrophenol a-d-galactopyranoside (40 mm),
a-(1 fi 6) linked galactodisaccharides were also obtained with galactose, glu-
cose and mannose in high yields of 39–58%. AglC did not transglycosylate
monosaccharides without the 6-hydroxymethyl group, i.e. xylose, l-arabi-
nose, l-fucose and l-rhamnose, or with axial 3-OH, i.e. gulose, allose, altrose
and l-rhamnose. Structural modelling using Thermotoga maritima
GH36
a-galactosidase as the template and superimposition of melibiose from the

complex with human GH27 a-galactosidase supported that recognition at
subsite +1 in AglC presumably requires a hydrogen bond between 3-OH
and Trp358 and a hydrophobic environment around the C-6 hydroxymethyl
group. In addition, successful transglycosylation of eight of 10 disaccharides
(400 mm), except xylobiose and arabinobiose, indicated broad specificity for
interaction with the +2 subsite. AglC thus transferred a-galactosyl to 6-OH
of the terminal residue in the a-linked melibiose, maltose, trehalose, sucrose
and turanose in 6–46% yield and the b-linked lactose, lactulose and cello-
biose in 28–38% yield. The product structures were identified using
NMR and ESI-MS and five of the 13 identified products were novel,
i.e. a-d-Galp-(1 fi 6)-d-Manp; a-d-Galp-(1 fi 6)-b-d-Glcp-(1 fi 4)-d-Glcp;
a-d-Galp-(1 fi 6) -b-d-Galp-( 1 fi 4)-d-Fruf; a-d-Ga lp-(1 fi 6)-d-Glcp-( a1 fi a1)-
d-Glcp; and a-d-Galp-(1 fi 6)-
a-d-Glcp-(1 fi 3)-d-Fruf.
Abbreviations
AglC, a-galactosidase from Aspergillus nidulans; GalA, a-galactosidase from Thermotoga maritima; GH, glycoside hydrolase family;
HPAEC-PAD, high-performance anion-exchange chromatography equipped with pulsed amperometric detection; pNP, 4-nitrophenol;
pNPaAra, 4-nitrophenyl a-
L-arabinopyranoside; pNPaAraf, 4-nitrophenyl a-L-arabinofuranoside; pNPaGal, 4-nitrophenyl a-D-galactopyranoside;
pNPaGalNAc, 4-nitrophenyl N-acetyl a-
D-galactosaminiside; pNPaGlc, 4-nitrophenyl a-D-glucopyranoside; pNPaGlcNAc, 4-nitrophenyl N-acetyl
a-
D-glucosaminiside; pNPaMan, 4-nitrophenyl a-D-mannopyranoside; pNPaRha, 4-nitrophenyl a-L-rhamnopyranoside; pNPaXyl, 4-nitrophenyl
a-
D-xylopyranoside; pNPbGal, 4-nitrophenyl b-D-galactopyranoside.
3538 FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS
Introduction
a-Galactosidases (EC 3.2.1.22) are exo-acting glycoside
hydrolases that catalyse the release of galactose from
a-galacto-oligosaccharides, e.g. melibiose [a-d-Galp-(1 fi

6)-d-Glcp], raffinose [a-d-Galp-(1 fi 6)-d-Glcp-(a1 fi
b2)-d-Fruf] and stachyose [a-d-Galp-(1 fi 6)-a-d-Galp-
(1 fi 6)-d-Glcp-(a1 fi b2)-d-Fruf], polymeric galacto-
mannans containing a-(1 fi 6) linked galactosyl resi-
dues bound to a b-(1 fi 4) mannan backbone and
galactolipids [1]. a-Galactosidases occur widely in bac-
teria [2–11], fungi [12–15], plants [16,17] and animals
[18,19] and have been classified based on substrate
specificity [20] and sequence similarity [21]. With
regard to substrate specificity, one type of a-galactosi-
dase from fungi and plants acts specifically on a-galac-
to-oligosaccharides, whereas another type is able to
degrade both these and polymeric galactomannans.
a-Galactosidases are classified into glycoside hydrolase
families GH4, GH27, GH36, GH57, GH97 and
GH110 [21]. Eukaryotic a-galactosidases belong to
GH27 and GH36, which form clan GH-D together
with GH31 ( [21] and are consid-
ered to have a common evolutionary origin [22].
Hydrolysis of GH27 [23] and GH36 [24] catalysed
by a-galactosidases proceeds via a double-displacement
mechanism, resulting in net retention of the stereo-
chemistry at the anomeric centre [25]. First, the general
acid catalyst protonates the glycosidic oxygen concom-
itantly with bond cleavage and the catalytic nucleo-
phile forms a covalent glycosyl-enzyme intermediate by
direct attack at the anomeric centre. In the next step,
water is deprotonated by the general base catalyst and
attacks the anomeric centre, releasing the carbohydrate
moiety. For GH36, the nucleophile and the acid ⁄ base

catalysts of Thermotoga maritima a-galactosidase
(GalA) were identified by mutational and structural
analyses to be Asp327 and Asp387, respectively [24].
In GH27, both labelling with mechanism-based inhibi-
tors [26,27] and crystal structures of ligand complexes
of a-galactosidase [27,28] and a-N-acetylgalactosamini-
dase (EC 3.2.1.49) [29] identified the catalytic residues,
whereas no crystal structure was available of a ligand
complex for GH36.
a-Galactosidases have been reported to form a-ga-
lacto-oligosaccharides at high substrate concentrations
by catalysing the transfer of a galactosyl moiety to an
acceptor with a-(1 fi 3), a-(1 fi 4) or a-(1 fi 6) regi-
oselectivity [2–4,30–35]. Chemo-enzymatic synthesis
using suitable donor and acceptor pairs can produce
raffinose, a-d-Galp-(1 fi 6)-b-d-Galp-(1 fi 4)-d-Glcp
and a-d-Galp-(1 fi 6)-a-d-Glcp-(1 fi 4)-d-Glcp with
melibiose as the donor and sucrose, lactose and
maltose as acceptors, respectively [30,31]. Detailed
acceptor specificity, however, has not been investigated
previously for GH36 a-galactosidases and a survey is
presented here of suitable acceptors. The results
obtained may also provide a certain insight into speci-
ficity in hydrolysis catalysed by GH36.
Certain a-galacto-oligosaccharides have been
reported to be candidates for health-promoting prebi-
otic food ingredients [36–38] because a-galactosidase
is lacking in the human gastrointestinal tract and
a-galacto-oligosaccharides can be digested by the intes-
tinal microbiota and stimulate growth of beneficial

Bifidobacteria and Lactobacilli. In the present study,
efficient transglycosylation catalysed by Aspergillus
nidulans FGSC GH36
a-galactosidase (AglC), which
was produced recombinantly in Escherichia coli,
resulted in chemo-enzymatic synthesis of 13 a-galacto-
oligosaccharides, including five not reported previ-
ously, representing novel prebiotics oligosaccharide
candidates. The enzymatic properties of AglC are
described with focus on specificity and regioselectivity
in transglycosylation using 4-nitrophenol a-d-galacto-
pyranoside (pNPaGal) as the donor and different
mono- and disaccharides as acceptors. Furthermore,
structural modelling of AglC using the three-dimen-
sional structure of GalA [24] as the template and
superimposition of an equilibrium mixture of a- and
b-galactose from Oryza sativa a-galactosidase [28],
N-acetyl-a-galactosamine from Gallus gallus a-N-acet-
ylgalactosaminidase [29] and melibiose from human
a-galactosidase [27] complexes of GH27 were per-
formed to illustrate the donor and acceptor specificity
and the regioselectivity of AglC.
Results and Discussion
Sequence similarity of AglC
The amino acid sequence of AglC, deduced from aglC
(GenBank, gi: 40739585), shows 6–79% sequence iden-
tity and 17–90% sequence similarity with different
functionally characterized GH36 members (Table 1).
Phylogenetically, AglC occurs in the cluster of eukary-
otic a-galactosidases (Fig. 1) and has highest identity

(79%) to a-galactosidase of Aspergillus niger [12],
whereas it has low identity (6–10%) to plant alkaline
a-galactosidases involved in the metabolism of raffi-
nose, stachyose and polymeric galactomannans, serving
as storage carbohydrates in many botanical families
[16,17], and to raffinose (EC 2.4.1.82) [39] and stachy-
ose synthases (EC 2.4.1.67) [40,41], which catalyse the
H. Nakai et al. Transglycosylation by A. nidulans a-galactosidase
FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS 3539
formation of storage oligosaccharides by transglycosy-
lation using galactinol [O-a-d-Galp-(1 fi 1)-l-myo-ino-
sitol] as the donor. This relationship motivated the
detailed analysis of the capacity and specificity of AglC
in transglycosylation reactions.
Overproduction in E. coli and purification of AglC
Similar to other fungal GH36 a-galactosidases [13–15],
AglC has a signal peptide (Met1-Ala26; predicted by
wolf psort [42] and signalp [43]), and the bioinfor-
matic analysis suggests that AglC is an extracellular
GH36 a-galactosidase. Previously, heterologous expres-
sion in Pichia pastoris X-33 and partial characteriza-
tion was described for AglC, together with a large
number of cell wall polysaccharide-degrading enzymes
annotated in the A. nidulans genome [12,44]. However,
because this recombinant AglC was produced with sig-
nal peptide, we overproduced AglC in E. coli by
expression of aglC encoding mature protein, isolated
from genomic DNA of the P. pastoris transformant
(see Experimental procedures) under strict control of
the cold shock promoter cpsA and the lac operator

[45]. The resulting AglC His-tag fusion was purified by
nickel chelating chromatography in a yield of 1.3 g
from 2 L culture and migrated in SDS ⁄ PAGE as a sin-
gle band with an estimated molecular mass of 83 kDa
(Fig. S1). Moreover, the molecular mass of the recom-
binant AglC was estimated to be 335 kDa by gel filtra-
tion chromatography, indicating that AglC is a
tetramer in solution, similar to several bacterial and
fungal GH36 a-galactosidases [2,5,6,8,10,14,15].
Other bacterial and fungal GH36 a-galactosidases
were found to be dimers [4], trimers [3] or octamers
[11], whereas plant alkaline a-galactosidases [16] and
bacterial a-N-acetylgalactosaminidases [46,47] were
monomers.
Enzymatic properties of AglC
AglC hydrolysed pNPaGal, but not the pNP glycosides
of N-acetyl a-d-galactosamine (pNPaGalNAc, i.e.
the substrate for GH36 a-N
-acetylgalactosaminidase
[45,47]), b- d-galactopyranose (pNPbGal), a-d-gluco-
pyranose (pNPaGlc), N-acetyl a-d-glucosamine (pNPa
GlcNAc), a-d-xyl opyranose (pNPaXyl), a-d-manno-
pyranose (pNPaMan), a-l-arabinopyranose (pNPaAra),
a-l-arabinofuranose (pNP aAraf) and a-l-rhamnopyra-
nose (pNPaRha) (less than 10 lm pNP liberated in the
reaction mixture). AglC is thus an a-galactosidase, as
also suggested by the sequence similarity (Table 1,
Fig. 1). The pH optimum of AglC catalysed hydrolysis
of pNPaGal was 5.0 (Fig. 2A) as found for bacterial
[4,7,9,34] and other fungal a-galactosidases [13–15],

whereas plant alkaline a-galactosidases have pH
optima of 7.5–8.5 [16,17]. AglC showed good stability
Table 1. Amino acid sequence comparison of AglC from Aspergillus nidulans FGSC with functionally characterized GH36 enzymes. Similari-
ties of amino acid sequences were determined using the
BLASTP program (Swiss-Prot ⁄ TrEMBL database).
Swiss-Prot ⁄ TrEMBL
accession no. Identity (%) Similarity (%) Gap (%)
a-Galactosidase
Aspergillus niger CBS 120.49 ⁄ N400 Q9UUZ4 79 90 0
Penicillium sp. F63 CGMCC1669 A4Z4V0 68 81 2
Geobacillus stearothermophillus NUB3621 Q9X624 39 54 6
Clostridium stercorarium F-9 Q84IQ0 36 54 7
Lactobacillus plantarum ATCC 8014 Q9L905 33 51 5
Carnobacterium piscicola strain BA Q93DW8 34 53 6
Lactococcus raffinolactis ATCC 43920 Q7XIP3 36 54 6
Mycocladus corymbiferus IFO 8084 Q9P8N4 28 44 11
Lactobacillus fermentum CRL722 Q6IYF5 27 45 8
Bifidobacterium bifidum NCIMB 41171 Q1KTD9 23 37 9
Bifidobacterium breve 203 Q2XQ11 21 36 12
Thermus sp. strain T2 Q9WXC1 10 19 38
Thermotoga maritima MSB8 O33835 8 18 32
a-N-Acetylgalactosaminidase
Clostridium perfringens Q8XNK8 8 20 25
Raffinose synthase
Glycine max CV. CLARK63 BD953761 8 20 25
Stachyose synthase
Pisum sativum L cv. Wunder von Kelevedon Q93XK2 6 17 20
Vigna angularis Ohwi et Ohashi Q9SBZ0 6 17 21
Transglycosylation by A. nidulans a-galactosidase H. Nakai et al.
3540 FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS

at pH 3.6–9.9 (Fig. 2B), maximum activity at 50 °C
(Fig. 2C) and retained > 95% activity after 15 min
incubation up to 45 °C at pH 5.0 (Fig. 2D).
AglC hydrolysed the a-galactosidic linkage in
pNPaGal, melibiose [a-d-Galp-(1 fi 6)- d-Glcp] and
raffinose [a- d-Gal p-(1 fi 6)-d-Glcp-(a1 fi b2)-d-Fruf],
but failed to cleave off a-(1 fi 6) galactosyl branches
in galactomannan [48]. AglC thus belongs to the cate-
gory of exo-acting fungal and plant a-galactosidases
hydrolysing a-galacto-oligosaccharides [20]. The cata-
lytic efficiency (k
cat
⁄ K
m
) towards pNPaGal was two
orders of magnitude higher than for these oligosaccha-
rides due to the lower K
m
value (Table 2). This repre-
sents the first kinetic analysis of a fungal GH36
a-galactosidase and AglC gave approximately two-fold
lower k
cat
⁄ K
m
for raffinose compared with melibiose,
similar to bacterial a-galactosidases [5,6,10,20],
whereas plant alkaline a-galactosidase showed 18-fold
higher k
cat

⁄ K
m
for raffinose than melibiose [16].
Transglycosylation and acceptor specificity of
AglC
Phylogenetically AglC is in a cluster including eukary-
otic a-galactosidases (Fig. 1) and also has sequence
similarity (17–20%) to raffinose and stachyose synthas-
es (Table 1). These enzymes synthesize raffinose and
stachyose by transglycosylation, and it is shown here
that AglC also efficiently catalysed transglycosylation
of pNPaGal as monitored by TLC (Fig. 3A) and
HPLC (Fig. 3D). The product was obtained in 74%
yield after 1 h and ESI-MS showed m ⁄ z of 486 corre-
Fig. 1. Phylogenetic tree constructed based on deduced full-length amino acid sequences of functionally characterized GH36 glycosidases
and synthases using
CLUSTALW. The rectangular cladogram tree was generated with TREEVIEW version 1.6.6 software. Values at nodes repre-
sent the percentage of bootstrap confidence level on 1000 resamplings. Bacterial a-galactosidases: Bifidobacterium adolescentis DSM
20083 Aga (GenBank, gi: 14495552), Bifidobacterium bifidum NCIMB 41171 MelA (gi: 90655076), Bifidobacterium breve 203 Aga2
(gi:82468523), Clostridium stercorarium F-9 Aga36A (gi: 28268728), Escherichia coli K-12 RafA (gi: 147505), Geobacillus stearothermophilus
KVE39 AgaA (gi: 12331004), Geobacillus stearothermophilus NUB3621 AgaN (gi: 4567098), Lactococcus raffinolactis ATCC 43920 AgA (gi:
32450781), Lactobacillus fermentum CRL722 MelA (gi: 47717086), Lactobacillus plantarum ATCC8014 MelA (gi: 15042935), Streptococ-
cus mutans strain Ingribitt Aga (gi:153736), Thermotoga maritima MSB8 GalA (gi: 55165925), Thermotoga neapolitana 5068 AglA (gi:
3237318), Thermus brockianus ITI360 AgaT (gi: 4928639), Thermus sp. strain T2 AglA (gi: 4587043) and Thermus thermophilus TH125 AgaT
(gi: 4894857); bacteria a-N-acetylgalactosaminidase: Clostridium perfringens ATCC 10543 AagA (gi: 22651784); fungal a-galactosidases:
Aspergillus nidulans FGSC A4 AglC (gi: 40739585), Aspergillus niger CBS 120.49 ⁄ N400 AglC (gi: 6624914) and Penicillium sp. F63
CGMCC1669 Agl1 (gi: 85375918); plant alkaline a-galactosidase: Cucumis melo L. Aga1 and Aga2 (gi: 29838629 and gi: 29838631),
Pisum sativum L. cv. Kelvedon Wonder AGa1 (gi: 148925503), Tetragonia tetragonioides TtAga1 (gi: 209171772) and Zea mays L. ZmAGA1
and ZmAGA3 (gi: 68270843 and gi: 33323027); raffinose synthase: Glycine max CV. CLARK63 Ras (gi: 67587384); stachyose synthases:
Hordeum vulgare subsp. vulgare Sip1 (gi: 167100), Pisum sativum L. cv. Wunder von Kelvedon Sts1 (gi: 13992585), Stachys sieboldii STS

(gi: 19571727) and Vigna angularis Ohwi wt Ohashi VaSTS1 (gi: 6634701).
H. Nakai et al. Transglycosylation by A. nidulans a-galactosidase
FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS 3541
sponding to the calculated value of the Na
+
adduct of
pNP a-d-galactobioside (C
18
H
25
NO
13
+Na
+
).
1
H-
and
13
C-NMR spectroscopy indicated the formation of
a single product, pNP a-d-Galp-(1 fi 6)-d-Galp,
reflecting the regioselectivity of AglC (Table S1). In
contrast, a-galactosidases of Bacillus stearothermophi-
lus and Thermus brockianus were reported to produce
both a-(1 fi 3) and a-(1 fi 6) linked pNP a-d-galacto-
biosides [33]. AglC furthermore synthesized a tri-
(Fig. 3B, E) and a tetrasaccharide (Fig. 3C, F) from
40 mm melibiose or raffinose in 59 and 37% yields,
respectively, during 1 h reaction. ESI-MS showed m ⁄ z
of 527 and 689 corresponding to the calculated values

for Na
+
adducts of galactosyl-melibiose (C
18
H
32
O
16
+
Na
+
) and galactosyl-raffinose (C
24
H
42
O
21
+Na
+
)
and two-dimensional NMR identified the oligosaccha-
rides as a-d-Galp-(1 fi 6)-a-d-Galp-(1 fi 6)-d-Glcp
and a-d-Galp-(1 fi 6)-a-d-Galp-(1 fi 6)-d-Glcp-(a1 fi
b2)-d-Fruf (stachyose), respectively (Table S1). AglC
thus catalysed efficient transglycosylation with a-1,6-
regioselectivity at a lower concentration (40 mm)of
melibiose and raffinose compared with a-galactosidases
of Bifidobacterium [3,4,32] and Lactobacillus [34] of the
prokaryotic cluster (Fig. 1) at a higher concentration
of melibiose (0.1–1.2 m) and raffinose (0.46 m) result-

ing in 11–33% and 26% yield, respectively.
This important transglycosylation catalysed by AglC
motivated a comprehensive analysis of acceptor speci-
ficity involving 10 mono- and 10 disaccharides
(Table 3) for the formation of a-galacto-oligosaccha-
rides with the donor pNPaGal, which has a good
leaving group. Among the monosaccharides, only
galactose, glucose and mannose were found to be
acceptors, resulting in disaccharide yields of 39–58%
after 3 h reaction (Table 3). Apparently, AglC did not
transfer a-galactosyl to monosaccharides without
6-OH (xylose, l-arabinose, l-fucose and l-rhamnose)
or with axial 3-OH (gulose, allose, altrose and l-rham-
nose), indicating the equatorial 3-OH to be critical for
recognition at subsite +1. On the other hand, analysis
AB
CD
Fig. 2. Effect of pH and temperature on the
activity and stability of AglC. (A) pH depen-
dence for hydrolysis of pNPaGal by 0.27 n
M
AglC (
•
)in40mM Britton-Robinson buffer
pH 2.3–11.9. (B) pH stability of 1.6 n
M AglC
(s)in90m
M Britton-Robinson buffer pH
2.3–11.9. (C) Temperature activity depen-
dence for 4.1 n

M AglC ( ) at 20–90 °C with
10 min reaction. (D) Stability of 9.0 n
M AglC
(h) in the temperature range 20–90 °C for
15 min. Each experiment was carried out in
triplicate. Standard deviations are shown as
error bars.
Table 2. Kinetic parameters for hydrolysis of pNPaGal, melibiose
and raffinose by AglC. Parameters are calculated from the initial
velocities of release of pNP from pNPaGal and of galactose from
melibiose and raffinose at different substrate concentrations (see
Experimental procedures).
Substrate K
m
(mM) k
cat
(s
)1
) k
cat
ÆK
m
)1
(s
)1
ÆmM
)1
)
pNPaGal 0.27 ± 0.01 1278 ± 38 4730
Melibiose 12 ± 0.12 1067 ± 26 88.9

Raffinose 15 ± 0.57 586 ± 17 39.1
Transglycosylation by A. nidulans a-galactosidase H. Nakai et al.
3542 FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS
of disaccharide acceptors reflected broad specificity of
subsite +2 and resulted in the formation of eight
trisaccharides, five from a-linked (melibiose, maltose,
trehalose, sucrose, turanose) and three from b-linked
disaccharides (lactose, lactulose, cellobiose) in 26–46%
yield, except for melibiose resulting in only 6% yield
of trisaccharide. Melibiose at a high concentration pos-
sibly competes with the donor pNPaGal having a good
leaving group, resulting in the modest yield. As found
for xylose and l-arabinose, xylobiose and arabinobiose
were not acceptors (Table 3).
Progress of transglycosylation during 3 h using
40 mm pNPaGal and 400 mm of the identified 11 func-
tional acceptors (see above) (Fig. 4) showed individual
product formation rates and yields, glucose and malt-
ose giving the highest yield, but having the slowest
reaction rate. Noticeably, only one product (Table 3)
was obtained with each acceptor, emphasizing that
rigorous recognition governs the transglycosylation
outcome. Analysis of the product structures (see
below) accordingly indicated strict a-(1 fi 6) regiospec-
ificity for the AglC transglycosylation.
ESI-MS analysis gave m ⁄ z signals of 365 or 527
corresponding to calculated molecular masses of Na
+
adducts of mono- or disaccharide acceptor conjugates
of galactose. Chemical shifts for NMR linkage analysis

were assigned based on two-dimensional NMR spectra
(Tables S2 and S3). The formed a-(1 fi 6) linkages
were identified by long-range proton–carbon tree bond
correlation from the nonreducing anomeric proton to
C-6 of the substituted position, as confirmed by inter
NOE correlations. AglC thus recognized the C-6
hydroxymethyl and equatorial 3-OH group of an
aldohexopyranosyl unit at subsite +1 and transferred
a-galactopyranosyl to the 6-OH, resulting in 11
a-(1 fi 6) linked galactosyl-oligosaccharides. These
ABC
DEF
Fig. 3. Monitoring formation of transglycosylation products from pNPaGal (A), melibiose (B) and raffinose (C) by TLC (see Experimental pro-
cedures). Standards: lane S1, pNPaGal and galactose; lane S2, galactose and melibiose; lane S3, glucose; lane S4, galactose and raffinose;
lane S5, sucrose. Products from pNPaGal (D), melibiose (E) or raffinose (F) were reconfirmed by HPLC equipped with a UV or refractive
index (RI) detector and a TSKgel Amide-80 column. The compounds, pNP (1), pNP a-Galp (2), pNP a-Galp-(1 fi 6)-Galp (3), galactose and
glucose (4), melibiose (5), a-Galp-(1 fi 6)-a-Galp-(1 fi 6)-Glcp (6), galactose (7), sucrose (8), raffinose (9) and a-Galp-(1 fi 6)-a-Galp-(1 fi 6)-
Glcp-(a1 fi b2)-Fruf (10) are marked by arrows.
H. Nakai et al. Transglycosylation by A. nidulans a-galactosidase
FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS 3543
products include five novel compounds (Fig. 5);
a-d-galactopyranosyl-(1 fi 6)-d-mannopyranose; a-d-
galactopyranosyl-(1 fi 6)-d-glucopyranosyl-(a1 fi a1)-
d-glucopyranose; a-d-galactopyranosyl-(1 fi 6)-a-d-gluco
pyranosyl-(1 fi 3)-d-fructofuranose; a-d-galactopyr-
anosyl-(1 fi 6)-b-d-galactopyranosyl -(1 fi 4)-d-fruc-
tofuranose; and a-d-galactopyranosyl-(1 fi 6)-b-d-
glucopyranosyl-(1 fi 4)-d-glucopyranose.
Substrate recognition by AglC
The crystal structure of GalA (PDB ID:1ZY9) [24]

was used as the template to model a truncated AglC
(Gly193–Glu699) comprising b6-b15 of the N-terminal
b-sandwich domain (Gly193–Ala347) and the catalytic
(b ⁄ a)
8
-barrel (Thr348–Glu699) (Fig. 6). This truncated
AglC has 25% sequence identity and 40% sequence
similarity with corresponding GalA domains, whereas
full-length AglC shows only 8% identity and 18% sim-
ilarity. Recognition of a-galactose at subsite )1 of the
modelled AglC structure (Fig. 6A, B) was proposed by
superimposition of a- and b-galactose and N-acetyl-
a-galactosamine, respectively, from complexes with
O. sativa a-galactosidase (1UAS) [28] and G. gallus a-
N-acetylgalactosaminidase (1KTC) [29] both of GH27,
because a ligand complex structure was not available
for GH36. Direct hydrogen bonds appeared in this
model between the a-anomeric 1-OH and the 2-OH of
a-galactose with Asp573, corresponding to Asp387, i.e.
the proposed acid ⁄ base catalyst in GalA [24]. Further-
more, Asp511, which corresponds to the predicted cat-
alytic nucleophile Asp327 in GalA [24], presumably
makes a hydrogen bond with O5 of the galactose ring
and direct hydrogen bonds were also suggested
between Lys509 and 3-OH and the axial 4-OH as well
as Asp388 and Asp389 and 4-OH and 6-OH, respec-
tively. These AglC ⁄ a-galactose contacts are consistent
with the reported recognition at subsite )1 of the mod-
Table 3. Test of carbohydrate acceptor candidates for transgly-
cosylation as catalysed by AglC using the donor pNPaGal. Products

from 40 m
M pNPaGal and 400 mM acceptor were quantified by
HPAEC-PAD using melibiose and raffinose as standards for di- and
trisaccharide products, respectively. Yields are based on the pNPa
Gal concentration (see Experimental procedures).
Acceptor Product
Yield
(%)
Monosaccharide
Galactose (Gal) a-Galp-(1 fi 6)-Galp 39
Gulose – –
Glucose (Glc) a-Galp-(1 fi 6)-Glcp 58
Allose – –
Mannose (Man) a-Galp-(1 fi 6)-Manp 50
Altrose – –
Xylose (Xyl) – –
L-Arabinose (L-Ara) – –
L-Fucose (L-Fuc) – –
L-Rhamnose – –
Disaccharide
Melibiose a-Galp-(1 fi 6)-a-Galp-(1 fi 6)-Glcp 6
Maltose a-Galp-(1 fi 6)-a-Glcp-(1 fi 4)-Glcp 46
Trehalose a-Galp-(1 fi 6)-Glcp-(a1 fi a1)-Glcp 26
Sucrose a-Galp-(1 fi 6)-Glcp-(a1 fi b2)-Fruf 28
Turanose a-Galp-(1 fi 6)-a-Glcp-(1 fi 3)-Fruf 26
Arabinobiose – –
Lactose a-Galp-(1 fi 6)-b-Galp-(1 fi 4)-Glcp 38
Lactulose a-Galp-(1 fi
6)-b-Galp-(1 fi 4)-Fruf 38
Cellobiose a-Galp-(1 fi 6)-b-Glcp-(1 fi 4)-Glcp 28

Xylobiose – –
ABC
Fig. 4. Progress of AglC (18 nM) catalysed transglycosylation with different acceptors (400 mM) and pNPaGal (40 mM) as the donor. (A)
Monosaccharides: galactose (•), glucose (s), mannose (h). (B) a-Linked disaccharides: melibiose (•), maltose (s), trehalose (h), sucrose (e),
turanose (
). (C) b-Linked disaccharides: lactose (D), lactulose ( ) and cellobiose (¤)in40mM Na acetate (pH 5.0) at 37 °C for 3 h. Product
concentrations were calculated from peak areas of HPAEC-PAD (linear gradient, 0–75 m
M Na acetate in 100 mM NaOH for 35 min; flow rate,
0.35 mLÆmin
)1
) calibrated with melibiose and raffinose as standards for di- and trisaccharides, respectively.
Transglycosylation by A. nidulans a-galactosidase H. Nakai et al.
3544 FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS
elled structure for Bifidobacterium adolescentis GH36
a-galactosidase [35] and AglC specifically hydrolysing
pNPaGal and not pNPaMan and pNPaGlc having
equatorial 4-OH, or pNPaXyl lacking the 6-hydroxym-
ethyl group. Noticeably, the axial 1-OH of a-galactose
projects out of the active site in the model and the cat-
alytic nucleophile Asp511 together with Trp221, from
the N-terminal b-sandwich domain, block for binding
of a b-linked aglycone at subsite +1 in agreement with
AglC not hydrolysing pNPbGal. The bulky Trp221
and Trp570 side chains presumably preclude binding
of the C-2 substituent of N-acetyl-a-galactosamine
(Fig. 6B). The a-N-acetylgalactosaminidase from
G. gallus, in contrast, has a cavity formed by Ser172
and Ala175 in the (b ⁄ a)
8
-barrel loop connecting b5

and a5 where the N-acetyl group becomes sandwiched
between Tyr176 and Arg197 and Ser172 hydrogen
bonds to the carbonyl oxygen [29].
The acceptor recognition at subsite +1 of the mod-
elled AglC structure (Fig. 6C) was further illustrated
by superimposition of melibiose from a complex with
human GH27 a-galactosidase (3HG3) [27]. Proposed
recognition of the a-galactose moiety in melibiose at
subsite )1 seems identical to that of the a-galactose
superimposed from the complex with O. sativa a-galac-
tosidase (Fig. 6A,C). Noticeably, direct hydrogen
bonds at subsite +1 are suggested, involving 3-OH
and O5 of the b-glucose moiety in melibose
and Trp358 and Asp511 (the acid ⁄ base catalyst),
respectively. Furthermore, Trp221 from the N-terminal
b-sandwich domain presumably makes a hydrophobic
environment for the C-6 hydroxymethyl group of the
b-glucose moiety. These observations supported that
AglC specifically transferred a-galactopyranosyl to C-6
hydroxymethyl of aldohexopyranosyl units with equa-
torial 3-OH group (Table 3).
Conclusion
AglC catalysed transglycosylation with remarkable effi-
ciency and selectively transferred a-galactopyranosyl to
the 6-hydroxymethyl group of aldohexopyranoses with
equatorial 3-OH, as indicated by reaction with three
monosaccharide acceptors. AglC also catalysed
transfer to 6-OH of the terminal residue in eight
disaccharides. Five novel a-(1 fi 6) linked galacto-
oligosaccharides were obtained. The very efficient

expression system makes the production of engi-
neered AglC feasible and the transglycosylation has
potential for the design and production of a-galacto-
oligosaccharides with prebiotic effect on human gut
microbiota.
Experimental procedures
Materials
Allose, altrose, galactose, glucose, gulose, mannose,
l-fucose, l-arabinose, l-rhamnose, cellobiose, lactose, lactu-
lose, maltose, melibiose, sucrose, trehalose, turanose, raffi-
nose, pNPaAra, pNPaAraf, pNPaGal, pNPaGalNAc,
pNPbGal, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRha
and pNPaXyl were purchased from Sigma (St. Louis, MO,
USA). Galactomannans (Carubin type and 98% Guarin
type) and xylose were purchased from Carl Roth (Kar-
lsruhe, Germany). Arabinobiose and xylobiose were from
Megazyme (Bray, Ireland). Other reagents were of analyti-
cal grade and from commercial sources.
Sequence analysis
clustalw ( was
used for the phylogenetic analysis using full-length amino
acid sequences of functionally characterized GH36 members
( A rectangular clad-
ogram tree was generated using treeview version 1.6.6
AD
B
C
E
Fig. 5. Structures of novel a-galacto-oligosaccharides produced by
transglycosylation catalysed by AglC. (A) a-Galp-(1 fi 6)-Manp, (B)

a-Galp-(1 fi 6)-Glcp-(a1 fi a1)-Glc p,(C)a-Gal p-(1 fi 6)- a-Glcp-(1 fi 3)-Fruf,
(D) a-Galp-(1 fi 6)-b-Galp-(1 fi 4)-Fruf, (E) a-Galp-(1 fi 6)-b-Glcp-
(1 fi 4)-Glcp.
H. Nakai et al. Transglycosylation by A. nidulans a-galactosidase
FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS 3545
software and a bootstrap test based on 1000 resampl-
ings ( />Protein localization and signal peptides were predicted
using wolf psort ( [42] and signalp
3.0 server ( [43],
respectively.
A
B
C
Fig. 6. Stereo views of presumed ligand
interactions with the active site of AglC.
(A) An equilibrium mixture of a- and b-galac-
tose (pink) from the complex with O. sativa
a-galactosidase (1UAS) [28] superimposed
on the structure AglC modelled using
T. maritima GH36 a-galactosidase (GalA,
1ZY9) [24] as a template. Suggested hydro-
gen bonds are shown as dotted lines.
Asp511 and Asp573 are predicted to be
nucleophile (nu) and acid ⁄ base (a ⁄ b) cata-
lysts, respectively, by sequence alignment
with GalA [24]. (B) N-acetyl-a-galactosamine
(as a yellow stick) from the complex with
G. gallus a-N-acetylgalactosaminidase (as
yellow lines; 1KTC) [29] superimposed on
the modelled AglC structure (grey lines).

A hydrogen bond (2.6 A
˚
) suggested
between S172
1KTC
and oxygen of the
N-acetyl group of a-galactosamine is shown
(dotted line). (C) Melibiose (as an orange
stick) from the complex with human GH27
a-galactosidase (3HG3) [27] superimposed
on the modelled AglC structure (grey lines).
Suggested hydrogen bonds are shown as
dotted lines.
Transglycosylation by A. nidulans a-galactosidase H. Nakai et al.
3546 FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS
Cloning of aglC and construction of the
expression plasmid
The gene aglC (GenBank, gi: 40739585) was cloned by
direct PCR [49] from a P. pastoris X-33 transformant har-
bouring the expression plasmid aglC ⁄ pPICZaC (FGSC
database accession no. 10122; ) [12] pur-
chased from Fungal Genetics Stock Center (School of Bio-
logical Sciences, University of Missouri, MO, USA) with
elimination of both the Saccharomyces cerevisiae a-factor
signal peptide [50] and the AglC signal sequence (Met1-
Ala26). The Expand High Fidelity PCR System (Roche,
Basel, Switzerland) was used as DNA polymerase with
oligonucleotides based on the genomic sequence [44]:
5¢-GGG
GAGCTCATTGCGCAGGGTACAACTGGTTCC

AATG-3¢ containing a SacI site (underlined) as 5¢ forward
and 5¢-CCC
TCTAGACTGCCTTTCTAAGAAGACCACT
TTG-3¢ containing an XbaI site (underlined) as the 3¢
reverse primer. The PCR product was purified (QIAquick
Gel Extraction Kit; Qiagen, Germantown, MD, USA),
digested by SacI and XbaI (New England Biolabs, Ontario,
Canada) and cloned into pCold I [47] (Takara, Kyoto,
Japan). The plasmid was propagated in E. coli DH5a
(Novagen, Madison, WI, USA), purified (QIAprep Spin
Miniprep Kit; Qiagen), and its sequence verified (MWG
Biotech, Ebersberg, Germany).
Recombinant AglC production
Escherichia coli BL21(DE3) (Novagen) harbouring aglC-
pCold I was grown at 12 °C in Luria-Bertani medium
(1% tryptone, 0.5% yeast extract, 1% NaCl) containing
50 lgÆmL
)1
ampicillin (2 · 1 L in 2 L shake flasks).
Expression of aglC was induced by 0.1 mm isopropyl-1-
thio-b-galactopyranoside and continued at 12 °C for 24 h.
Cells were harvested by centrifugation (9000 g, 10 min,
4 °C), resuspended in 20 mL BugBuster Protein Extrac-
tion Reagents (Novagen) containing 2 lL Benzonate
Nuclease (Novagen) followed by 30 min at room tempera-
ture and centrifugation (19 000 g, 15 min, 4 °C). The
supernatant was filtered (acetate, pore size: 0.22; GE
Infrastructure Water & Process Technologies Life Science
Microseparations, Trevose, PA, USA) and applied to
HisTrap HP (5 mL; GE Healthcare UK, Uppsala,

Sweden) equilibrated with 20 mm HEPES pH 7.5, 0.5 m
NaCl, 10 mm imidazole (A
¨
KTAexplorer; GE Healthcare)
and washed with 20 mm HEPES pH 7.5, 0.5 m NaCl,
22 mm imidazole. Protein was eluted by a linear
22–400 mm imidazole gradient in the same buffer and
AglC-containing fractions were pooled, dialysed against
20 mm HEPES pH 7.0, and concentrated (Centriprep
YM50; Millipore Corporation, Billerica, MA, USA). All
purification steps were performed at 4 °C. The protein
concentration was measured spectrophotometrically at
280 nm using E
0.1%
= 1.44 (determined using amino acid
analysis). The molecular mass of AglC was estimated by
SDS ⁄ PAGE stained with Coomassie Brilliant Blue and by
gel filtration (HiLoad
TM
200 Superdex
TM
16 ⁄ 60 column;
flow rate, 0.5 mLÆmin
)1
;A
¨
KTAexplorer; GE Healthcare)
equilibrated with 10 mm MES pH 6.8, 0.15 m NaCl and
using the Gel Filtration Calibration kit HMW (GE Health-
care) as standards.

Routine enzyme assay
AglC (0.18–0.27 nm) hydrolysed 2 mm pNPaGal in 40 mm
Na acetate pH 5.0, 0.02% BSA (50 lL) for 10 min at
37 °C. The reaction was stopped by 1 m Na
2
CO
3
(100 lL)
and released pNP was measured spectrophotometrically
from the absorbance at 410 nm using E
1mM
= 2.01. One
unit of activity was defined as the amount of enzyme that
liberates 1 lmol pNP from pNPaGal per minute under
these conditions.
Characterization of enzymatic properties
The pH optimum of 0.27 nm AglC for 2 mm pNPaGal
was determined in 40 mm Britton-Robinson buffer [51]
(50 lL; pH 2.3–11.9; 40 mm acetic acid, 40 mm phospho-
ric acid, 40 mm boric acid, pH adjusted by NaOH), as
above. The temperature optimum of activity (see above) in
the range 20–90 °C was determined in 40 mm Na acetate
pH 5.0, 0.02% BSA (100 lL). The dependence of AglC
stability on pH and temperature was deduced from resid-
ual activity analysed by the standard assay for 1.6 nm
AglC in 90 mm Britton-Robinson buffer (pH 2.3–11.9),
0.02% BSA incubated at 4 °C for 24 h and for 4.1 nm
AglC in 20 mm HEPES pH 7.0, 0.02% BSA incubated at
20–90 °C for 15 min. Each experiment was carried out in
triplicate.

Hydrolytic activity of 0.27–270 nm AglC was tested
towards 5 mm pNPaGal, pNPaGalNAc, pNPaAra,
pNPaAraf, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRha,
pNPaXyl, and pNPbGal, and 0.4% galactomannans in
40 mm Na acetate pH 5.0, 0.02% BSA, for 10 min at
37 °C.
Initial rates of hydrolysis of 0.10–2.0 mm p
NPaGal,
1.0–12 mm melibiose and 1.0–12 mm raffinose were mea-
sured at seven different substrate concentrations using AglC
(0.18 nm for pNPaGal, 0.37 nm for melibiose, 0.91 nm for
raffinose) in 40 mm Na acetate pH 5.0, 0.02% BSA (1 mL)
at 37 °C. Aliquots (100 lL) removed at 0, 5, 10, 20, 30 min
were mixed with 1 m Na
2
CO
3
(200 lL) for pNPaGal or
2 m Tris-HCl pH 8.0 (200 lL) for melibiose and raffinose
to stop the reaction. pNP was quantified spectrophotomet-
rically as above. Galactose released from melibiose and
raffinose was quantified using the Lactose ⁄ Galactose
(Rapid) kit (Megazyme). K
m
and k
cat
were determined from
Lineweaver–Burk plots (1 ⁄ s)1 ⁄ v plots). Each experiment
was carried out in triplicate.
H. Nakai et al. Transglycosylation by A. nidulans a-galactosidase

FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS 3547
TLC and HPLC monitoring of transglycosylation
Transglycosylation products formed by AglC (18 nm for
pNPaGal, 37 nm for melibiose, 91 nm for raffinose) with
40 mm substrate in 40 mm Na acetate pH 5.0 at 37 °C for
0–1 h were detected by TLC (TLC Silica gel 60 F
254
; Merck,
Darmstadt, Germany) developed by acetonitrile ⁄ water
(85:15, v ⁄ v) – twice for the transglycosylation products from
pNPaGal and three times for the products from melibiose
and raffinose, respectively – and sprayed by a-naphthol ⁄ sul-
furic acid ⁄ methanol (0.03:15:85, w ⁄ v ⁄ v) followed by tarring
at 120 °C. Transglycosylation products were separated by
HPLC (UltiMate 300; Dionex, Sunnyvale, CA, USA)
equipped with a TSKgel Amide-80 column (4.6 · 250 mm;
Tosoh Bioscience, Tokyo, Japan) at a constant flow of
1.0 mLÆmin
)1
(see Table S4 for mobile phase composition
and column temperature) and quantified from peak areas
detected by an ultraviolet detector (UltiMate 300 series vari-
able wavelength detector VWD-3400; Dionex) or refractive
index detector (Shodex RI-101; Showa Denko K.K.,
Kanagawa, Japan) calibrated with pNPaGal, melibiose and
raffinose for pNP a-galactobioside, galactosyl-melibiose and
galactosyl-raffinose, respectively. Transglycosylation yields
were calculated based on substrate concentration.
Transglycosylation with mono- and disaccharide
acceptors

a-Galacto-oligosaccharides after 3 h reaction in mixtures
(1 mL) containing 18 nm AglC, 40 mm pNPaGal, 400 mm
acceptor (Table 3) in 40 mm Na acetate pH 5.0 at 37 °C
were quantified from peak areas in high-performance
anion-exchange chromatography equipped with pulsed
amperometric detection (HPAEC-PAD, ICS-3000 ion
chromatography system; Dionex; linear gradient 0–75 mm
Na acetate in 100 mm NaOH for 35 min; flow rate
0.35 mLÆmin
)1
) calibrated with melibiose and raffinose for
di- and trisaccharide products, respectively. Transglycosyla-
tion yields were calculated based on pNPaGal concentra-
tion. Aliquots (50 lL) were removed at 0, 2, 4, 6, 8, 10, 20,
30, 60, 120 and 180 min and 0.5 m NaOH (500 lL) was
added to stop the reaction.
Sample preparation for oligosaccharide structural
analysis
Transglycosylation products for structure determination
were generated by (a) AglC (18 nm for pNPaGal, 37 nm for
melibiose or 91 nm for raffinose) reacting with 40 mm sub-
strate in 40 mm Na acetate pH 5.0 (final volume 1 mL) at
37 °C for 1 h and (b) AglC (18 nm) reacting with 40 mm
pNPaGal and 400 mm acceptor (Table 3) in 40 mm Na ace-
tate pH 5.0 (final volume 1 mL) at 37 °C for 2 h (with
melibiose and trehalose) or 3 h (other acceptors). Following
heat inactivation (15 min, 90 °C) and desalting (Amberlite
MB20; Sigma), the products were purified by HPLC
using a TSKgel Amide-80 column at a constant flow of
1.0 mLÆmin

)1
at 70 °C (see Table S4 for mobile phase com-
position). Fractions containing products were collected
(Foxy Jr. Fraction collector; Teledyne Isco, Lincoln, NE,
USA) and the purity verified by TLC.
ESI-MS
ESI-MS was performed using an LTQ XL Ion Trap MS
(Thermo Scientific, San Jose, CA, USA) [52]. Samples were
introduced through a Thermo Accela UHPLC system
equipped with a Hypercarb (100 · 2.1 mm, 3 lm) column
(Thermo) eluted by a gradient of deionized water, acetoni-
trile in 0.2% trifluoroacetic acid (0.4 mLÆmin
)1
;70°C). MS
detection was performed in positive mode using a spray
voltage of 4.5 kV and a capillary temperature of 260 °C
and auto-tuned on glucohexaose (m ⁄ z 1013).
NMR analysis
NMR spectra were recorded on a Bruker DRX 600 spec-
trometer (Bruker BioSpin AG, Fa
¨
llanden, Switzerland) in
5 mm NMR tubes at 300K. Relative amounts were
obtained by integration of one-dimensional proton spectra.
A series of two-dimensional homo- and heteronuclear cor-
related spectra were obtained by Bruker standard experi-
ments COSY, NOESY, TOCSY, heteronuclear single
quantum coherence and heteronuclear multiple bond corre-
lation spectra. The following parameters were used: acquisi-
tion time 0.4 s, NOESY mixing time 0.8 s, 0.12 s TOCSY

spinlock and data points 4096*512 with zero filling in F1
dimension.
Homology modelling of AglC
The three-dimensional structure of AglC covering Gly193-
Ala347 (b6–b15 of the N-terminal b-sandwich domain) and
Thr348–Glu699 [the (b ⁄ a)
8
-barrel catalytic domain] was
modelled (swiss model; [53]
using the structure of GalA (PDB ID: 1ZY9) [24] as a tem-
plate. An equilibrium mixture of a- and b-galactose from
O. sativa a-galactosidase (1UAS) [28], melibiose from
human a-galactosidase (3HG3) [27] and N-acetyl-a-galac-
tosamine from G. gallus a-N-acetylgalactosaminidase
(1KTC) [29] complexes of GH27 were superimposed on to
the modelled AglC, as no GH36 ligand complex structure
is available.
Acknowledgements
Anne Blicher is thanked for amino acid analysis,
Louise Enggaard Rasmussen for maintaining the
Transglycosylation by A. nidulans a-galactosidase H. Nakai et al.
3548 FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS
P. pastoris transformant strain and Andrew J. Mort
for making the transformant available. Folmer Fredsl-
und is thanked for help with the structural analysis.
Jørn Dalgaard Mikkelsen and Anne S. Meyer are
thanked for discussions. This study was supported by
the Danish Strategic Research Council’s Committee on
Food and Health (FøSu, to the project ‘Biological
Production of Dietary Fibres and Prebiotics’, no.

2101-06-0067), the Center for Advanced Food Studies
(LMC), the Carlsberg Foundation, the Danish
Research Council for Natural Sciences and an H.C.
Ørsted postdoctoral fellowship from DTU (MJB).
References
1 Dey PM & Campillo ED (1984) a-Galactosidase. Adv
Enzymol Relat Areas Mol Biol 56, 141–249.
2 Van den Broek LAM, Ton J, Verdoes JC, Van Laere
KMJ, Voragen AGJ & Beldman G (1999) Synthesis of
a-galacto-oligosaccharides by a cloned a-galactosidase
from Bifidobacterium adolescentis. Biotechnol Lett 21,
441–445.
3 Goulas T, Goulas A, Tzortzis G & Gibson GR (2009)
A novel a-galactosidase from Bifidobacterium bifidum
with transgalactosylating properties: gene molecular
cloning and heterologous expression. Appl Microbiol
Biotechnol 82, 471–477.
4 Zhao H, Lu L, Xiao M, Wang Q, Lu Y, Liu C, Wang
P, Kumagai H & Yamamoto K (2008) Cloning and
characterization of a novel a-galactosidase from
Bifidobacterium breve 203 capable of synthesizing
Gal-a-1,4 linkage. FEMS Microbiol Lett 285, 278–283.
5 Schmid K & Schmitt R (1976) Raffinose metabolism in
Escherichia coli K12. Purification and properties of a
new a-galactosidase specified by a transmissible plas-
mid. Eur J Biochem 67, 95–104.
6 Fridjonsson O, Watzlawick H, Gehweiler A & Mattes
R (1999) Thermostable a-galactosidase from Bacillus
stearothermophilus NUB3621: cloning, sequencing and
characterization. FEMS Microbiol Lett 176, 147–153.

7 Carrera-Silva EA, Silvestroni A, LeBlanc JG, Piard JC,
Savoy de Giori G & Sesma F (2006) A thermostable
a-galactosidase from Lactobacillus fermentum CRL722:
genetic characterization and main properties. Curr
Microbiol 53, 374–378.
8 Aduse-Opoku J, Tao L, Ferretti JJ & Russell RR
(1991) Biochemical and genetic analysis of Streptococ-
cus mutans a-galactosidase. J Gen Microbiol 137, 757–
764.
9 Liebl W, Wagner B & Schellhase J (1998) Properties of
an a-galactosidase, and structure of its gene galA,
within an a- and b-galactoside utilization gene cluster
of the hyperthermophilic bacterium Thermotoga mariti-
ma. Syst Appl Microbiol 21, 1–11.
10 Fridjonsson O, Watzlawick H, Gehweiler A, Rohrhirsch
T & Mattes R (1999) Cloning of the gene encoding a
novel thermostable a
-galactosidase from Thermus
brockianus ITI360. Appl Environ Microbiol 65, 3955–
3963.
11 Ishiguro M, Kaneko S, Kuno A, Koyama Y, Yoshida
S, Park GG, Sakakibara Y, Kusakabe I & Kobayashi
H (2001) Purification and characterization of the recom-
binant Thermus sp. strain T2 a-galactosidase expressed
in Escherichia coli. Appl Environ Microbiol 67, 1601–
1606.
12 Bauer S, Vasu P, Persson S, Mort AJ & Somerville CR
(2006) Development and application of a suite of poly-
saccharide-degrading enzymes for analyzing plant cell
walls. Proc Natl Acad Sci USA 103, 11417–11422.

13 Ademark P, de Vries RP, Haegglund P, Staalbrand H
& Visser J (2001) Cloning and characterization of
Aspergillus niger genes encoding an a-galactosidase and
a b-mannosidase involved in galactomannan degrada-
tion. Eur J Biochem 268, 2982–2990.
14 Mi S, Meng K, Wang Y, Bai Y, Yuan T, Luo H &
Yao B (2007) Molecular cloning and characterization of
a novel a-galactosidase gene from Penicillium sp. F63
CGMCC 1669 and expression in Pichia pastoris.
Enzyme Microb Technol 40, 1373–1380.
15 Baik SH, Saito K, Yokota A, Asano K & Tomita F
(2000) Molecular cloning and high-level expression in
Escherichia coli of fungal a-galactosidase from Absidia
corymbifera IFO 8084. J Biosci Bioeng 90, 168–173.
16 Gao Z & Schaffer AA (1999) A novel alkaline a-galac-
tosidase from melon fruit with a substrate preference
for raffinose. Plant Physiol 119, 979–987.
17 Carmi N, Zhang G, Petreikov M, Gao Z, Eyal Y,
Granot D & Schaffer AA (2003) Cloning and functional
expression of alkaline a-galactosidase from melon fruit:
similarity to plant SIP proteins uncovers a novel family
of plant glycosyl hydrolases. Plant J 33, 97–106.
18 Tsuji S, Martin BM, Kaslow DC, Migeon BR,
Choudary PV, Stubblefield BK, Mayor JA, Murray GJ,
Barranger JA & Ginns EI (1987) Signal sequence and
DNA-mediated expression of human lysosomal a-galac-
tosidase A. Eur J Biochem 165, 275–280.
19 Ohshima T, Murray GJ, Nagle JW, Quirk JM, Kraus
MH, Barton NW, Brady RO & Kulkarni AB (1995)
Structural organization and expression of the mouse

gene encoding a-galactosidase A. Gene 166, 277–280.
20 Dey PM, Patel S & Brownleader MD (1993) Induction
of a-galactosidase in Penicillium ochrochloron by guar
(Cyamopsis tetragonobola) gum. Biotechnol Appl
Biochem 17, 361–371.
21 Cantarel BL, Coutinho PM, Rancurel C, Bernard T,
Lombard V & Henrissat B (2009) The Carbohydrate-
Active EnZymes database (CAZy): an expert resource
for glycogenomics. Nucleic Acids Res 37, D233–238.
H. Nakai et al. Transglycosylation by A. nidulans a-galactosidase
FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS 3549
22 Rigden DJ (2002) Iterative database searches demon-
strate that glycoside hydrolase families 27, 31, 36 and
66 share a common evolutionary origin with family 13.
FEBS Lett 523, 17–22.
23 Brumer H, Sims PFG & Sinnott ML (1999) Lignocellu-
lose degradation by Phanerochaete chrysosporium:
purification and characterization of the main
a-galactosidase. Biochem J 339, 43–53.
24 Comfort DA, Bobrov KS, Ivanen DR, Shabalin KA,
Harris JM, Kulminskaya AA, Brumer H & Kelly RM
(2007) Biochemical analysis of Thermotoga maritima
GH36 a-galactosidase (TmGalA) confirms the mecha-
nistic commonality of clan GH-D glycoside hydrolases.
Biochemistry 46, 3319–3330.
25 Zechel DL & Withers SG (2000) Glycosidase mecha-
nisms: anatomy of a finely tuned catalyst. Acc Chem
Res 33, 11–18.
26 Hart DO, He S, Chany CJ, Withers SG, Sims PF,
Sinnott ML & Brumer H (2000) Identification of

Asp-130 as the catalytic nucleophile in the main
a-galactosidase from Phanerochaete chrysosporium, a fam-
ily 27 glycosyl hydrolase. Biochemistry 39, 9826–9836.
27 Guce AI, Clark NE, Salgado EN, Ivanen DR, Kulmins-
kaya AA, Brumer H & Garman SC (2010) Catalytic
mechanism of human a-galactosidase. J Biol Chem 285,
3625–3632.
28 Fujimoto Z, Kaneko S, Momma M, Kobayashi H &
Mizuno H (2003) Crystal structure of rice a-galactosi-
dase complexed with D-galactose. J Biol Chem 278,
20313–20318.
29 Garman SC, Hannick L, Zhu A & Garboczi DN (2002)
The 1.9 A structure of a-N-acetylgalactosaminidase:
molecular basis of glycosidase deficiency diseases.
Structure 10, 425–434.
30 Kato K, Ikami T, Kono H, Yamauchi R & Ueno Y
(1982) Transferase action of a-galactosidase from tubers
of Stachys affinis. Agric Biol Chem 46, 1089–1090.
31 Hashimoto H, Katayama C, Goto M, Okinaga T &
Kitahata S (1995) Transglycosylation catalyzed by
a-galactosidase from Candida guilliermondii H-404.
Biosci Biotech Biochem 59, 619–623.
32 Van Laere KMJ, Hartemink R, Beldman G, Pitson S,
Dijkema C, Schols HA & Voragen AG (1999) Transgly-
cosidase activity of Bifidobacterium adolescentis DSM
20083 a-galactosidase. Appl Microbiol Biotechnol 52,
681–688.
33 Spangenberg P, Andre
´
C, Dion M, Rabiller C & Mattes

R (2000) Comparative study of new a-galactosidases in
transglycosylation reactions. Carbohydr Res 329, 65–73.
34 Tzortzis G, Jay AJ, Baillon ML, Gibson GR & Rastall
RA (2003) Synthesis of a-galactooligosaccharides with
a-galactosidase from Lactobacillus reuteri of canine
origin. Appl Microbiol Biotechnol 63, 286–292.
35 Hinz SW, Doeswijk-Voragen CH, Schipperus R, Van
den Broek LA, Vincken JP & Voragen AG (2006)
Increasing the transglycosylation activity of a-galactosi-
dase from Bifidobacterium adolescentis DSM 20083 by
site-directed mutagenesis. Biotechnol Bioeng 93, 122–131.
36 Tzortzis G, Goulas AK, Baillon ML, Gibson GR &
Rastall RA (2004) In vitro evaluation of the fermenta-
tion properties of galactooligosaccharides synthesised
by a-galactosidase from Lactobacillus reuteri. Appl
Microbiol Biotechnol 64, 106–111.
37 Desjardins ML & Roy D (1990) Growth of bifidobacte-
ria and their enzyme profiles. J Dairy Sci 73, 299–307.
38 Voragen AGJ (1998) Technological aspects of func-
tional food-related carbohydrates. Trends Food Sci
Technol 9, 328–335.
39 Osumi C, Nozaki J & Kida T. DNA encoding raffinose
synthase from soybean. Patent: US 6891084-A 24
10-MAY-2005; Ajinomoto Co., Inc., Tokyo;JPX;
REMARK. CAMBIA Patent Lens: US 6891084.
40 Peterbauer T, Mucha J, Mayer U, Popp M, Glossl J &
Richter A (1999) Stachyose synthesis in seeds of adzuki
bean (Vigna angularis): molecular cloning and func-
tional expression of stachyose synthase. Plant J 20,
509–518.

41 Peterbauer T, Mucha J, Mach L & Richter A (2002)
Chain elongation of raffinose in pea seeds. Isolation,
characterization, and molecular cloning of mutifunc-
tional enzyme catalyzing the synthesis of stachyose and
verbascose. J Biol Chem 277, 194–200.
42 Nakai K & Horton P (2007) Computational prediction
of subcellular localization. Methods Mol Biol 390, 429–
466.
43 Emanuelsson O, Brunak S, von Heijne G & Nielsen H
(2007) Locating protein in the cell using TargetP,
SignalP, and related tools. Nat Protoc 2, 953–971.
44 Galagan JE, Calvo SE, Cuomo C, Ma LJ, Wortman
JR, Batzoglou S, Lee SI, Bastu
¨
rkmen M, Spevak CC,
Clutterbuck J et al. (2005) Sequencing of Aspergillus
nidulans and comparative analysis with A. fumigatus
and A. oryzae. Nature 438, 1105–1115.
45 Qing G, Ma LC, Khorchid A, Swapna GV, Mal TK,
Takayama MM, Xia B, Phadtare S, Ke H, Acton T
et al. (2004) Cold-shock induced high-yield protein pro-
duction in
Escherichia coli. Nat Biotechnol 22, 877–882.
46 Hsieh HY, Mitra M, Wells DC & Smith D (2000)
Purification and characterization of a-N-acetylgalactosa-
minidase from Clostridium perfringens. IUBMB Life 50,
91–97.
47 Hsieh HY, Calcutt MJ, Chapman LF, Mitra M &
Smith DS (2003) Purification and characterization of a
recombinant a-N-acetylgalactosaminidase from Clostrid-

ium perfringens. Protein Expr Purif 32, 309–316.
48 Srivastava M & Kapoor VP (2005) Seed galactomann-
ans: an overview. Chem Biodivers 2, 295–317.
49 Linder S, Schliwa M & Kube-Granderath E (1996)
Direct PCR screening of Pichia pastoris clones.
BioTechniques 20, 980–982.
Transglycosylation by A. nidulans a-galactosidase H. Nakai et al.
3550 FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS
50 Cregg JM, Vedvick TS & Raschke WC (1993) Recent
advances in the expression of foreign genes in Pichia
pastoris. BioTechnology 11, 905–910.
51 Britton HTK & Robinson RA (1931) Universal buffer
solutions and the dissociation constant of veronal.
J Chem Soc 10, 1456–1462.
52 Westphal Y, Schols HA, Voragen AGJ & Gruppen H
(2010) Introducing porous graphitized carbon liquid
chromatography with evaporative light scattering and
mass spectrometry detection into cell wall oligosaccha-
ride analysis. J Chromatogr 1217, 689–695.
53 Kiefer F, Arnold K, Kunzli B, Bordoli L &
Schwede T (2009) The SWISS-MODEL Repository
and associated resources. Nucleic Acids Res 37,
D387–D392.
Supporting information
The following supplementary material is available:
Fig. S1. SDS ⁄ PAGE of recombinant AglC (4.8 lg).
Table S1.
1
H and
13

C NMR data assignment for
a-galacto-oligosaccharides produced from pNPaGal,
melibiose and raffinose as substrates by transglycosyla-
tion.
Table S2.
1
H and
13
C NMR data assignment for
a-galacto-disaccharides produced with pNPaGal as the
donor and suitable monosaccharide acceptors by trans-
glycosylation.
Table S3.
1
H and
13
C NMR data assignment for
a-galacto-trisaccharides produced from pNPaGal as
the donor and suitable disaccharide acceptors by trans-
glycosylation.
Table S4. Purification conditions of a-galacto-oligosac-
charides by HPLC.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)

should be addressed to the authors.
H. Nakai et al. Transglycosylation by A. nidulans a-galactosidase
FEBS Journal 277 (2010) 3538–3551 ª 2010 The Authors Journal compilation ª 2010 FEBS 3551