Báo cáo khoa học: A novel G-quadruplex motif modulates promoter activity of human thymidine kinase 1 docx

A novel G-quadruplex motif modulates promoter activity
of human thymidine kinase 1
ˆ
Richa Basundra1,*, Akinchan Kumar1,*, Samir Amrane2,*, Anjali Verma1, Anh Tuan Phan2 and
Shantanu Chowdhury1,3
1 Proteomics and Structural Biology Unit, Institute of Genomics and Integrative Biology, CSIR, Delhi, India
2 Division of Physics and Applied Physics, School of Physical and Mathematical Sciences, Nanyang Technological University, Singapore
3 G. N. Ramachandran Knowledge Centre for Genome Informatics, Institute of Genomics and Integrative Biology, CSIR, Delhi, India

Keywords
G-quadruplex; NMR; thymidine kinase 1
Correspondence
S. Chowdhury, G. N. Ramachandran
Knowledge Centre for Genome Informatics,
Institute of Genomics and Integrative
Biology, CSIR, Mall Road, Delhi 110 007,
India
Fax: +91 011 27667471
Tel: +91 011 27666157 ext. 144
E-mail:
A. T. Phan, Division of Physics and Applied
Physics, School of Physical and
Mathematical Sciences, Nanyang
Technological University, Singapore 637371,
Singapore
Fax: 6795 7981
Tel: 6514 1915
E-mail:

G-quadruplex motifs constitute unusual DNA secondary structures formed
by stacking of planar hydrogen-bonded G-tetrads. Recent genome-wide

bioinformatics and experimental analyses have suggested the interesting
possibility that G-quadruplex motifs could be cis-regulatory elements.
Here, we identified a characteristic potential G-quadruplex-forming
sequence element within the promoter of human thymidine kinase 1 (TK1).
Our NMR, UV and CD spectroscopy and gel electrophoresis data suggested that this sequence forms a novel intramolecular G-quadruplex with
two G-tetrads in K+ solution. The results presented here indicate the role
of this G-quadruplex motif in transcription of TK1 in cell-based reporter
assays. Specific nucleotide substitutions designed to destabilize the G-quadruplex motif resulted in increased promoter activity, supporting direct
involvement of the G-quadruplex motif in transcription of TK1. These
studies suggest that the G-quadruplex motif may be an important target
for controlling critical biological processes, such as DNA synthesis, mediated by TK1.

*These authors contributed equally to this
work
(Received 10 October 2009, revised 8 July
2010, accepted 16 August 2010)
doi:10.1111/j.1742-4658.2010.07814.x

Introduction
Nucleotide sequences are established as regulatory elements [1]. However, DNA conformation(s) is relatively
unexplored in a regulatory context. Non-B DNA structures have been implicated in recombination, replication and regulation of gene expression [2–6], in both

prokaryotes [7] and eukaryotes [2,8]. A particular type
of non-B DNA structure, the G-quadruplex motif, has
attracted interest in the context of gene regulation,
owing to reports indicating the prevalence of such
motifs in promoters [9,10]. G-quadruplex motifs are

Abbreviations
TDS, thermal difference spectrum; TK1, thymidine kinase 1; TSS, transcription start site.

4254

FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR). Journal compilation ª 2010 FEBS


R. Basundra et al.

G-quadruplex motif in human thymidine kinase 1

structural conformations formed by consecutive stacking of coplanar arrays of four cyclic hydrogen-bonded
guanines [11–15].
G-quadruplex conformations were first reported in
telomeres [16], and subsequently in other genomic
regions, i.e. immunoglobin heavy chain switch regions
[17], G-rich minisatellites [18] and rDNA [19]. Recently,
genome-wide analysis of recombination-prone regions
showed the enrichment of potential G-quadruplexforming sequences within human hot spots or short recombinogenic regions [20]. In another recent study, it
was proposed that G-quadruplex motifs may act as
nucleosome exclusion signals [21]. Moreover, several
gene promoters, such as b-globin [22], retinoblastoma
susceptibility genes [23], the insulin gene [24], adenovirus serotype 2 [25], PDGF [26], c-KIT [27], hypoxiainducible factor 1a [28], BCL-2 [29] and c-MYC
[10,30,31], harbor G-quadruplex motifs. In genomewide studies, enrichment of G-quadruplex-forming
motifs in promoters of several bacterial [32], chicken
[33] and mammalian genomes, including the human
genome [9,34–36], has been observed, suggesting a widespread regulatory influence of G-quadruplexes. Further
support comes from reports showing that more than
700 orthologous promoters conserve putative G-quadruplex sequences in human, mouse and rat [37], and a
recent genome-wide gene expression study showing that
the expression of many genes, whose promoters harbor

putative G-quadruplex forming sequences, had changes
in the presence of G-quadruplex-binding ligands in two
different human cell lines [36].
A role of G-quadruplex motifs in the transcription
of specific genes has been experimentally demonstrated. In the case of the c-MYC promoter, it was
shown that the purine-rich strand of DNA in the

A

nuclease-hypersensitive region of the promoter can
adopt different intramolecular G-quadruplex conformations. It was further demonstrated that destabilization or stabilization of a G-quadruplex motif resulted
in increased or decreased promoter activity, respectively, in a luciferase reporter assay [30]. Similarly, it
was shown in KRAS [38] and PDGF-A [39] that stabilization of a G-quadruplex motif in the promoter
region with a quadruplex-specific ligand resulted in
decreased promoter activity.
We note that all of the above studies considered
G-quadruplex motifs formed by sequences containing at
least four tracts of three or more consecutive guanines,
which, in principle, can fold into G-quadruplexes with
three stacked G-tetrads. The regulatory role of
G-quadruplex motifs comprising two G-tetrads (Fig. 1A),
where the core involves only two stacked G-tetrads
instead of three, has not been studied. A possible reason for this could be that a stack of two G-tetrads
would confer less stability than a G-quadruplex with
three stacked G-tetrads. Although it has not been studied in a regulatory context, the existence and biological
role of G-quadruplexes with two G-tetrads has been
reported in multiple cases [40–46]. In the retinoblastoma susceptibility gene, it was shown that a potential
two-G-tetrad structure at the 5¢-end of the gene acts as
a barrier to DNA polymerase activity [46]. Likewise,
in an in vitro study, the thrombin-binding aptamer

d(GGTTGGTGTGGTTGG) was reported to form a
unimolecular stable G-quadruplex motif with two
G-tetrads connected by two TT loops and a TGT loop,
which inhibits thrombin-induced fibrin clot formation
[43]. Recently, it was found that human and Giardia
telomeric DNA sequences containing four tracts
of three consecutive guanines can form intramolecular

Loop1

Loop2

G
G

G
G

G

G

G

Fig. 1. G-quadruplex motif and TK1 promoter. (A) Schematic representation of a
G-quadruplex motif with two stacks of
G-tetrad in the core connected by three
loops. (B) The TK1 promoter [62] showing
two potential G-quadruplex-forming
sequences: TKQ1 (bold) and TKQ2

(underlined). The TSS is indicated by the
arrowhead.

G

5′

3′

Loop3

B
AAATCTCCCGCCAGGTCAGCGGCCGGGCGCTGATTGGCCCCATGGCGGCGGGGCCGGC
TCGTGATTGGCCAGCACGCCGTGGTTTAAAGCGGTCGGCGCGGGAACCAGGGGCTTAC
TGCGGGACGGCCTTGGAGAGTACTCGGGTTCGTGAACTTCCCGGAGGCGCAATGAGCT

FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR). Journal compilation ª 2010 FEBS

4255


G-quadruplex motif in human thymidine kinase 1

G-quadruplexes comprising only two G-tetrads in K+
solution, and, interestingly, these structures can be
more stable than other G-quadruplex conformations
comprising three G-tetrads [47–50].
Here, we have identified a characteristic potential
G-quadruplex-forming sequence element, containing
several tracts of two consecutive guanines, within the

promoter of human thymidine kinase 1 (TK1). Thymidine kinase is a critical enzyme required for the
production of TTP during DNA synthesis, and is
therefore ubiquitously conserved in prokaryotes and
eukaryotes. It is tightly regulated during the cell cycle,
and has been shown to increase protein promoter
activity more than 10-fold during S-phase, to meet
demands for increased TTP synthesis; enzymatic activity remains high until about the time of cell division,
and then decreases rapidly [51]. We show, by a series
of biophysical and biochemical experiments, including
NMR, UV and CD spectroscopy and gel electrophoresis, that this sequence forms a novel intramolecular
G-quadruplex with two G-tetrads in K+ solution.
Using intracellular reporter experiments, we observed
that the promoter activity of TK1 is directly influenced
by specific nucleotide substitutions that disrupt the
G-quadruplex motif.

Results
Identification of potential G-quadruplex-forming
sequences within the TK1 promoter
We used a customized perl program to search for
potential G-quadruplex-forming motifs G2–5L1–7G2–
5L1–7G2–5L1–7G2–5, which contained at least four runs
of two to five guanines separated by linkers of one to
seven nucleotides. We identified two such motifs within
the functional promoter of TK1, spanning from )89 to
+58 of the transcription start site (TSS) [52]. The two
identified sequences were designated TKQ1 ()13 to
+8) and TKQ2 ()47 to )68) (Table 1). Their locations
within the TK1 promoter are shown in Fig. 1B. TKQ1
harbors two tracts of two guanines, one of three guanines and one of four guanines. The G-tracts are separated by linkers composed of two, three and five

Table 1. Oligonucleotides used in the study (5¢- to 3¢). G-tracts are
underlined. One or two guanines were replaced by the same number of adenines in the modified oligonucleotides (bold).
TKQ1
TKQ1m
TKQ2
TKQ2m

4256

GGTCGGCGCGGGAACCAGGGG
GGTCGGCGCAAGAACCAGGGG
GGCCCCATGGCGGCGGGGCCGG
GGCCCCATGACGGCGGGGCCGG

R. Basundra et al.

nucleotides, respectively. TKQ2 comprises four tracts
of two guanines and one of four guanines, separated
by linkers of one, two or six nucleotides.
TKQ1 forms a G-quadruplex structure – NMR
study
In order to determine whether TKQ1 and TKQ2 form
G-quadruplex structures, we recorded their NMR
spectra in K+ solution. The imino proton spectrum of
TKQ1 (Fig. 2A, top) displayed sharp peaks between
10 and 12 p.p.m., which were characteristic of G-quadruplex formation, whereas the imino proton spectrum
of TKQ2 (Fig. 2B, top) displayed peaks only at
 13 p.p.m., which probably resulted from Watson–
Crick base pairing. For the spectrum of TKQ1, the
observation of eight major sharp imino proton peaks

between 10 and 12 p.p.m. was consistent with formation of a major G-quadruplex structure involving two
G-tetrad layers; three major sharp peaks between 12
and 14 p.p.m. might come from other base pairing
alignments, e.g. Watson–Crick or Hoogsteen base pairs
in the loops of the G-quadruplex; minor sharp peaks
between 10 and 12 p.p.m. should represent minor
G-quadruplex conformation(s); a rather big hump in
this region reflected yet other conformation(s) adopted
by TKQ1. For the spectrum of TKQ2, very little signal

A

14.0

13.0

12.0

11.0

10.0 p.p.m.

13.0

12.0

11.0

10.0 p.p.m.

B

14.0

Fig. 2. NMR spectroscopy. Imino proton spectra of: (A) TKQ1 (top)
and TKQ1m (bottom); and (B) TKQ2 (top) and TKQ2m (bottom).
Experimental conditions: DNA concentration, 0.5 mM; temperature,
25 °C; 70 mM KCl; 20 mM potassium phosphate (pH 7.0).

FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR). Journal compilation ª 2010 FEBS


R. Basundra et al.

G-quadruplex motif in human thymidine kinase 1

between 10 and 12 p.p.m. was observed, indicating the
presence of insignificant populations of G-quadruplex(es). Imino protons at  13 p.p.m. might suggest
the formation of DNA duplex(es) or hairpin(s) involving
Watson–Crick base pairs, consistent with the presence
of complementary fragments G1–G2–C2–C4–C5–C6
and G15–G16–G17–G18–C19–C20 in TKQ2, which
would participate in the formation of the stem of a
hairpin or a duplex.
To further probe the G-quadruplex-forming potential of TKQ1 and TKQ2, we designed two modified
sequences, TKQ1m and TKQ2m (Table 1), in which a
G-tract was disrupted by G-to-A substitutions. For
TKQ1m, no sharp imino proton peaks between 10 and
12 p.p.m. were observed (Fig. 2A, bottom), indicating
that the TKQ1 G-quadruplex(es) were disrupted; imino

protons at 12–13 p.p.m. suggested the formation of a
few base pairs of a residual structure such as a hairpin
(see gel electrophoresis data below). The imino proton
spectrum of TKQ2m (Fig. 2B, bottom), like that of
TKQ2, exhibited peaks only at  13 p.p.m., indicative
of other types of base pairing alignments (e.g. Watson–Crick base pairs), rather than those in G-tetrads.
In order to test the effect of flanking bases on the
G-quadruplex formation of TKQ1, we analyzed the
NMR spectrum of a DNA sequence containing four
additional bases (two on each side). Although the
imino proton spectrum of the new sequence was now
not well-resolved, and peaks at 13 p.p.m. were
observed, the presence of peaks at 10–12 p.p.m. indicated the existence of G-quadruplexes (Fig. S1).

TDS of TKQ1 displayed two positive maxima at 245
and 275 nm and one negative minimum at 295 nm. In
contrast, TDS profiles of TKQ1m, TKQ2 and TKQ2m
did not present any negative peak at 295 nm, but only
major positive peaks at 250–275 nm, consistent with
NMR observations that these sequences did not adopt
G-quadruplex structures. The G-to-A mutations completely disrupted the G-quadruplex TDS signature of
TKQ1, but showed little effect on the TDS of TKQ2.
The CD spectra of TKQ1, TKQ1m, TKQ2 and
TKQ2m are presented in Fig. 4. They show negative
peaks at  240 nm and positive peaks from 265 to
290 nm. It is difficult to confirm or disprove the formation of G-quadruplexes based solely on CD signatures, particularly if multiple structures coexist [49]. It
has been reported that parallel-stranded G-quadruplexes give a positive peak at 260 nm and a negative peak
at 240 nm, whereas antiparallel-stranded G-quadruplexes give a positive peak at 290–295 nm and a negative peak at 265 nm [54]. The CD spectrum of TKQ1
showed a positive peak at 290 nm, a positive shoulder
at 260 nm, and a negative peak at 240 nm. This spectrum could correspond to a mixture of different

G-quadruplex conformations or a mixed parallel ⁄ antiparallel G-quadruplex [47,49,55]. The CD profile of
TKQ1 was significantly different from that of the modified sequence TKQ1m (Fig. 4A), whereas modification
of the TKQ2 sequence resulted in only a small spectral
change (Fig. 4B). This observation is consistent with
the NMR and TDS data shown above, supporting the
observation that, among the four sequences, only
TKQ1 forms a significant population of G-quadruplex(es).

A novel G-quadruplex motif of TKQ1 – TDS and
CD signatures

Thermal stability of TKQ1 – UV melting
experiments

Thermal difference spectrum (TDS) signatures of
TKQ1, TKQ1m, TKQ2 and TKQ2m are shown in
Fig. 3. Only the TDS profile of TKQ1 exhibited a signature compatible with G-quadruplex structures [53].

A

To assess the thermal stability of the structures of
TKQ1, TKQ1m, TKQ2 and TKQ2m, we performed

B

1

1
0.8

Normalized TDS

Fig. 3. Normalized UV absorbance TDS of:
(A) TKQ1 (continuous line) and TKQ1m (red
dotted line); and (B) TKQ2 (continuous line)
and TKQ2m (red dotted line). Experimental
conditions: DNA concentration, 4 lM;
70 mM KCl; 20 mM potassium phosphate
(pH 7.0).

Normalized TDS

0.8
0.6
0.4
0.2
0

0.4
0.2
0

–0.2

–0.2
–0.4
220

0.6

–0.4
240

260

280

300

Wavelength (nm)

320

220

240

260

280

300

320

Wavelength (nm)

FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR). Journal compilation ª 2010 FEBS

4257

G-quadruplex motif in human thymidine kinase 1

A

R. Basundra et al.

B
2.5

Molar ellipticity (103 deg·M–1)

Molar ellipticity (103 deg·M–1)

2.5
2
1.5
1
0.5
0
–0.5
–1
220

240 260 280 300
Wavelength (nm)

2
1.5

1
0.5
0
–0.5
–1
220

320

240 260 280 300
Wavelength (nm)

at 500 mm K+ (Fig. 5D). In the cases of TKQ1m,
TKQ2 and TKQ2m, the increase in the 295 nm absorbance when the temperature increased and ⁄ or the
absence of significant cooperative transitions showed
that these sequences did not form G-quadruplexes.

0.19
0.185

0.185

0.16

0.17
0.15
0.165
0.14

0.16

20

30

40

50

60

70

80

90

Absorbance at 295 nm

0.175

0.18
0.165
0.175
0.16

0.17
0.165

0.155

0.13

0.16
0.15

20

30

Temperature (°C)

D

0.18

0.2
0.192

50

60

70

80

0.17

0.184

0.16
0.176
0.15

0.168
0.16

55
50

Tm (°C)

0.19
0.208

Absorbance at 295 nm

Absorbance at 295 nm

40

Temperature (°C)

45
40
35

0.14
20

30

40

50

60

70

Temperature (°C)

80

90

30
0

100

200 300 400
KCl (mM)

500

90

0.155

Absorbance at 295 nm

0.17

0.18

4258

Native PAGE was performed to assess the molecular
sizes and shapes of the structures formed by TKQ1
and TKQ2. A 21-nucleotide oligonucleotide (dT21) for
TKQ1 and a 22-nucleotide oligonucleotide (dT22) for
TKQ2 were used as controls to check relative mobility.
TKQ1 migrated faster than dT21 of the same length
(Fig. 6A), consistent with the formation of a monomeric intramolecular G-quadruplex structure of

0.17

B

0.155

C

Native gel electrophoresis

0.18

Absorbance at 295 nm

Absorbance at 295 nm

melting experiments. Folding ⁄ unfolding processes of
G-quadruplexes can be monitored by the change in
UV absorption at 295 nm as a function of temperature
[56]. Typical denaturation profiles of TKQ1, TKQ1m,
TKQ2 and TKQ2m, as measured by the 295 nm
absorbance, are presented in Fig. 5A,B. At heating
and cooling rates of 0.5 °CỈmin)1, the melting and
folding profiles were superimposable, indicating equilibrium processes. Only TKQ1 exhibited a characteristic profile of G-quadruplex melting curves, with a
decrease in the 295 nm absorbance upon increasing
temperature. The G-quadruplex melting ⁄ folding transition of TKQ1 was more evident in the presence of
higher K+ concentrations (Fig. 5C). The stability of
the structure increased as the K+ concentration
increased, and its melting temperature reached 50 °C
A

320

Fig. 4. CD spectra of: (A) TKQ1 (continuous
line) and TKQ1m (red dotted line); and (B)
TKQ2 (continuous line) and TKQ2m (red dotted line). Experimental conditions: DNA
concentration, 4 lM; temperature, 20 °C;
70 mM KCl; 20 mM potassium phosphate
(pH 7.0).

Fig. 5. UV melting curves recorded at
295 nm, with a DNA concentration of 4 lM.
(A) TKQ1 (filled circles, left axis) and TKQ1m
(red open circles, right axis). The buffer contained 70 mM KCl and 20 mM potassium

phosphate (pH 7.0). (B) TKQ2 (filled circles,
left axis) and TKQ2m (red open circles, right
axis). The buffer contained 70 mM KCl and
20 mM potassium phosphate (pH 7.0). (C)
Melting profiles of TKQ1 recorded at different KCl concentrations: 70 mM (continuous
line), 300 mM (dotted line), 400 mM (green
squares) and 500 mM (red open circles). All
experiments were performed in the presence of 20 mM potassium phosphate
(pH 7.0). Right axis for 300, 400, 500 mM
KCl; left axis for 70 mM KCl. (D) Plot of
the melting temperature (Tm) of TKQ1 as a
function of KCl concentration.

FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR). Journal compilation ª 2010 FEBS


TKQ2m

TKQ2

B
dT22

dT21

A

TKQ1m

G-quadruplex motif in human thymidine kinase 1

TKQ1

R. Basundra et al.

Fig. 6. Native gel electrophoresis. PAGE of potential G-quadruplexforming sequences and their modified variants under nondenaturing
(native) conditions. (A) dT21 marker, TKQ1, and TKQ1m. (B) dT22
marker, TKQ2, and TKQ2m. Experimental conditions: 15% nondenaturing polyacrylamide gel, 70 mM KCl in 1· TAE.

TKQ1. TKQ1m, on the other hand, migrated more
slowly than TKQ1 but faster than dT21. The migration profile of TKQ1m is consistent with the disruption of the TKQ1 G-quadruplex structure, resulting in
a less compact intramolecular structure (e.g. a hairpin,
as suggested by NMR data), induced by G-to-A substitutions.
In contrast, migrations of TKQ2 and TKQ2m were
similar and both faster than that of dT22 (Fig. 6B).
This result was in agreement with NMR, UV and CD
data indicating the absence of quadruplex formation
by TKQ2: the G-to-A mutation that was designed to
specifically disrupt potential quadruplex formation did
not induce a significant conformational change. A
slightly faster migration of TKQ2 and TKQ2m than of
dT22 could be explained by the formation of an intramolecular structure, such as a hairpin involving
Watson–Crick base pairs.

transcription of TK1. To test this hypothesis, the functional promoter of TK1 [52] (Fig. 1B) was cloned
upstream of the firefly luciferase gene in the pGL2 promoter (pTK1), and the promoter activity of pTK1 was
measured 24 and 48 h after transfection in A549 cells
(see Experimental procedures). The difference in transfection efficiency was normalized with Renilla luciferase expression in each case. As discussed above,
in vitro, TKQ1 forms an intramolecular G-quadruplex,
whereas TKQ1m does not. We anticipated that if the

G-quadruplex adopted by TKQ1 was involved in the
transcription of TK1, specific nucleotide substitutions
that disrupted this G-quadruplex (e.g. TKQ1m) would
alter the luciferase activity. We found 2-fold and
2.7-fold increases in promoter activity at 24 and 48 h,
respectively, for promoter pTKQ1m (carrying the
TKQ1m modification) relative to pTK1 (Fig. 7). Furthermore, as an additional control, we studied the
sequence TKQ2 (Table 1). Although TKQ2 contains
several G-tracts, it was shown that this sequence does
not form G-quadruplexes in vitro. Therefore, in contrast the situation with TKQ1, we expected that a
mutation within TKQ2 would not affect TK1 promoter activity. Indeed, we noted no change in the promoter activity of pTKQ2m (carrying the TKQ2m
modification) relative to that of pTK1 at 24 h, whereas
there was a marginal decrease at 48 h (Fig. 7). Taken
together, these results suggested that the G-quadruplex
adopted by TKQ1 may be involved in suppression of
TK1 promoter activity.
3

24 h
48 h

Previously, it has been reported that stabilization of a
G-quadruplex motif in the c-MYC promoter by the
specific ligand TMPyP4 results in decreased promoter
activity. On the other hand, substitution of a single
nucleotide (G to A) that was critical for the G-quadruplex motif gave approximately three-fold increased
promoter activity [30]. Another such example is
PDGF-A, where a stable parallel G-quadruplex motif
in the promoter was shown to regulate PDGF-A
expression [39]. Regulation of transcription by a

G-quadruplex motif has also been demonstrated in the
case of the KRAS proto-oncogene, where, in the presence of the cationic porphyrin TMPyP4, promoter
activity is reduced to 20% of the normal value [38].
We hypothesized that formation of a G-quadruplex
structure by TKQ1 could be of significance in the

Relative fold change

2.5

Base substitutions in TKQ1 result in increased
promoter activity

2

1.5

1

0.5

0

pTK1

pTKQ1m

pTKQ2m

Fig. 7. G-quadruplex motif alters the activity of the TK1 promoter.

Normalized luciferase activity of pTKQ1m and pTKQ2m relative to
pTK1 at 24 and 48 h following transfection in human lung cancer
cells A549. Error bars in all experiments denote standard deviation
observed across three independent experiments.

FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR). Journal compilation ª 2010 FEBS

4259


G-quadruplex motif in human thymidine kinase 1

Discussion
We identified two potential G-quadruplex-forming
sequences, TKQ1 and TKQ2 (Fig. 1B), within the minimal functional promoter of human TK1, which was
taken from )89 to +58 with reference to the TSS. In
a study by Arcot et al. [52], it was shown that progressive deletion of upstream regions from the promoter
()457 to +34 with respect to the TSS) of human TK1
resulted in decreased chloramphenicol acetyltransferase
activity, wherein the minimal promoter region from
)88 to +34 was shown to have an activity of 28 (normalized chloramphenicol acetyltransferase activity).
We were interested in deciphering the effect of two
potential G-quadruplex-forming sequences found in
this minimal promoter region on promoter activity.
Of these, TKQ1 showed characteristics of a novel
G-quadruplex motif in vitro, whereas TKQ2 did not.
This was confirmed by incorporating specific nucleotide substitutions within TKQ1 and TKQ2 (TKQ1m
and TKQ2m, respectively) that were intended to disrupt the G-quadruplex motif. TKQ1m showed clear
signs of losing secondary structure; in contrast,
TKQ2m did not show any noticeable change. These

findings were supported by biophysical and biochemical experiments, including NMR, UV and CD spectroscopy and gel electrophoresis. Interestingly, we
observed that TKQ1, but not TKQ2, appeared to
affect the promoter activity of TK1 in A549 cells. The
fact that disruption of TKQ1, but not TKQ2, leads to
an appreciable change in the promoter activity of
pTK1 suggests involvement of the G-quadruplex motif
formed by TKQ1 in regulating TK1 expression. Interestingly, to the best of our knowledge, TKQ1 is the
first G-quadruplex motif overlapping a TSS to be
reported, and it is therefore possible that it functions
independently of any transcription factor binding. In
line with this, we did not find any transcription factorbinding site overlapping the TKQ1 sequence (searched
for with transfac 2.1).
The characteristic nature of the TK1 G-quadruplex
motif with tracts of two guanines is noteworthy.
Although this is the first time that it has been studied
in a regulatory context, examples of its biological role
have been reported. Apart from the retinoblastoma
susceptibility gene and the thrombin-binding aptamer
(see above), GGA triplet repeats that may adopt
G-quadruplex motifs with a core of two G-tetrads [44]
are widely dispersed throughout eukaryotic genomes,
and are frequently located within biologically important gene regulatory regions and recombination hot
spots. The Bombyx mori telomere repeat d(TTAGG)
[42,57] and the yeast telomeric repeat d(TGGTGGC)
4260

R. Basundra et al.

[45] were also shown to form stable G-quadruplex
motifs. Interestingly, the nick site for adenoassociated

virus type 2 on human chromosome 19 was observed
to fold into a quadruplex structure. The sequence,
GGCGGCGGTTGGGGCTCG, indicates a quadruplex motif comprising two G-tetrads in the core [41].
In addition to this, RNA sequences containing runs of
two guanines could also form quadruplex motifs and
be physiological targets of the fragile X mental retardation protein [40]. However, we note that the presence of several tracts of two guanines or three
guanines does not necessarily imply the formation of
two-G-tetrad or three-G-tetrad structures, respectively.
Recent structural studies of G-quadruplexes [58,59]
revealed various unusual folding patterns: for a
G-quadruplex formed in the c-MYC promoter [58], a
guanine in a continuous G-tract is not involved in the
G-tetrad core, but is displaced by a ‘snap-back’ guanine further downstream in the sequence; for a G-quadruplex in the c-KIT promoter [59], an isolated guanine
is involved in G-tetrad core formation, despite the
presence of four-three-guanine tracts. In an analogous
way, it is possible that the G-quadruplex motif
adopted by the TKQ1 sequence involves not only
G-tracts but also one or more isolated guanines in the
tetrad formation.
Consistent with the expectation that a G-quadruplex
motif with only two stacked G-tetrads would be of
low stability, the melting temperature of the G-quadruplex motif adopted by TKQ1 was  35–40 °C at
90 mm K+, and increased at higher K+ concentrations. In contrast to the general belief that such structures may be of limited significance, we observed a
significant change in promoter activity that was influenced by the presence ⁄ absence of the G-quadruplex
motif formed by TKQ1. Furthermore, one must consider that the formation of such structures in vivo may
be facilitated by various cellular factors, proteins or
other intracellular ligands. Consistent with this, several
proteins that bind G-quadruplex motifs have been
reported [60], supporting the possibility that quadruplex motifs are sequestered by proteins inside cells, in
which case protein recognition would be critical relative to stability per se. It can also be argued that

motifs of moderate ⁄ low stability could be useful, in
relation to stable ones, in potential regulatory roles
where the contextual presence ⁄ absence of the structure
could be significant. However, more evidence is
required to distinguish between these possibilities.
In conclusion, our results identify a novel G-quadruplex motif in the promoter of TK1 and suggest its role
as a ‘repressor’ element in the transcription of TK1, as
specific disruption of the quadruplex motif resulted in

FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR). Journal compilation ª 2010 FEBS


R. Basundra et al.

increased promoter activity. A role for a G-quadruplex
motif constituting two stacks of G-tetrads in gene transcription has not been reported before, and therefore
this study opens yet another avenue for exploration of
the role of quadruplex motifs.

Experimental procedures
DNA sample preparation
Oligonucleotides (Table 1) were chemically synthesized at a
1 lmol scale on an ABI 394 synthesizer, and purified with
cartridges (Poly Pack II; Glen Research) as described by
the manufacturer. All concentrations were expressed in
strand molarity, using a nearest-neighbor approximation
for the absorption coefficients of the unfolded species [61].
Samples were dialyzed successively against  50 mm KCl
solution and against water. Unless otherwise stated, experiments were carried out in a buffer containing 20 mm potassium phosphate (pH 7) and 70 mm KCl.

NMR spectroscopy
NMR experiments were performed on 600 MHz and
700 MHz Bruker spectrometers at 25 °C. Proton spectra in
H2O were recorded using JR-type pulse sequences for water
suppression [62,63]. The DNA concentration in NMR samples was typically 0.5 mm. The solution contained 90%
H2O and 10% D2O. The oligonucleotides were heated at
95 °C for 10 min, and allowed to slowly cool down to
room temperature overnight.

UV melting experiments
The thermal stability of different oligonucleotides was characterized in heating ⁄ cooling experiments by recording the
UV absorbance at 295 nm as a function of temperature
[53], with a Cary 300 VARIAN Bio UV ⁄ Vis spectrophotometer. The heating and cooling rates were 0.5 °CỈmin)1.
Experiments were performed with 1 cm pathlength quartz
cuvettes. The DNA concentration was 4 lm. All melting
profiles were perfectly reversible at the chosen temperature
gradient, indicating that these curves corresponded to the
equilibrium curves.

TDSs
The TDS of a nucleic acid is obtained by simply recording
the UV absorbance spectra of the unfolded and folded
states at temperatures, respectively, above and below its
melting temperature (Tm). The difference between these two
spectra is defined as the TDS. The TDS can provide specific
signatures of different DNA and RNA structural conformations [50]. Spectra were recorded between 220 and

G-quadruplex motif in human thymidine kinase 1

320 nm on a Cary 300 VARIAN Bio UV ⁄ Vis spectrophotometer, using quartz cuvettes with an optical pathlength of

1 cm. The DNA concentration was 4 lm.

CD
CD spectra were recorded on a JASCO-810 spectropolarimeter, using a 1 cm pathlength quartz cuvette in a reaction
volume of 800 lL. The concentration of oligonucleotides
was 4 lm. They were heated at 95 °C for 10 min, and
allowed to slowly cool down to room temperature overnight. Scans were performed at 20 °C over a wavelength
range of 220–320 nm, with a scanning speed of
200 nm min)1. An average of three scans was taken, the
spectrum of the buffer was subtracted, and the data were
zero-corrected at 320 nm. The spectra were finally normalized to the concentration of the DNA samples.

Nondenaturing gel electrophoresis
Oligonucleotides were end-labeled with [32P]ATP[cP], using
T4 polynucleotide kinase. Labeled oligonucleotides were
purified with Sephadex G25 columns to remove free ATP.
Corresponding 21-nucleotide and 22-nucleotide marker oligonucleotides (dT21 and dT22) were prepared similarly.
Labeled oligonucleotides were heated at 95 °C in 20 mm
potassium phosphate buffer (pH 7.0) containing 70 mm
KCl for 10 min, and then gradually cooled to room temperature overnight. The samples were run on nondenaturing
15% polyacrylamide gel containing 70 mm KCl in 1· TAE
buffer at 100 V for 4 h.

Plasmid construction and site-directed
mutagenesis
The promoter sequence of  151 base pairs, including the
minimal functional promoter region based on previous
experimental characterization of TK1 [61], was amplified
from genomic DNA with forward (5¢-AAATCTCCCCTC
GAGTCAGCGG-3¢) and reverse (5¢-AGCTCATTAAGCT

TCCGGGAAGTTC-3¢) primers harboring restriction sites
for XhoI and HindIII, respectively. The amplified product
was purified from gel, and then subjected to restriction digestion with both enzymes. The digested product was cloned
upstream of the firefly luciferase gene in the pGL2 (basic)
vector from Promega (Madison, WI, USA), which was also
digested with XhoI and HindIII. The clones obtained were
then screened by restriction digestion with XhoI and HindIII
and further confirmed by sequencing. Two independent
site-directed mutants were made, representing: (a) TKQ1m
(with a GG to AA substitution in TKQ1); and (b) TKQ2m
(with a G to A substitution in TKQ2; see Table 1). Substitutions were incorporated by the use of primers containing the
desired mutation, with the Quick Change Site-Directed
mutagenesis Kit from Stratagene, according to the

FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR). Journal compilation ª 2010 FEBS

4261


G-quadruplex motif in human thymidine kinase 1

manufacturer’s protocol. Plasmids were
sequencing to obtain the desired mutant.

R. Basundra et al.

screened

by

Transfection and luciferase assay
Human lung cancer cell line A549 was cultured in DMEM.
One day prior to transfection  6 · 105 cells per well were
seeded in a six-well plate to obtain  90–95% confluent cells
before transfection. Transfection was performed with Lipofectamine 2000 (Invitrogen, Invitrogen BioServices India
Pvt. Ltd, Whitefield, Bangalore), according to the manufacturer’s protocol. For normalization of transfection efficiency,
Renilla luciferase plasmid (pGL4 from Promega) was cotransfected in each well. Cells were lysed either 24 or 48 h
after transfection, and luciferase assays were performed for
both firefly (pGL2) and Renilla (pGL4) luciferase in each
sample, with the dual luciferase assay kit from Promega,
according to the manufacturer’s protocol. Firefly luciferase
counts were normalized with Renilla luciferase counts. Three
independent experiments were performed in triplicate, and
the results were used for the measurement of standard deviation. All reporter assays were conducted at 25 °C.

Acknowledgements
We thank members of the Chowdhury laboratory for
helpful discussion and comments on the manuscript,
and V. Yadav for assistance with making some of the
figures. This research was supported by fellowships
from CSIR (A. Kumar and A. Verma) and research
grants to S. Chowdhury from the Department of
Science and Technology (DST ⁄ SJF ⁄ LS-03). R. Basundra
is in receipt of a project fellowship from CMM 0017
(CSIR Task Force Project). Research performed in the
Phan laboratory was supported by Singapore Ministry
of Education grant ARC30 ⁄ 07, Nanyang Technological University (NTU) grant RG62 ⁄ 07 and Singapore
Biomedical Research Council grant 07 ⁄ 1 ⁄ 22 ⁄ 19 ⁄ 542 to
A. T. Phan. We thank the Division of Chemistry and
Biological Chemistry (NTU School of Physical and

Mathematical Sciences) and the NTU School of Biological Sciences for granting us access to their CD
spectropolarimeter and NMR spectrometers. We thank
Professor L. Nordenskiold (NTU School of Biological
ă
Sciences) for allowing us to use the UV spectrophotometer of his laboratory.

References
1 Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V,
Lindblad-Toh K, Lander ES & Kellis M (2005) Systematic discovery of regulatory motifs in human promoters
and 3¢ UTRs by comparison of several mammals.
Nature 434, 338–345.

4262

2 Bacolla A & Wells RD (2004) Non-B DNA conformations, genomic rearrangements, and human disease.
J Biol Chem 279, 47411–47414.
3 Pedersen AG, Jensen LJ, Brunak S, Staerfeldt HH &
Ussery DW (2000) A DNA structural atlas for Escherichia coli. J Mol Biol 299, 907–930.
4 Perez-Martin J & de Lorenzo V (1997) Clues and consequences of DNA bending in transcription. Annu Rev
Microbiol 51, 593–628.
5 Sinden RR (1994) DNA: Structure and Function.
Academic Press, San Diego.
6 Wells RD (2007) Non-B DNA conformations, mutagenesis and disease. Trends Biochem Sci 32, 271–278.
7 Hatfield GW & Benham CJ (2002) DNA topology-mediated control of global gene expression in Escherichia
coli. Annu Rev Genet 36, 175–203.
8 Rich A & Zhang S (2003) Timeline: Z-DNA: the long
road to biological function. Nat Rev Genet 4, 566–572.
9 Huppert JL & Balasubramanian S (2007) G-quadruplexes in promoters throughout the human genome.
Nucleic Acids Res 35, 406–413.
10 Simonsson T, Pecinka P & Kubista M (1998) DNA

tetraplex formation in the control region of c-myc.
Nucleic Acids Res 26, 1167–1172.
11 Burge S, Parkinson GN, Hazel P, Todd AK & Neidle S
(2006) Quadruplex DNA: sequence, topology and structure. Nucleic Acids Res 34, 5402–5415.
12 Davis JT (2004) G-quartets 40 years later: from
5¢-GMP to molecular biology and supramolecular
chemistry. Angew Chem Int Ed Engl 43, 668–698.
13 Gellert M, Lipsett MN & Davies DR (1962) Helix
formation by guanylic acid. Proc Natl Acad Sci USA
48, 2013–2018.
14 Patel DJ, Phan AT & Kuryavyi V (2007) Human telomere, oncogenic promoter and 5¢-UTR G-quadruplexes:
diverse higher order DNA and RNA targets for cancer
therapeutics. Nucleic Acids Res 35, 7429–7455.
15 Sen D & Gilbert W (1988) Formation of parallel fourstranded complexes by guanine-rich motifs in DNA and
its implications for meiosis. Nature 334, 364–366.
16 Williamson JR, Raghuraman MK & Cech TR (1989)
Monovalent cation-induced structure of telomeric
DNA: the G-quartet model. Cell 59, 871–880.
17 Dunnick W, Hertz GZ, Scappino L & Gritzmacher C
(1993) DNA sequences at immunoglobulin switch
region recombination sites. Nucleic Acids Res 21, 365–
372.
18 Weitzmann MN, Woodford KJ & Usdin K (1997)
DNA secondary structures and the evolution of hypervariable tandem arrays. J Biol Chem 272, 9517–9523.
19 Hanakahi LA, Sun H & Maizels N (1999) High affinity
interactions of nucleolin with G-G-paired rDNA. J Biol
Chem 274, 15908–15912.
20 Mani P, Yadav VK, Das SK & Chowdhury S (2009)
Genome-wide analyses of recombination prone regions

FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR). Journal compilation ª 2010 FEBS


R. Basundra et al.

21

22

23

24

25

26

27

28

29

30

31

32

predict role of DNA structural motif in recombination.

PLoS ONE 4, e4399.
Halder K, Halder R & Chowdhury S (2009) Genomewide analysis predicts DNA structural motifs as nucleosome exclusion signals. Mol Biosyst 5, 1703–1712.
Howell RM, Woodford KJ, Weitzmann MN & Usdin
K (1996) The chicken beta-globin gene promoter forms
a novel ‘cinched’ tetrahelical structure. J Biol Chem
271, 5208–5214.
Murchie AI & Lilley DM (1992) Retinoblastoma susceptibility genes contain 5¢ sequences with a high propensity to form guanine-tetrad structures. Nucleic Acids
Res 20, 49–53.
Catasti P, Chen X, Moyzis RK, Bradbury EM &
Gupta G (1996) Structure–function correlations of the
insulin-linked polymorphic region. J Mol Biol 264,
534–545.
Kilpatrick MW, Torri A, Kang DS, Engler JA & Wells
RD (1986) Unusual DNA structures in the adenovirus
genome. J Biol Chem 261, 11350–11354.
Ma D, Xing Z, Liu B, Pedigo NG, Zimmer SG, Bai Z,
Postel EH & Kaetzel DM (2002) NM23-H1 and NM23H2 repress transcriptional activities of nuclease-hypersensitive elements in the platelet-derived growth factorA promoter. J Biol Chem 277, 1560–1567.
Rankin S, Reszka AP, Huppert J, Zloh M, Parkinson
GN, Todd AK, Ladame S, Balasubramanian S &
Neidle S (2005) Putative DNA quadruplex formation
within the human c-kit oncogene. J Am Chem Soc 127,
10584–10589.
De AR, Wood S, Sun D, Hurley LH & Ebbinghaus
SW (2005) Evidence for the presence of a guanine quadruplex forming region within a polypurine tract of the
hypoxia inducible factor 1alpha promoter. Biochemistry
44, 16341–16350.
Dexheimer TS, Sun D & Hurley LH (2006) Deconvoluting the structural and drug-recognition complexity of
the G-quadruplex-forming region upstream of the bcl-2
P1 promoter. J Am Chem Soc 128, 5404–5415.
Siddiqui-Jain A, Grand CL, Bearss DJ & Hurley LH

(2002) Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to
repress c-MYC transcription. Proc Natl Acad Sci USA
99, 11593–11598.
Thakur RK, Kumar P, Halder K, Verma A, Kar A,
Parent JL, Basundra R, Kumar A & Chowdhury S
(2009) Metastases suppressor NM23-H2 interaction
with G-quadruplex DNA within c-MYC promoter
nuclease hypersensitive element induces c-MYC expression. Nucleic Acids Res 37, 172–183.
Rawal P, Kummarasetti VB, Ravindran J, Kumar N,
Halder K, Sharma R, Mukerji M, Das SK & Chowdhury S (2006) Genome-wide prediction of G4 DNA as
regulatory motifs: role in Escherichia coli global
regulation. Genome Res 16, 644–655.

G-quadruplex motif in human thymidine kinase 1

33 Du Z, Kong P, Gao Y & Li N (2007) Enrichment of
G4 DNA motif in transcriptional regulatory region of
chicken genome. Biochem Biophys Res Commun 354,
1067–1070.
34 Yadav VK, Abraham JK, Mani P, Kulshrestha R &
Chowdhury S (2008) QuadBase: genome-wide database
of G4 DNA – occurrence and conservation in human,
chimpanzee, mouse and rat promoters and 146
microbes. Nucleic Acids Res 36, D381–D385.
35 Zhao Y, Du Z & Li N (2007) Extensive selection for
the enrichment of G4 DNA motifs in transcriptional
regulatory regions of warm blooded animals. FEBS Lett
581, 1951–1956.
36 Verma A, Yadav VK, Basundra R, Kumar A &
Chowdhury S (2009) Evidence of genome-wide G4

DNA-mediated gene expression in human cancer cells.
Nucleic Acids Res 37, 4194–4204.
37 Verma A, Halder K, Halder R, Yadav VK, Rawal P,
Thakur RK, Mohd F, Sharma A & Chowdhury S
(2008) Genome-wide computational and expression
analyses reveal G-quadruplex DNA motifs as conserved
cis-regulatory elements in human and related species.
J Med Chem 51, 5641–5649.
38 Cogoi S & Xodo LE (2006) G-quadruplex formation
within the promoter of the KRAS proto-oncogene and
its effect on transcription. Nucleic Acids Res 34, 2536–
2549.
39 Qin Y, Rezler EM, Gokhale V, Sun D & Hurley LH
(2007) Characterization of the G-quadruplexes in
the duplex nuclease hypersensitive element of the
PDGF-A promoter and modulation of PDGF-A
promoter activity by TMPyP4. Nucleic Acids Res 35,
7698–7713.
40 Darnell JC, Jensen KB, Jin P, Brown V, Warren ST &
Darnell RB (2001) Fragile X mental retardation protein
targets G quartet mRNAs important for neuronal function. Cell 107, 489–499.
41 Jang MY, Yarborough OH III, Conyers GB, McPhie
P & Owens RA (2005) Stable secondary structure near
the nicking site for adeno-associated virus type 2 Rep
proteins on human chromosome 19. J Virol 79, 3544–
3556.
42 Kettani A, Bouaziz S, Wang W, Jones RA & Patel DJ
(1997) Bombyx mori single repeat telomeric DNA
sequence forms a G-quadruplex capped by base triads.
Nat Struct Biol 4, 382–389.

43 Macaya RF, Schultze P, Smith FW, Roe JA & Feigon
J (1993) Thrombin-binding DNA aptamer forms a unimolecular quadruplex structure in solution. Proc Natl
Acad Sci USA 90, 3745–3749.
44 Matsugami A, Okuizumi T, Uesugi S & Katahira M
(2003) Intramolecular higher order packing of parallel
quadruplexes comprising a G:G:G:G tetrad and a
G(:A):G(:A):G(:A):G heptad of GGA triplet repeat
DNA. J Biol Chem 278, 28147–28153.

FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR). Journal compilation ª 2010 FEBS

4263


G-quadruplex motif in human thymidine kinase 1

45 Patel PK & Hosur RV (1999) NMR observation of
T-tetrads in a parallel stranded DNA quadruplex
formed by Saccharomyces cerevisiae telomere repeats.
Nucleic Acids Res 27, 2457–2464.
46 Xu Y & Sugiyama H (2006) Formation of the G-quadruplex and i-motif structures in retinoblastoma susceptibility genes (Rb). Nucleic Acids Res 34, 949–954.
47 Lim KW, Amrane S, Bouaziz S, Xu W, Mu Y, Patel
DJ, Luu KN & Phan AT (2009) Structure of the human
telomere in K+ solution: a stable basket-type G-quadruplex with only two G-tetrad layers. J Am Chem Soc
131, 4301–4309.
48 Lim KW, Alberti P, Guedin A, Lacroix L, Riou JF,
Royle NJ, Mergny JL & Phan AT (2009) Sequence
variant (CTAGGG)n in the human telomere favors a
G-quadruplex structure containing a G.C.G.C tetrad.
Nucleic Acids Res 37, 6239–6248.

49 Hu L, Lim KW, Bouaziz S & Phan AT (2009) Giardia
telomeric sequence d(TAGGG)4 forms two intramolecular G-quadruplexes in K+ solution: effect of loop
length and sequence on the folding topology. J Am
Chem Soc 131, 16824–16831.
50 Phan AT (2010) Human telomeric G-quadruplex: structures of DNA and RNA sequences. FEBS J 277, 1107–
1117.
51 Bello LJ (1974) Regulation of thymidine kinase synthesis in human cells. Exp Cell Res 89, 263–274.
52 Arcot SS, Flemington EK & Deininger PL (1989) The
human thymidine kinase gene promoter. Deletion analysis and specific protein binding. J Biol Chem 264, 2343–
2349.
53 Mergny JL, Li J, Lacroix L, Amrane S & Chaires JB
(2005) Thermal difference spectra: a specific signature
for nucleic acid structures. Nucleic Acids Res 33,
e138.
54 Balagurumoorthy P, Brahmachari SK, Mohanty D,
Bansal M & Sasisekharan V (1992) Hairpin and parallel
quartet structures for telomeric sequences. Nucleic Acids
Res 20, 4061–4067.
´
´
55 Kypr J, Kejnovska I, Renciuk D & Vorlı´ ckova M
(2009) Circular dichroism and conformational polymorphism of DNA. Nucleic Acids Res 37, 1713–1725.

4264

R. Basundra et al.

56 Mergny JL, Phan AT & Lacroix L (1998) Following
G-quartet formation by UV-spectroscopy. FEBS Lett
435, 74–78.

57 Amrane S, Ang RW, Tan ZM, Li C, Lim JK, Lim JM,
Lim KW & Phan AT (2009) A novel chair-type Gquadruplex formed by a Bombyx mori telomeric
sequence. Nucleic Acids Res 37, 931–938.
58 Phan AT, Kuryavyi V, Gaw HY & Patel DJ (2005)
Small-molecule interaction with a five-guanine-tract
G-quadruplex structure from the human MYC promoter.
Nat Chem Biol 1, 167–173.
59 Phan AT, Kuryavyi V, Burge S, Neidle S & Patel DJ
(2007) Structure of an unprecedented G-quadruplex
scaffold in the human c-kit promoter. J Am Chem Soc
129, 4386–4392.
60 Fry M (2007) Tetraplex DNA and its interacting
proteins. Front Biosci 12, 4336–4351.
61 Cantor CR, Warshaw MM & Shapiro H (1970) Oligonucleotide interactions. 3. Circular dichroism studies of
the conformation of deoxyoligonucleotides. Biopolymers
9, 1059–1077.
62 Phan AT, Gueron M & Leroy JL (2001) Investigation of
unusual DNA motifs. Methods Enzymol 338, 341–371.
63 Plateau P & Gueron M (1982) Exchangeable proton
NMR without base line distortion, using strong pulse
sequences. J Am Chem Soc 104, 7310–7311.

Supporting information
The following supplementary material is available:
Fig. S1. Imino proton spectrum of an extended
sequence from TKQ1.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied

by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.

FEBS Journal 277 (2010) 4254–4264 ª 2010 Council of Scientific and industrial research (CSIR). Journal compilation ª 2010 FEBS