Báo cáo khoa học: The enzymatic activity of SR protein kinases 1 and 1a is negatively affected by interaction with scaffold attachment factors B1 and 2 pot

The enzymatic activity of SR protein kinases 1 and 1a is
negatively affected by interaction with scaffold
attachment factors B1 and 2
Dora Tsianou
1
, Eleni Nikolakaki
2
, Alexandra Tzitzira
1
, Sofia Bonanou
1
, Thomas Giannakouros
2
and
Eleni Georgatsou
1
1 Department of Medicine, University of Thessaly, Mezourlo, 41110 Larissa, Greece
2 Department of Chemistry, The Aristote University of Thessaloniki, Greece
Keywords
kinase activity inhibition; nuclear complex
formation; SAFB; SRPK1; SRPK1a
Correspondence
E. Georgatsou, Laboratory of Biochemistry,
Department of Medicine, School of Health
Sciences, University of Thessaly, Mezourlo,
41110 Larissa, Greece
Fax: +30 241 068 5545
Tel: +30 241 068 5581
E-mail:
Website:
(Received 24 January 2009, accepted 16

July 2009)
doi:10.1111/j.1742-4658.2009.07217.x
SR protein kinases (SRPKs) phosphorylate Ser ⁄ Arg dipeptide-containing
proteins that play crucial roles in a broad spectrum of basic cellular processes.
Phosphorylation by SRPKs constitutes a major way of regulating such cellu-
lar mechanisms. In the past, we have shown that SRPK1a interacts with the
nuclear matrix protein scaffold attachment factor B1 (SAFB1) via its unique
N-terminal domain, which differentiates it from SRPK1. In this study, we
show that SAFB1 inhibits the activity of both SRPK1a and SRPK1 in vitro
and that its RE-rich region is redundant for the observed inhibition. We dem-
onstrate that kinase activity inhibition is caused by direct binding of SAFB1
to SRPK1a and SRPK1, and we also present evidence for the in vitro binding
of SAFB2 to the two kinases, albeit with different affinity. Moreover, we show
that both SR protein kinases can form complexes with both scaffold attach-
ment factors B in living cells and that this interaction is capable of inhibiting
their activity, depending on the tenacity of the complex formed. Finally, we
present data demonstrating that SRPK ⁄ SAFB complexes are present in the
nucleus of HeLa cells and that the enzymatic activity of the nuclear matrix-
localized SRPK1 is repressed. These results suggest a new role for SAFB
proteins as regulators of SRPK activity and underline the importance of the
assembly of transient intranuclear complexes in cellular regulation.
Structured digital abstract
l
MINT-7228149: SRPK1 (uniprotkb:Q96SB4-2) phosphorylates (MI:0217) Nt-LBR (uni-
protkb:
Q14739)byprotein kinase assay (MI:0424)
l
MINT-7228207: SRPK1 (uniprotkb:Q96SB4-2) physically interacts (MI:0915) with SAFB1C
(uniprotkb:
Q15424)bypull down (MI:0096)

l
MINT-7228438: SRPK1a (uniprotkb:Q96SB4-3) physically interacts (MI:0915) with SAFB1C
(uniprotkb:
Q15424)bypull down (MI:0096)
l
MINT-7228306: SRPK1 (uniprotkb:Q14151) physically interacts (MI:0915) with SAFB2C
(uniprotkb:
Q14151)bypull down (MI:0096)
l
MINT-7228452: SRPK1a (uniprotkb:Q96SB4-3) physically interacts (MI:0915) with SAFB2C
(uniprotkb:
Q14151)bypull down (MI:0096)
l
MINT-7228466: SRPK1 (uniprotkb: Q96SB4-2) physically interacts (MI:0915) with SAFB1
(uniprotkb:
Q15424)byanti tag coimmunoprecipitation (MI:0007)
l
MINT-7228500: SRPK1a (uniprotkb:Q96SB4-3) physically interacts (MI:0915) with SAFB1
(uniprotkb:
Q15424)byanti tag coimmunoprecipitation (MI:0007)
l
MINT-7228483: SRPK1 (uniprotkb:Q14151) physically interacts (MI:0915) with SAFB2 (uni-
protkb:
Q14151)byanti tag coimmunoprecipitation (MI:0007)
Abbreviations
GFP, green fluorescent protein; GST, glutathione S-transferase; LBR, lamin B receptor; SAFB, scaffold attachment factor B; SRPK, SR
protein kinase.
5212 FEBS Journal 276 (2009) 5212–5227 ª 2009 The Authors Journal compilation ª 2009 FEBS
Introduction
Although the SR protein kinase (SRPK) family was

discovered < 15 years ago, it has been implicated in
cellular processes of the utmost importance. SRPKs
specifically phosphorylate serine residues in regions
rich in Ser ⁄ Arg repeats, also called RS domains. RS
domain-containing proteins are spread throughout the
cell. They are functionally associated with a multiplic-
ity of cellular processes, such as splicing, pre-mRNA
processing, chromatin structure and remodeling, tran-
scription by RNA polymerase II, mRNA translation,
cell-cycle progression, cell structure and other species-
specific functions [1,2]. The SRPK family of protein
kinases is highly conserved among eukaryotes, both
structurally and functionally [3–9].
The correct constitutive and alternative splicing, the
shuttling of several RS splicing factors between the
nucleus and the cytoplasm, their subnuclear localiza-
tion in nuclear speckles, their recruitment to sites of
transcription and their contribution to correct exon
selection via RNA binding, are some of the steps regu-
lated by SRPK phosphorylation [10–15]. SRPKs have
also been implicated in mRNA export from and pro-
tein import into the nucleus [16,17]. In addition, phos-
phorylation of the nucleoplasmic tail of the lamin B
receptor (LBR) by SRPK1 [18,19] regulates its binding
to chromatin [20]. Protamine P1, a histone-replacing
protein is also phosphorylated by SRPK1 [21]. Phos-
phorylation of the two proteins has been shown to
play a crucial role in mammalian spermiogenesis [22].
It is also interesting to note that several viruses alter
expression levels of SRPKs, and viral proteins interact

and become phosphorylated by SR kinases during the
infection cycle (human T-lymphotropic virus-1, herpes
simplex virus-1, hepatitis B virus), highlighting the
importance of the involvement of SRPKs in a large
number of cellular mechanisms [23–26].
In humans, the SRPK1 gene product is alternatively
spliced producing a minor transcript, the product of
which, SRPK1a, contains an additional 171 amino
acids at its N-terminus because of the retention of an
intron [27]. In a previous study, which revealed the
expression of SRPK1a as an active kinase displaying
only minor differences from SRPK1, we showed that
its additional N-terminal region interacts with scaffold
attachment factor B1 (SAFB1) [27].
SAFB1 is a protein of the nuclear matrix first dis-
covered approximately a decade ago. It was reported
with different names and was associated with a diver-
sity of functions [28–31]. It is clear, however, that
SAFB1 resides in the nucleus and is a scaffold ⁄ matrix
attachment region element binding protein. It is 915
amino acids long and contains a SAF box (amino
acids 35–67), a RNA recognition motif domain (amino
acids 409–482), a putative nuclear localization signal
(amino acids 519–614), a Glu ⁄ Arg-rich region (amino
acids 619–699) and a Gly-rich region (amino acids
785–899). A multiplicity of publications provide ample
evidence that SAFB1 interacts with several different
proteins such as polymerase II, splicing factors and
hnRNP proteins and also with the tight junction pro-
tein ZO-2 and the tripartite motif family protein

TRIM 27 [30,32–36]. In addition, it is found in a num-
ber of different subnuclear complexes formed by a
variety of different combinations of nuclear proteins
involved in either transcription [37] or splicing [38].
The most prominent function of SAFB1, however, is
transcriptional repression. It was initially shown that
SAFB1 binds to, and acts as, a corepressor of estrogen
receptor a [39]. It was further shown that it is capable
of suppressing the transcription of a reporter gene;
suppression being exerted via interaction with TATA-
binding protein associated factor II 68 [39]. In addi-
tion, SAFB1 represses the transcriptional activity of
multiple nuclear receptors [40]. This repression might
be effectuated, in some cases at least, by its interaction
with the nuclear receptor corepressor which facilitates
binding of histone deacetylases to the sites of tran-
scription of nuclear receptors [41]. SAFB2, a protein
with 70% structural identity to SAFB1, is much less
studied, but it also seems to be a transcriptional
repressor [39,42]. However, it cannot substitute for
SAFB1, because SAFB1 knockout mice display serious
defects [43]. Moreover, SAFB1 and SAFB2 have dif-
ferent subnuclear localizations [38]. A third protein
belonging to the SAFB family, SAF-like transcription
modulator (34% identity to SAFB1 and 32% to
SAFB2), has been shown to downregulate general
mRNA synthesis [44]. Finally, SAFB1, and the SAF-
like transcription modulator, have been reported to
exhibit pro-apoptotic activity [44,45].
Following our initial finding that the unique N-ter-

minal part of SRPK1a interacts with SAFB1, we
decided to investigate whether this interaction has an
effect on the enzyme activity of the kinase. In this
study, we demonstrate that both kinases (SRPK1a and
SRPK1) interact with both scaffold attachment factors
(SAFB1 and SAFB2), albeit with different affinities.
Our in vitro experiments clearly show that this inter-
action inhibits the activity of the kinases, whereas
co-immunoprecipitation and subcellular fractionation
analyses suggest that this inhibition also takes place
in vivo.
D. Tsianou et al. SRPK1/1a inhibition by interaction with SAFB1/2
FEBS Journal 276 (2009) 5212–5227 ª 2009 The Authors Journal compilation ª 2009 FEBS 5213
Results
FLAG–SRPK1a activity is inhibited in vitro by
SAFB1
SRPK1a interacts with SAFB1 via its N-terminus. In
order to find out whether the interaction affects the
enzymatic activity of the kinase, we performed phos-
phorylation assays using as the substrate the N-termi-
nal 205 amino acids of LBR (NtLBR) in the
presence of increasing quantities of bacterially
expressed SAFB1 protein. Because it was practically
impossible to obtain soluble recombinant SRPK1a
from bacteria, we used as a kinase source immuno-
precipitates of FLAG–SRPK1a from transfected
HeLa cell extracts [27]. The SAFB1 protein used in
the assays was the bacterially produced glutathione
S-transferase (GST)-fused C-terminal amino acids
600–915 (GST–SAFB1C) [39] (Fig. 1A). As shown in

Fig. 1B, SRPK1a phosphorylates bacterially produced
GST–NtLBR (lane 1) and this phosphorylation is
inhibited in a dose-responsive manner by the addition
of GST–SAFB1C (lanes 2–6). Moreover, the inhibi-
tion is specific for SAFB1C because, when GST is
added to the assay in quantities equal to those of
GST–SAFB1C that completely inhibit the reaction, it
does not affect the phosphorylation of GST–NtLBR
(lane 7).
To verify that this inhibition is valid for more
than one substrate, we used P2P-R, a nuclear matrix
protein which contains RS motifs. This protein has
previously been shown to be phophorylated by
SRPK1a [37] (and our unpublished observations). As
shown in Fig. 1C, SRPK1a phosphorylates bacterially
A
C
D
B
12
66-
45-
35-
25-
FLAG–SRPK1a
FLAG–SRPK1a
GST–NtLBR
GST–P2P-R
GST–SAFB1C
GST–SAFB1C

FLAG–SRPK1a
R
0
FLAG–SRPK1a
GST–SAFB1C (µg)
GST (µg)
R
0
GST–SAFB1C
FLAG–SRPK1a
+
+
+
+
+
+
++
+++ + +
+++ + +
–
– – – 37.5
++ +++
0 7.5 22.5 37.5 –
0 7.5 15 37.5 –
– – – – 37.5
+
+
+
+
+

+++++
+
0
–
7.5
–
15
–
22.5
–
30
–
37.5
–
–
37.5
12 34
5
123 4 5
67
GST–NtLBR
GST–SAFB1C (µg)
GST (µg)
FLAG–SRPK1a
GST–P2P-R
GST–SAFB1C (µg)
GST (µg)
12 3 4 5
123 45
123 45

6
12 345 6
7
GST
GST
GST
Fig. 1. Effect of GST–SAFB1C on FLAG–SRPK1a activity. (A) Bacterial preparation of GST–SAFB1C (lane 2). Full-length GST–SAFB1C is indi-
cated by a dot. Numbers indicate molecular mass in kDa (lane 1). (B) FLAG–SRPK1a kinase immunoprecipitated from HeLa whole-cell extract
was incubated with GST–NtLBR and [
32
P]ATP[cP] in the presence of GST–SAFB1C or GST (quantities were as indicated on the right), as
described in Materials and methods. Samples were analysed on 10% SDS ⁄ polyacrylamide gel. Proteins were Coomassie stained (left) and
labelled proteins were detected by autoradiography (right). (C) As in (B) except that GST–P2P-R(442–585) was used as a substrate. (D) As in
(B) except that peptide R
0
was used as a substrate and the SDS ⁄ polyacrylamide gel was 12%.
SRPK1/1a inhibition by interaction with SAFB1/2 D. Tsianou et al.
5214 FEBS Journal 276 (2009) 5212–5227 ª 2009 The Authors Journal compilation ª 2009 FEBS
expressed GST–P2P-R(442–585), a fragment of the
P2P-R protein that contains a RS domain (lane 1)
and this phosphorylation is gradually abolished by
increasing amounts of GST–SAFB1C (Fig. 1C,
lanes 2–4). Finally, when the artificial peptide R
0
corresponding to the RS-rich LBR amino acid
sequence 70–91 was used as substrate [46], the results
were similar to the previous two experiments
(Fig. 1D compare lane 1 with lanes 2–4), indicating
that SAFB1 inhibits phosphorylation by affecting the
kinase itself and not specific sequences on each of

the substrates.
The RE domain of SAFB1 is not required for the
inhibition of FLAG–SRPK1a activity
Amino acids 619–699 of SAFB1 comprise its so-called
Glu ⁄ Arg region, which is rich in RE dipeptides. It has
been hypothesized that this region mimics phosphory-
lated RS dipeptides [47], the structure that the SRPK
substrates display after the phosphorylation reaction.
In this context, we explored the possibility that this
region may play a role in the inhibition that SAFB1
exerts on SRPK1a activity. To this end, we con-
structed a plasmid producing a fusion protein lacking
the RE-rich region, GST–SAFB1CDRE (amino acids
709–915) (Fig. 2A). As shown in Fig. 2B, the new
fusion protein still inhibits the phosphorylation of
GST–NtLBR by SRPK1a (Fig. 2B, lanes 2–6). GST–
SAFB1CDRE also inhibits SRPK1a activity when
P2P-R or the R
0
peptide is used as a substrate (data
not shown). These results show that the deleted
Glu ⁄ Arg region of SAFB1 is not required for inhibi-
tion of SRPK1a activity.
Along this line of thought, we tested SAFB2, the
close evolutionary relative of SAFB1 which also con-
tains the corresponding RE domain. We constructed
the bacterially expressed fusion protein GST–SAFB2C
(Fig. 2C) harboring amino acids 641–953 of the C-ter-
minal region of SAFB2, which corresponds to the
respective sequences of GST–SAFB1C, including the

Glu ⁄ Arg region.
As shown in Fig. 2D, GST–SAFB2C is practically
unable to inhibit the phosphorylation of GST–NtLBR
by SRPK1a (compare lane 1 with lanes 2–5) and the
barely detectable inhibition is in quantities of GST–
SAFB2C significantly exceeding those of GST–
SAFB1C (or GST–SAFB1CDRE) that totally inhibit
SRPK1a activity (lanes 5–6). These results were con-
firmed using P2P-R and the R
0
peptide as substrates,
as shown in Fig. 2E,F. These data confirm the inability
of the RE-rich region to inhibit the phosphorylating
activity of SRPK1a.
FLAG–SRPK1 activity is inhibited in vitro by
SAFB1 and SAFB2
We next asked whether the inhibition exerted by
SAFB1 on SRPK1a activity is because of its inter-
action with the N-terminal part of the kinase. We
approached this question indirectly by examining the
effect of GST–SAFB1C, GST–SAFB1CDRE and
GST–SAFB2C on SRPK1, which in its full-length is
100% identical to the SRPK1a molecule, except for
the absence of amino acids 5–174. SRPK1 was
expressed, like SRPK1a, as a FLAG-tagged protein
in HeLa cells, immunoprecipitated by the M2 mono-
clonal anti-FLAG IgG and used as such, in in vitro
phosphorylation assays, with GST–NtLBR as the
substrate.
As shown in Fig. 3A (lane 1, compare with lanes

2–6), SRPK1 activity is inhibited by GST–SAFB1C to
a similar extent to the inhibition exerted on SRPK1a.
Accordingly, GST–SAFB1CDRE also inactivates
FLAG–SRPK1 to the same extent as FLAG–SRPK1a
(Fig. 3B). However, as shown in Fig. 3C (compare
lane 1 with lanes 2–6), FLAG–SRPK1 activity is also
clearly inhibited by GST–SAFB2C, unlike that of
FLAG–SRPK1a (Fig. 2D).
Bacterially expressed GST–SRPK1 activity is
inhibited in vitro by SAFB1 and SAFB2
The fact that SAFB1C inhibits both SRPK1a and
SRPK1 suggests that it does not bind to SRPK1a only
via its unique N-terminal part, but also via other
regions common to the two kinases. However, because
in our assays we always used kinases immunoprecipi-
tated from whole-cell extracts we decided to rule out
the possibility that a third protein intervenes in the
SRPK1 ⁄ 1a–SAFB1 ⁄ 2 interaction. To this end, we pre-
pared bacterially expressed GST–SRPK1 which is rela-
tively easily purified [19], (Fig. 4A) and used it in
in vitro phosphorylation assays (0.7 lg of GST fusion
protein per assay) with GST–Nt-LBR as the substrate
and increasing quantities of each of the three fusion
proteins GST–SAFB1C, GST–SAFB1CDRE and
GST–SAFB2C. As shown in Fig. 4B, the recombinant
kinase was active in phosphorylating GST–NtLBR
(lane 1). The results are practically identical to those
obtained with the whole-cell extract immunoprecipitat-
ed kinase, because when GST–SAFB1C is included in
the phosphorylation assay at increasing quantities,

phosphorylation is gradually abolished (lanes 2–6).
As expected, GST–SRPK1 is inhibited by GST–SAFB1
DRE (Fig. 4C) and also by GST–SAFB2C (Fig. 4D),
as observed in the case of HeLa cell isolated kinase. Up
D. Tsianou et al. SRPK1/1a inhibition by interaction with SAFB1/2
FEBS Journal 276 (2009) 5212–5227 ª 2009 The Authors Journal compilation ª 2009 FEBS 5215
to 500 ng of full-length GST–SRPK1 tested in our
experiments was inhibited by the maximal quantity of
GST–SAFB1C used in all the assays (data not shown).
These results indicate that the inhibition exerted by
SAFB1 and SAFB2 on SRPK1 is caused by a direct
interaction between each of the two proteins and
SRPK1. In an attempt to map the region of this inter-
action on the kinase, we also produced in bacteria a
truncated form of GST–SRPK1, from which amino
acids 256 to 475, containing the so-called spacer region
of the kinase, are deleted (GST–SRPK1Dspacer). It has
previously been shown that removal of the spacer
domain has no effect on catalytic activity but drasti-
cally affects the subcellular localization of the kinase
[48]. Indeed, as shown in Fig. 4E, GST–SRPK1Dspacer
is able to phosphorylate its substrate, GST–NtLBR, as
efficiently as GST–SRPK1 (lanes 1 and 5). In addition,
its activity is inhibited by both SAFB1 and SAFB2
(lanes 6 and 7), implying binding of the SAFB proteins
to (a) region(s) other than the spacer region.
A B
C
E
F

D
1
116-
FLAG–SRPK1a
FLAG–SRPK1a
+
+
+
+
+
+
+
+
+
+
+
+
0 7.5 15 22.5 30 37.5
+
+
+
+
+
+
+
+
+
+
+
+

+
+
+
+
+
+
+
+
0 7.5 15 22.5 30 37.5
0 7.5 22.5 37.5
+
+
+
+
+
+
+
+
0 7.5 22.5 37.5
GST–NtLBR
GST–NtLBR
GST–SAFB1CΔRE
FLAG–SRPK1a
GST–NtLBR
GST–SAFB2C
FLAG–SRPK1a
GST–P2P-R
GST–SAFB2C
FLAG–SRPK1a
GST–P2P-R

GST–SAFB2C (µg)
FLAG–SRPK1a
R
0
GST–SAFB2C (µg)
FLAG–SRPK1a
R
0
GST–SAFB2C
12 3 4
12 3 4
FLAG–SRPK1a
GST–NtLBR
GST–SAFB2C (µg)
GST–SAFB1CΔRE (µg)
12 34 5 6
123456
12345 6
1234
1234
12 3 4
56
66-
45-
35-
25-
116-
66-
45-
35-

25-
12
2
Fig. 2. Effect of GST–SAFB1CDRE and GST–SAFB2C on FLAG–SRPK1a activity. (A) Bacterial preparation of GST–SAFB1CDRE (lane 2). Full-
length GST–SAFB1CDRE is indicated by a dot. Numbers indicate molecular mass markers in kDa (lane 1). (B) FLAG–SRPK1a kinase immuno-
precipitated from HeLa whole-cell extracts was incubated with GST–NtLBR and [
32
P]ATP[cP] in the presence of GST–SAFB1CDRE (quantities
were as indicated in the right panel) as described in Materials and methods. Samples were analysed on 10% SDS ⁄ polyacrylamide gels. Pro-
teins were Coomassie stained (left) and labelled proteins were detected by autoradiography (right). (C) Bacterial preparation of GST–SAFB2C
(lane 2). Full-length GST–SAFB2C is indicated by a dot. Numbers indicate molecular mass markers in kDa (lane 1). (D) As in (B) except that
the indicated quantities of GST–SAFB2C were used. (E) As in (D) except that GST–P2P-R(442–585) was used as a substrate. (F) As in (D)
except that peptide R
0
was used as a substrate and the SDS ⁄ polyacrylamide gel was 12%.
SRPK1/1a inhibition by interaction with SAFB1/2 D. Tsianou et al.
5216 FEBS Journal 276 (2009) 5212–5227 ª 2009 The Authors Journal compilation ª 2009 FEBS
Both SRPK1, as well as SRPK1a, bind to both
SAFB1 and SAFB2
In order to confirm SAFB1 and SAFB2 binding to the
kinases, we performed an affinity chromatography
experiment in which we immobilized M2 antibody-
bound FLAG–SRPK1 or SRPK1a on beads and incu-
bated them with GST–SAFB1C, GST–SAFB1CDRE,
GSTSAFB2C and GST bacterial preparations. The
beads were washed and the eluted proteins were
probed with the anti-GST IgG for SAFB protein
detection and the anti-FLAG IgG for the immuno-
precipitated SRPK1 protein calibration.
As shown in Fig. 5, both SAFB proteins bind clearly

and specifically to both kinases (no proteins bind to
beads alone: lanes 9, 10, 11 and 12), albeit with differ-
ent affinities. SAFB1 binds tightly to SRPK1a and
almost as tightly to SRPK1 (compare lanes 2 and 1)
and the same holds true for the GST–SAFB1CDRE
protein (lanes 3 and 4), whereas SAFB2 barely binds
to SRPK1a (lane 6) but almost as tightly as SAFB1 to
SRPK1 (compare lanes 5 and 1). These results confirm
the direct interaction of SAFBs with the SRPK1 ⁄ 1a
proteins and provide a direct link between the affinity
of the SAFB–SRPK1 ⁄ 1a interaction and the extent of
the inhibition exerted on kinase activity in each case
(see Discussion). Also, both GST–SAFB1 and GST–
SAFB2 were able to bind to a FLAG–SRPK1DSpacer
fusion protein in a similar experiment, suggesting that
the catalytic region of the kinase, comprising amino
acids 1–256 and 476–655, interacts with the SAFB
proteins (data not shown).
In SRPK
⁄
SAFB complexes, able to form in living
cells, SRPK activity is inhibited
In a following step, we asked whether the corresponding
SRPK ⁄ SAFB complexes were able to form in living cells
with full-length SAFB proteins, and whether the kinases
in these complexes were also repressed. HeLa cells were
co-transfected with plasmids expressing FLAG, FLAG–
SRPK1a or FLAG–SRPK1 together with green fluores-
cent protein (GFP), GFP–SAFB1 or GFP–SAFB2,
lysed and FLAG proteins were immunoprecipitated

with the M2 anti-FLAG IgG. Kinase assays were
performed on the immunoprecipitated kinases using
A
B
C
FLAG–SRPK1
GST–NtLBR
GST–SAFB1C
FLAG–SRPK1
GST–NtLBR
GST–SAFB1CΔRE
GST–SAFB1CΔRE (µg)
FLAG–SRPK1 + + + + + +
++++++
0 7.5 15 22.5 30 37.5
++++++
++++++
0 7.5 15 22.5 30 37.5
++++++
++++++
0 7.5 15 22.5 30 37.5
GST–NtLBR
GST–SAFB1C (µg)
FLAG–SRPK1
GST–NtLBR
GST–SAFB2C (µg)
FLAG–SRPK1
GST–NtLBR
123456
12 3 4 5 6

12 3 4 5 6
1234 56
1234 5 6
FLAG–SRPK1
GST–NtLBR
GST–SAFB2C
1234 5 6
Fig. 3. Effect of GST–SAFB1C, GST–SAFB1CDRE and GST–SAFB2C on FLAG–SRPK1 activity. (A) FLAG–SRPK1 kinase immunoprecipitated
from HeLa whole-cell extracts was incubated with GST–NtLBR and [
32
P]ATP[cP] in the presence of GST–SAFB1C (quantities were as indi-
cated in the right panel) as described in Materials and methods. Samples were analysed on 10% SDS ⁄ polyacrylamide gels. Proteins were
Coomassie stained (left) and labelled proteins were detected by autoradiography (right). (B) As in (A) except that the indicated quantities of
GST–SAFB1CDRE were used. (C) As in (A) except that the indicated quantities of GST–SAFB2C were used.
D. Tsianou et al. SRPK1/1a inhibition by interaction with SAFB1/2
FEBS Journal 276 (2009) 5212–5227 ª 2009 The Authors Journal compilation ª 2009 FEBS 5217
GST–NtLBR as a substrate. In order to monitor the
SRPK ⁄ SAFB complex assembly, half of the extract was
used to detect the proteins with the anti-FLAG and the
anti-GFP IgG. As shown in Fig. 6A both kinases are
active when extracted from cells co-expressing GFP
(lanes 1 and 4). However, when SRPK1 is co-expressed
with either SAFB1 or SAFB2, its activity is clearly
inhibited (lanes 2, 3). SRPK1a activity is also inhibited
by SAFB1 (lane 5), yet inhibition by SAFB2 is much
weaker (lane 6).
As shown in Fig. 6B, both GFP–SAFB1 and
GFP–SAFB2 proteins bind to both kinases (left and
right panels, lanes 2, 3 and 5, 6), unlike GFP (lanes
1 and 4) which does not bind by itself. However,

A
C
D
E
B
12
116-
GST–SRPK1
GST–NtLBR
GST–SAFB1C
GST–SRPK1
GST–NtLBR
GST–SAFB1CΔRE
GST–SRPK1
GST–NtLBR
GST–SAFB2C
GST–SAFB1CΔRE (µg)
GST–SRPK1
GST–NtLBR
GST–SAFB1C (µg)
GST–SRPK1
GST–NtLBR
GST–SRPK1Δspacer
GST–SAFB1C (µg)
GST–SAFB2C (µg)
GST
GST–NtLBR
GST–SRPK1
++++
++++

++
37.5
37.5
37.5
37.5
37.5
37.5
++ + + + +
––
–
–
–
–––– –
––
–––
––
–– –
––––
––
GST–SAFB2C (µg)
GST–SRPK1
GST–NtLBR
GST
+
+
+
+
+
+
+

+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
– – – – – – 37.5
7
654321
67854321
654321
654321
0 7.5 15 22.5 30 37.5 –
0 7.5 15 22.5 30 37.5
+
+
+

+
+
+
+
+
+
+
+
+
0
7.5
15
22.5
30
37.5
12 3456 7
12 34 5 6
12 34 5 6
GST
66-
45-
35-
25-
Fig. 4. Effect of GST–SAFB1C, GST–SAFB1CDRE and GST–SAFB2C on GST–SRPK1 and GST–SRPK1 Dspacer activity. (A) Bacterial prepara-
tion of GST–SRPK1 (lane 2). Full-length GST–SRPK1 is indicated with a dot. Numbers indicate molecular mass markers in kDa (lane 1). (B)
GST–SRPK1 purified from Escherichia coli whole-cell extract was incubated with GST–NtLBR and [
32
P]ATP[cP] in the presence of GST–
SAFB1C or GST (quantities were as indicated in the right panel) as described in Materials and methods. Samples were analysed on 10%
SDS ⁄ polyacrylamide gels. Proteins were Coomassie stained (left) and labelled proteins were detected by autoradiography (right). (C) As in

(B) except that the indicated quantities of GST–SAFB1CDRE were used. (D) As in (B) except that the indicated quantities of GST–SAFB2C
were used. (E) GST–SRPK1 (lanes 1–4) and GST–SRPK1Dspacer (lanes 5-8) purified from E. coli whole-cell extract were incubated with
GST–NtLBR and [
32
P]ATP[cP] in the presence of the indicated quantities of GST–SAFB1C, GST–SAFB1C or GST as described in (B). Labelled
proteins were detected by autoradiography.
SRPK1/1a inhibition by interaction with SAFB1/2 D. Tsianou et al.
5218 FEBS Journal 276 (2009) 5212–5227 ª 2009 The Authors Journal compilation ª 2009 FEBS
although SAFB1 seems to bind to SRPK1 almost as
well as to SRPK1a, SAFB2, which is clearly present
in the eluate of SRPK1, is barely detectable in the
eluate of SRPK1a. These results show that SRPK ⁄
SAFB complexes are able to form in living cells and
that cell-extracted SAFB-bound kinases are inactive
in vitro.
SRPK
⁄
SAFB complexes are present in the nucleus
of HeLa cells
Finally, we sought to detect the existence of endogenous
SRPK ⁄ SAFB complexes. SAFB proteins were immuno-
precipitated from whole-cell lysates of exponentially
growing HeLa cells and the eluate was probed with the
Input
GST–
SAFB1C
GST–
SAFB1C
GST–
SAFB1C

ΔRE
GST–
SAFB1C
ΔRE
GST–
SAFB2C
GST–
SAFB2C
GST
GST
GST–
SAFB1C
GST–
SAFB1C
ΔRE
GST–
SAFB2C GST
Anti-GST
Anti-FLAG
Anti-GST
12 3 4 5 6 7 8 9 10 1112
Eluate
FLAG–SRPK1
FLAG–SRPK1a
FLAG–SRPK1
FLAG–SRPK1a
FLAG–SRPK1
FLAG–SRPK1a
FLAG–SRPK1
FLAG–SRPK1a

Beads
Fig. 5. Binding of the GST–SAFB1/2
proteins on immobilized FLAG–SRPK1/1a
proteins. FLAG–SRPK1 and FLAG–SRPK1a
were immunoprecipitated on beads by from
HeLa cell extracts and the beads were
incubated with GST–SAFB1C, GST–
SAFB1CDRE, GST–SAFB2C or GST. The
eluates were subjected to electrophoresis
and proteins were detected using the anti-
FLAG and the anti-GST IgG as indicated
(lanes 1-8). The GST fusion proteins were
also incubated with beads alone treated
with immunoprecipitates from whole-cell
extracts of non-transfected cells (lanes
9–12) (lower). One-thirtieth of the input
proteins were subjected to electrophoresis
and detected using the anti-GST IgG
(upper).
A
B
GST–NtLBR
FLAG–SRPK1
FLAG–SRPK1a
GFP
GFP–SAFB1
GFP–SAFB2
123
Anti-GFP
Anti-FLAG

Anti-GFP
123 456
456
Whole cell extract
Whole cell extract
GFP GFP–
SAFB1
Eluate
FLAG–SRPK1
Eluate
FLAG–SRPK1a
GFP–
SAFB2
GFP GFP–
SAFB1
GFP–
SAFB2
GFP GFP–
SAFB1
GFP–
SAFB2
GFP GFP–
SAFB1
GFP–
SAFB2
+
+
–
+
–

–
+
+
–
–
+
–
+
+
–
–
–
+
+
–
+
+
–
–
+
–
+
–
+
–
+
–
+
–
–

+
Fig. 6. The binding effect of full-length
SAFB1 and SAFB2 on SRPK1 and SRPK1a
kinase activities. HeLa cells were co-trans-
fected with plasmids expressing FLAG,
FLAG–SRPK1 or FLAG–SRPK1a together
with GFP, GFP–SAFB1 or GFP–SAFB2.
Whole-cell extracts were immunoprecipitat-
ed with an anti-FLAG IgG. A) On half of the
immunoprecipitated material a kinase assay
was performed, as described in Materials
and methods. Samples from the kinase
assay were analysed on SDS ⁄ polyacryl-
amide gel and labelled proteins were
detected by autoradiography. (B) The
remaining half of the immunoprecipitates
were analysed on SDS ⁄ polyacrylamide gel
and immunoblotted with an anti-FLAG and
an anti-GFP IgG. On the same gel, 1 ⁄ 10 of
the quantity of the whole-cell extract that
was used in each immunoprecipitation
assay was subjected to electrophoresis and
immunoblotted with an anti-GFP IgG.
D. Tsianou et al. SRPK1/1a inhibition by interaction with SAFB1/2
FEBS Journal 276 (2009) 5212–5227 ª 2009 The Authors Journal compilation ª 2009 FEBS 5219
anti-SRPK1 IgG (the mAbs available do not distinguish
between SAFB1 ⁄ 2 and SRPK1 ⁄ 1a). An immunoreac-
tive band was detected in the eluate of SAFB co-immu-
noprecipitated proteins (Fig. 7, lane 4), indicating that
part of endogenous SRPK1 ⁄ 1a is complexed with

SAFB in HeLa cells. Approximately 2% of the total
SRPK1 ⁄ 1a levels was calculated to co-immunopercipi-
tate with the SAFB proteins (based on the intensinty of
the bands on the western blot). In order to determine in
which subcellular compartment such complexes may
form, we proceeded in subcellular fractionation of
HeLa cells and subsequent immunoblotting of the frac-
tions with the anti-SAFB and anti-SRPK1 IgG (Fig. 8).
As expected, SAFB is detected in the nucleus where
it is found mostly in the nuclear matrix ( 80%),
whereas SRPK1 ⁄ 1a is detected mainly in the cytoplasm
( 60%) and to a lesser extent in the nucleus ( 40%).
Notably, a small but clearly detectable fraction of the
kinase ( 10%) is found in the nuclear matrix where
the SAFB concentration is high (Fig. 8A). Conse-
quently, SRPK ⁄ SAFB-containing complexes may exist
in the nuclear matrix as well as in the nucleoplasm.
When the different fractions were assayed for SR kinase
activity using GST–NtLBR as a substrate, phosphory-
lation was easily detected in the cytoplasmic and nucle-
oplasmic fractions, but none was detected in the nuclear
matrix (Fig. 8B), despite the presence of SRPK1 ⁄ 1a
molecules in this fraction (Fig. 8A).
Discussion
In this study, we have followed up our initial observa-
tion that SRPK1a, the alternatively spliced form of
SRPK1, interacts with the nuclear matrix protein
SAFB1 via its unique additional N-teminal domain.
In our pursuit of a biological consequence of this
interaction, we examined the activity of SRPK1a in

the presence of SAFB1 and showed that the kinase is
inhibited by this factor in vitro. In our assays, we used
the C-terminal region of SAFB1 because it includes
the area found to interact with SRPK1a (amino acids
585–720) [27]. Inhibition was evident when SRPK1a
activity was tested on three different substrates (LBR,
P2P-R and a RS domain-containing synthetic peptide)
eliminating the possibility that SAFB1 interferes with
different domains in each substrate. However, rela-
tively large quantities ( 20 lg) of our total bacterial
GST–SAFB1C preparation were needed to eliminate
phosphorylation of the substrates. We cannot be
WB: a-SRPK1
1234
IP: a-SAFB
127
77
Input (20%)
Fig. 7. A fraction of endogenous SRPK1 ⁄ 1a co-immunoprecipitates
with SAFB1 ⁄ 2. Complexes between SAFB and SRPK1 ⁄ 1a proteins
were immunoprecipitated from HeLa cell extracts with a monoclonal
anti-HET ⁄ SAFB IgG and analysed on 10% SDS ⁄ polyacrylamide gels.
The proteins were then transferred to nitrocellulose and SRPK1 ⁄ 1a
was detected with the monoclonal anti-SRPK1 IgG, recognizing both
isoforms (lane 4). No direct immunoprecipitation of SRPKs was
observed when an irrelevant monoclonal anti-GFP IgG was used as
control (lane 3). A standard amount of cell extract, one-fifth of which
is shown (lane 2), was used in each immunoprecipitation assay.
Molecular mass markers are shown in kDa on the left.
A

B
Fig. 8. Distribution of endogenous SAFB1 ⁄ 2 and SRPK1 ⁄ 1a pro-
teins in HeLa cells, following biochemical fractionation. (A) The dis-
tribution of SAFB1 ⁄ 2 and SRPK1 ⁄ 1a proteins between the various
fractions was analysed by immunoblotting using a mouse mono-
clonal anti-HET/SAFB and a monoclonal anti-SRPK1 IgG respectively
(the available antibodies do not distinguish between SAFB1 ⁄ 2 and
SRPK1 ⁄ 1a, respectively; see Materials and methods for the analyti-
cal fractionation protocol). (B) The different fractions were assayed
for RS kinase activity, using bacterially produced GST–NtLBR as
substrate. The samples were analysed by SDS ⁄ PAGE and auto-
radiographed. The radioactive bands corresponding to labelled
GST–NtLBR from were excised, and the radioactivity was deter-
mined by Cerenkov counting. RS kinase activity of the different
fractions is expressed as total units (%).
SRPK1/1a inhibition by interaction with SAFB1/2 D. Tsianou et al.
5220 FEBS Journal 276 (2009) 5212–5227 ª 2009 The Authors Journal compilation ª 2009 FEBS
certain whether this is because only the full-length
SAFB1C, which is a relatively small fraction in the
total population of the GST-purified peptide, inhibits
the kinase or because SAFB1 homopolymerizes via its
RE-rich region [38,42] (and our unpublished observa-
tions), large quantities are needed to have sufficient
SAFB1 monomers available to form complexes with
the kinase under the conditions of the in vitro phos-
phorylation assays.
The Glu ⁄ Arg-rich region is a candidate for repres-
sion of the kinase activity because of its particular
structure, which resembles a phosphorylated RS
domain. RS domains are known to be protein–protein

and protein–RNA interaction surfaces and the phos-
phorylation of serines affects those interactions as well
as interactions between RS domain-containing proteins
[49,50]. Very recently the core complex of SRPK1 with
one of its substrates, the spliceosome factor ASF ⁄ SF2,
has been crystallized [51], revealing important informa-
tion and confirming previous observations [52–54]
about the significance of enzyme–substrate contacts for
catalysis. This study highlights the importance of the
interaction of a phosphoserine of the RS domain of
the substrate with the catalytic region of the kinase, on
the one hand, and of the positive charge of the RS
domain with the negatively charged ‘docking groove’
of SRPK1, on the other hand. The RE-rich region of
SAFB1 may interfere with any of these processes by
mimicking a phosphorylated RS domain, thus disturb-
ing the catalytic activity of the kinase. However, when
we deleted the sequence rich in RE dipeptides, the
remaining SAFB1 sequences (709–915) still inhibited
SRPK1a activity, implying that some particular struc-
tural element or configuration in this region should be
responsible for the observed effect. At this point, it
should be noted that among the SAFB1 sequences
contained in the GST–SAFB1CDRE fusion protein,
several RE dipeptides are scattered so that we cannot
exclude the possibility that inhibition is exerted by
these sequences, particularly because the pI of the
remaining SAFB1 sequence in the GST–SAFB1CDRE
peptide is still basic. Otherwise, it could be a combina-
tion of two effects, where both specific structural ele-

ments and the scattered REs would contribute to the
observed inhibition.
We were intrigued to find that, although SAFB1
interacts with the unique N-terminal part of SRPK1a,
it also inhibits the activity of SRPK1 which lacks this
unique part. We excluded the possible involvement of
a cellular protein in our in vitro assays by using bacte-
rially purified GST-fused SRPK1 and confirmed that
both SAFB1 and SAFB2 repress its activity. Affinity
chromatography experiments confirmed that SAFB1
and SAFB2 bind to SRPK1, which suggests that there
exists a domain on the kinase recognized by each of
the two factors. We excluded the possibility that such
a domain is located in the spacer region of the kinase
because both SAFB proteins still bind on a kinase
molecule from which the spacer domain is deleted and
they still inhibit its enzymatic activity. Thus, the inhi-
bition mechanism involves binding of the SAFB mole-
cules to the catalytic domain of SRPK1. Furthermore,
SAFB1 also binds to SRPK1a (as previously shown),
but SAFB2 barely does. We obtained the same quali-
tative results concerning the relative affinities of the
four proteins when we co-immunoprecipitated the kin-
ases with SAFB proteins from HeLa cells. This result
is not very easy to explain for the pair SRPK1a–
SAFB2. Because SAFB2 interacts with SRPK1, it
must recognize and bind to a specific region on it,
which is evidently also contained in SRPK1a. How-
ever, SAFB2 binds only weakly to SRPK1a. One
should then accept that either SAFB1 and SAFB2

have two different, though almost equal in strength,
types of interaction with SRPK1 that are differenti-
ated in SRPK1a because of the N-terminal domain,
or that even if their interaction with SRPK1 is simi-
lar, the N-terminal domain has a stabilizing effect on
SAFB1, but a destabilizing effect on the interaction
with SAFB2. In any case, additional dissection of the
SAFB and SRPK1 molecules is required to determine
the regions responsible for their interactions. It should
be pointed out, however, that this study is the first to
reveal functional differences between SAFB1 and
SAFB2.
Although at this stage in our study our results can
only be qualitative, we have noticed that the inhibit-
ing activity exerted by SAFB proteins on the kinases,
is closely related to the affinity with which they inter-
act in affinity chromatography and co-immunoprecipi-
tation experiments. Although this is not unexpected, it
is indicative of the importance of SRPK ⁄ SAFB intra-
cellular complexing. We were able to demonstrate the
existence of SRPK ⁄ SAFB complexes in HeLa cells,
estimating the percentage of total cellular SRPK1 ⁄ 1a
molecules occupied in these complexes to be  2%.
Because the antibodies used cannot distinguish
between SRPK1 and SRPK1a, or between SAFB1
and SAFB2, we do not know the exact composition
of the detected SRPK ⁄ SAFB complexes. However,
using overexpressed proteins in HeLa cells we demon-
strated that all four complexes, SRPK1a–SAFB1,
SRPK1–SAFB1, SRPK1–SAFB2 and SRPK1a–

SAFB2 (listed by relative order of affinity) can be
formed in living cells by the full-length proteins.
Moreover, SRPK1 ⁄ 1a molecules extracted from the
D. Tsianou et al. SRPK1/1a inhibition by interaction with SAFB1/2
FEBS Journal 276 (2009) 5212–5227 ª 2009 The Authors Journal compilation ª 2009 FEBS 5221
lysates of such cells were shown to be inactivated to
an extent that depended on their binding affinities to
their SAFB partner. The results of our subcellular
fractionation in HeLa cells show that SAFB molecules
are localized exclusively in the nucleus, as previously
described [30,38,55],  80% of them residing in the
nuclear matrix. Several previous studies examined the
subnuclear partitioning of SAFB. It is known and
generally accepted to be a scaffold ⁄ matrix attachment
region binding protein, it was found in nuclear speck-
les [30], it has been shown to change subnuclear local-
ization in response to heat shock from perichromatin
fibrils to nuclear structures that do not correspond to
nuclear speckles [31,55] and also to migrate to the
nucleolus in response to early apoptotic signals [45].
Sergeant et al. [38] demonstrated that in HEK293 and
HeLa cells, SAFB2 is found in large stable multipro-
tein complexes that also contain a fraction of SAFB1,
whereas SAFB1 is also found in its monomeric form.
Proteins related to RNA processing were mostly
found in these stable complexes. Yet, many proteins
known to interact with SAFB1 ⁄ 2, such as Trab2 [56],
estrogen receptor a and the C-terminal domain of
RNA polymerase II, were not detected, and neither
was DNA. This observation leads to the assumption

that such interactions may be transient and some may
take place under particular conditions or in certain
cell types or cell-cycle phases.
Likewise, the intracellular localization of SR kinases
has always been a point of discussion because ordinarily
only a fraction of SRPK1 is found in the nucleus and
additional molecules move into the nucleus in response
to cell-cycle signals [48,57]. Within the nucleus, SRPK1
is localized in nuclear speckles, which are nuclear sub-
structures believed to play a role in coupling transcrip-
tion and pre-mRNA splicing. The composition of such
structures is thought to be relatively ‘fluid’, changing
in response to metabolic and environmental signals,
whereas individual components shuttle between them
and active gene loci [58]. Proteomic analysis, using MS,
has identified 146 proteins including SAFB1, many of
its already known interacting partners and as expected,
many SRPK1 substrates [59].
Our subfractionation experiment in HeLa cells has
shown that SRPK1 ⁄ 1a is distributed at a ratio of 3 : 2
between the cytoplasm and the nucleus and a further
subnuclear partitioning of 3 : 1 between the nucleo-
plasm and the nuclear matrix. It is evident that the
SRPK ⁄ SAFB complexes could form in the nucleo-
plasm or the nuclear matrix, or both. However, it was
very interesting to find that, whereas the SRPK1 ⁄ 1a
substrate NtLBR was easily phosphorylated by the
cytoplasmic and nucleoplasmic fractions, it was not
phosphorylated by the nuclear matrix fraction, despite
10% of the total SRPK1 ⁄ 1a molecules being detected

in this fraction, implying that the inhibitory factor
associated with the nuclear matrix may be SAFB1 ⁄ 2.
The higher activity detected in the nucleoplasmic frac-
tion compared with the cytoplasmic fraction (which
otherwise contains more SRPK1 ⁄ 1a) may be caused by
other kinases phosphorylating NtLBR, but most
importantly to inhibitors already described as being in
the cytoplasm that inhibit SRPK1 [7].
We propose that the SAFB ⁄ SRPK complexes we
detected are transiently formed in cells, most likely
under specific conditions. It is tempting to suppose
that the transient interaction of a SR kinase with a
SAFB protein under certain cellular conditions leads
to temporary inhibition of phosphorylation, influenc-
ing the processes of mRNA splicing or gene transcrip-
tion (or even another RS domain-dependent function)
via cross-talk between the SRPK and SAFB molecules.
For example, it is well established that for correct
splicing to occur, phosphorylation and sequential
dephosphorylation of SR proteins must take place
[2,10,60]. SRPKs, which are responsible for the phos-
phorylation of RS splicing factors, might, in this case,
be temporarily inhibited during the action of phospha-
tases on the phosphorylated RS proteins.
SAFB1 has been proposed to act as a structural
platform where transcription and pre-mRNA process-
ing components assemble close to scaffold ⁄ matrix
attachment region elements [30]. SRPK1 or SRPK1a
molecules could be transient components of such struc-
tures, depending on cellular activities. The notion of a

nucleus where proteins and RNA rapidly diffuse in
and out of complexes that form transiently, has
emerged as a result of multiple experimental data that
also underline the physiological importance of such
intranuclear trafficking and aggregate formation [61].
Kinase inhibition might take place in vivo depending
on the specific protein milieu of the complex in which
the SRPK ⁄ SAFB pair resides and it could be fine-
tuned by the specific composition of the transiently
formed complexes. Each partner of the SAFB ⁄ SRPK
complex pair could be implicated in specific cellular
processes to varying degrees. These could be also cell
type specific as, for example, in Sertoli cells where
SAFB2 (but not SAFB1) is expressed [38]. Neither the
functional differences between SRPK1 and SRPK1a,
nor those between SAFB1 and SAFB2 are clear at
present, but the differential pairing between them,
resulting in differentially regulated SR kinase function,
should reflect important fine tuned cellular mechanisms
in vivo. Elucidation of the regulation and physiological
properties of SRPK ⁄ SAFB complex formation in vivo
SRPK1/1a inhibition by interaction with SAFB1/2 D. Tsianou et al.
5222 FEBS Journal 276 (2009) 5212–5227 ª 2009 The Authors Journal compilation ª 2009 FEBS
will unravel important information concerning nuclear
and cellular function.
Materials and methods
Plasmids
pGEX-4T1 ⁄ SAFB1CDRE
The cDNA fragment corresponding to SAFB1CDRE (amino
acids 709–915) was amplified by PCR from plasmid pGEX-

2TK ⁄ SAFB1C, using as primers: forward 5¢-TTT
GGATCC
GCGGTGCGGCGGC-3¢, containing the underlined BamHI
site and reverse: 5¢-TT
GAATTCTCAGTAGCGGCGAGT
GAA-3¢, containing the underlined EcoRI site. The PCR
fragment was digested with BamHI and EcoRI, repurified
and subcloned into the BamHI and EcoRI sites of the bacte-
rial expression vector pGEX-4T1 (Amersham Biosciences,
Piscataway, NJ, USA).
pGEX-4T1 ⁄ SAFB2C
The cDNA fragment corresponding to SAFB2C (amino
acids 641–953) was amplified by PCR from plasmid pEGFP–
SAFB2 using as primers: forward 5¢-TTT
GGATCCGAG
CGCGAGCAGCGGG-3¢, containing the underlined BamHI
site and reverse: 5¢-TT
GAATTCTTAGTAGCGGCGGGT
GAA-3¢, containing the underlined EcoRI site. The PCR
fragment was digested with BamHI and EcoRI, repurified
and subcloned into the BamHI and EcoRI sites of the bacte-
rial expression vector pGEX-4T1.
pGEX-2T ⁄ P2P-R
The cDNA fragment of P2P-R coding for amino acids 442–
585 was excised from plasmid pCMV–FLAG
TM
–24 ⁄ P2P-R,
a gift of RE Scott (University of Tennessee Health Science
Center, Memphis, TN, USA), with EcoRI and SalI and
subcloned into the EcoRI and SalI sites of the bacterial

expression vector pGEX-2T.
pGEX-2T ⁄ SRPK1Dspacer
Spacer-deleted SRPK1 (lacking amino acids 256-475) was
generated by ligating the cDNAs coding for the N- and
C-terminus of human SRPK1. The cDNA coding for the
N-terminus was amplified by PCR from plasmid pGEX-
2T ⁄ SRPK1, using as primers: forward: 5¢-GCGT
GGATC
CATGGAGCGGAAAGTGCTTGCG-3¢, containing the
underlined BamHI site and reverse: 5¢-TCC
CCCGGGAG
CAGTACTGACTGCAGATCC-3¢, containing the under-
lined SmaI site. The cDNA coding for the C-terminus was
also amplified by PCR from plasmid pGEX-2T ⁄ SRPK1,
using as primers: forward: 5¢-TCC
CCCGGGAATTTTCT
TGTTATTCCCCTTGAG-3¢, containing the underlined
SmaI site and reverse: 5¢-CCGAG
GAATTCGGAGTTAA
GCCAAGGGTGCCG-3¢, containing the underlined EcoRI
site. The PCR fragments were digested with BamHI ⁄ SmaI
and SmaI ⁄ EcoRI, respectively, repurified and subcloned into
the BamHI and EcoRI sites of the bacterial expression vector
pGEX-2T.
The following plasmids have been previously described:
pGEX-2TK ⁄ SAFB1C [39], pGFP3–SAFB1 [38], pGFP3–
SAFB2 [38], pFLAG–CMV-2 ⁄ SRPK1a [27], pFLAG–
CMV-2 ⁄ SRPK1 [27], pGEX-2T ⁄ SRPK1 [21], pGEX-2T ⁄
NtLBR [46].
Cell cultures and transfections

HeLa cells were cultured in Dulbecco’s modified Eagle’s
medium (Gibco BRL, Invitrogen, Carlsbad, CA, USA) sup-
plemented with 10% fetal bovine serum (Biochrom KG
Seromed, Berlin, Germany) and antibiotic–antimycotic
solution (Gibco BRL). Cells ( 60% confluent) were trans-
fected with 10 lg of DNA (equal quantities of each plasmid
when more than one plasmid were used) in 10 cm dishes
using the Transpass Ô D
2
Transfection Reagent (New
England Biolabs, Ipswish, MA, USA) and incubated for
24 h in Dulbecco’s modified Eagle’s medium at 37°Cina
5% CO
2
⁄ 95% air incubator.
SDS
⁄
PAGE and western analysis
Protein samples were resolved by 10 or 12% SDS ⁄ PAGE
and analysed by Coomassie Brilliant Blue staining or wes-
tern blotting using a monoclonal anti-(FLAG M2) mouse
IgG (1 : 10 000; Sigma-Aldrich, St Louis, MO, USA) or
a monoclonal anti-(HET ⁄ SAFB) mouse IgG (1 : 2000;
Upstate Biotechnology, Lake Placid, NY, USA) or a mono-
clonal anti-GST goat IgG (1 : 5000, Amersham Biosciences)
or a monoclonal anti-SRPK1 mouse IgG (1 : 1000; BD
Transduction Laboratories, Lexington, KY, USA), or a rab-
bit polyclonal anti-GFP serum (1 : 3000), a gift of H. Boleti
(Hellenic Pasteur Institute, Athens, Greece). Membranes
were then incubated with horseradish peroxidase- or alka-

line phosphatase-conjugated goat anti-mouse IgG (1 : 3000;
Bio-Rad Laboratories, Hercules, CA, USA) or horseradish
peroxidase–mouse anti-(goat IgG) (1 : 3000; Jackson
Immunoresearch, Baltimore Pike, PA, USA) or horseradish
peroxidase–goat anti-(rabbit IgG) (1 : 3000, Cell Signaling,
Beverly, MA, USA) antibodies. Detection of the immuno-
reactive bands was performed using ECL (Amersham
Biosciences) or the 5-bromo-4-chloro-3-indolyl phosphate ⁄
nitro blue tetrazolium substrate.
Protein expression and purification
Expression of the fusion proteins GST–SAFB1C, GST–
SAFB1CDREand GST–SAFB2C was induced with 1 mm
D. Tsianou et al. SRPK1/1a inhibition by interaction with SAFB1/2
FEBS Journal 276 (2009) 5212–5227 ª 2009 The Authors Journal compilation ª 2009 FEBS 5223
isopropyl thio-b-d-galactoside (Fermentas International
Inc., Ontario, Canada) at 24 °C for 3 h, whereas expression
of GST–NtLBR, GST–SRPK1a, GST–SRPK1, GST–
SRPK1Dspacer and GST–P2P-R(442-585) was induced with
0.2 mm isopropyl thio-b-d-galactoside at 28 °C for 3 h.
Cells were suspended in ice-cold buffer [1 · NaCl ⁄ P
i
,
1% Triton-X, 1 mm phenylmethanesufonyl fluoride,
protease inhibitors cocktail (Roche Diagnostics, Manheim,
Germany)], the cell suspension was sonicated and insoluble
debris was pelleted by centrifugation (12 000 g for 15 min
at 4 °C). The supernatant was mixed with glutathione
Sepharose beads (Amersham Biosciences) at 4 °C for
30 min and bound proteins were eluted with glutathione
elution buffer (50 mm Tris ⁄ HCl pH 8.0, 10 mm glutathi-

one). The purity and concentration of GST–fusion proteins
was determined using SDS ⁄ PAGE followed by Coomassie
Brilliant Blue staining and the Bradford method.
Immunoprecipitation
For the immunoprecipitation of the FLAG–SRPK1a and
FLAG–SRPK1 kinases from HeLa cells, extracts of cells
transfected with pFLAG–CMV-2 ⁄ SRPK1a or pFLAG–
CMV-2 ⁄ SRPK1 were lysed with 1 mL lysis buffer (50 mm
Tris ⁄ HCl pH 7.5, 150 mm NaCl, 1% Triton X-100, 1 mm
phenylmethanesufonyl fluoride, 5 m m dithiothreitol) for
30 min on ice and centrifuged for 30 min at 12 000 g. One
hundred micrograms of FLAG–SRPK1a or FLAG–SRPK1
overexpressing cell extract were incubated with 0.3 lL of the
M2 monoclonal anti-FLAG IgG in immunoprecipitation
buffer (25 mm Tris ⁄ HCl pH 7.5, 150 mm NaCl, 1% Tri-
ton X-100, 1 mm phenylmethanesufonyl fluoride, 5 mm dith-
iothreitol) for 3 h at 4 °C. Twenty microliters of protein G
beads were added and incubated at 4 °C overnight. Antigen–
antibody complexes were collected by centrifugation and
washed three times with immunoprecipitation buffer.
For co-immunoprecipitation of the kinase with the SAFB
proteins, extracts of HeLa cells transfected with equal
quantities of plasmids expressing FLAG, FLAG–SRPK1a
or FLAG–SRPK1 and GFP, GFP–SAFB1 or GFP–SAFB2
were lysed 24 h after transfection with 200 lL RIPA buffer
(20 mm Tris ⁄ HCl pH 7.4, 150 mm NaCl, 0.5% Nonident
P-40, 0.5% NaDoc, 0.1% SDS, 1 mm EDTA, 0.5 mm
phenylmethanesufonyl fluoride) for 30 min on ice. The cell
suspension was then diluted in 800 lL RIPA-rescue buffer
(10 mm Na-phosphate pH 7.2, 20 mm NaCl, 0.5 mm phen-

ylmethanesufonyl fluoride), centrifuged at 12 000 g for
30 min at 4 °C and quantified by the Bio-Rad Protein assay
Dye Reagent (Bio-Rad Laboratories, Hercules, CA, USA).
Samples were incubated with 0.6 lg mouse monoclonal
anti-(FLAG M2) IgG (Sigma) for 3 h at 4 °C. Twenty mi-
croliters of protein G beads (Sigma-Aldrich) were added
and incubated at 4 °C overnight. Beads were collected by
centrifugation, washed three times with cold HNTG buffer
(50 mm Hepes pH 7.5, 150 mm NaCl, 1 mm EDTA, 10%
glycerol, 0.1% Triton X-100, 0.5 mm phenylmethanesufonyl
fluoride) and bound proteins were eluted in SDS sample
buffer. The same procedure was followed for the co-immu-
noprecipitation of endogenous SRPK and SAFB from
HeLa cell extracts.
Affinity chromatography
FLAG–SRPK1a or FLAG–SRPK1 immobilized on pro-
tein G beads was incubated with  100 lg of purified
GST–SAFB1C, GST–SAFB1CDRE, GST–SAFB2C or
GST in cold TNMT buffer (25 mm Tris ⁄ HCl pH 7.5,
150 mm NaCl, 0.1% Triton X-100, 1 mm phenylmethane-
sufonyl fluoride). After 1 h of incubation at 4 °C, the beads
were washed three times with TNMT buffer. The bound
proteins were eluted in SDS sample buffer, analysed by
SDS ⁄ PAGE and visualized by western blotting using the
relevant antibody.
Cell fractionation
Cell fractionation was based on a combination of the pro-
tocols described by Dignam et al. [62] and Jiang et al. [63].
Approximately 5 · 10
6

HeLa cells were harvested, washed
in NaCl ⁄ P
i
, resuspended in 500 lL of ice-cold buffer A
(10 mm Hepes ⁄ KOH pH 7.5, 10 mm KCl, 1.5 mm MgCl
2
,
0.5 mm dithiothreitol) and allowed to stand for 10 min at
4 °C. The cells were then collected by centrifugation, sus-
pended in 200 lL of buffer A and lysed by 10 strokes of a
glass Dounce homogenizer. The homogenate was centri-
fuged for 10 min at 5000 g and the supernatant was col-
lected as soluble cytoplasm fraction. The pellet was
resuspended in 100 lL buffer A and laid onto a 1.2 mL
cushion consisting of 0.8 m sucrose in buffer A. After cen-
trifugation at 5000 g for 10 min, the pellet (purified nuclei)
was collected, washed twice with NaCl ⁄ P
i
and extracted
with extraction buffer consisting of 10 mm Pipes pH 6.8,
250 mm ammonium sulfate, 300 mm sucrose, 3 mm MgCl
2
and 1 mm phenylmethanesufonyl fluoride. The supernatant
was collected as a soluble nucleoplasmic fraction, whereas
the pellets were then digested with RNAse-free DNAse I
(7.65 unitsÆlL
)1
) in digestion buffer (10 mm Pipes pH 6.8,
300 mm sucrose, 50 m m NaCl, 3 mm MgCl
2

, 0.5% Triton-
X 100 and 1 mm phenylmethanesufonyl fluoride) at 32 °C
for 60 min and centrifuged at 4300 g for 5 min. The pellets
(nuclear matrix fraction) were washed twice with extraction
buffer and resuspended in extraction buffer. Gel loading
was adjusted to give equivalent cell numbers in each lane.
In vitro kinase assay
Protein G beads, collected by centrifugation, as described
above, with FLAG–SRPK1a or FLAG–SRPK1 immuno-
precipitated from HeLa cells or 50 ng of full-length
SRPK1/1a inhibition by interaction with SAFB1/2 D. Tsianou et al.
5224 FEBS Journal 276 (2009) 5212–5227 ª 2009 The Authors Journal compilation ª 2009 FEBS
Coomassie-quantified GST–SRPK1 [21] (corresponding to
0.7 lg of Bradford measured GST purified protein) were
incubated with 2 lg GST–NtLBR or 7 lg GST–P2P-R or
10 lg synthetic peptide R
0
(
70
SSPSRRSRSRSRSRSPG-
RPAKG
91
) [19] and in vitro phosphorylation assays were
carried out as described previously [46]. Samples were incu-
bated in a total volume of 25 l L containing 25 mm
Tris ⁄ HCl pH 7.5, 10 mm MgCl
2
, 100 mm NaCl, 50 lm
[
32

P]ATP[cP] (Amersham, Bacacos SA, Greece) for 20 min
at 30 °C and the reaction was stopped by adding SDS buf-
fer and heating at 95 °C for 5 min. All samples were analy-
sed by 10 or 12% SDS ⁄ polyacrylamide gel followed by
Coomassie Brilliant Blue staining and labelled proteins were
detected by autoradiography.
Incorporation of radioactivity was measured by excising
the respective radioactive bands from an SDS ⁄ PAGE gel
and scintillation counting. RS kinase activity is expressed
as total units (%).
Acknowledgements
We wish to thank Dr S. Oesterreich (Baylor College of
Medicine and Methodist Hospital, Houston, TX, USA)
for kindly providing us with plasmid pGEX-
2TK ⁄ SAFB1C, Dr D.J. Elliot (University of Newcastle,
UK) for plasmids pGFP3–SAFB1 and pGFP3–SAFB2,
Dr H. Boleti (Hellenic Pasteur Institute, Athens, Greece)
for the rabbit anti-GFP serum and Dr R.E. Scott (Uni-
versity of Tennessee Health Science Center, Memphis,
TN, USA) for plasmid pCMV–FLAGÔ-24 ⁄ P2P-R. We
are also thankful to Dr G. Simos and Dr I. Mylonis for
helpful discussions and comments on the manuscript.
This work was supported by a grant from the Greek
Ministry of National Education and Religious affairs
(IRAKLEITOS in the context of the E.U funded
EPEAEK II program) to EG.
References
1 Boucher L, Ouzounis CA, Enright AJ & Blencowe BJ
(2001) A genome-wide survey of RS domain proteins.
RNA 7, 1693–1701.

2 Long JC & Caceres JF (2009) The SR protein family of
splicing factors: master regulators of gene expression.
Biochem J 417, 15–27.
3 Portal D, Lobo GS, Kadener S, Prasad J, Espinosa
JM, Pereira CA, Tang Z, Lin RJ, Manley JL, Kor-
nblihtt AR et al. (2003) Trypanosoma cruzi TcSRPK,
the first protozoan member of the SRPK family, is
biochemically and functionally conserved with
metazoan SR protein-specific kinases. Mol Biochem
Parasitol 127, 9–21.
4 Siebel CW, Feng L, Guthrie C & Fu XD (1999)
Conservation in budding yeast of a kinase specific for
SR splicing factors. Proc Natl Acad Sci USA 96, 5440–
5445.
5 Tang Z, Yanagida M & Lin RJ (1998) Fission yeast
mitotic regulator Dsk1 is an SR protein-specific kinase.
J Biol Chem 273, 5963–5969.
6 Kuroyanagi N, Onogi H, Wakabayashi T & Hagiwara
M (1998) Novel SR-protein-specific kinase, SRPK2,
disassembles nuclear speckles. Biochem Biophys Res
Commun 242, 357–364.
7 Gui JF, Tronchere H, Chandler SD & Fu XD (1994)
Purification and characterization of a kinase specific for
the serine- and arginine-rich pre-mRNA splicing factors.
Proc Natl Acad Sci USA 91, 10824–10828.
8 Wang HY, Lin W, Dyck JA, Yeakley JM, Songyang Z,
Cantley LC & Fu XD (1998) SRPK2: a differentially
expressed SR protein-specific kinase involved in mediat-
ing the interaction and localization of pre-mRNA splic-
ing factors in mammalian cells. J Cell Biol 140, 737–750.

9 Nakagawa O, Arnold M, Nakagawa M, Hamada H,
Shelton JM, Kusano H, Harris TM, Childs G,
Campbell KP, Richardson JA et al. (2005) Centro-
nuclear myopathy in mice lacking a novel muscle-
specific protein kinase transcriptionally regulated by
MEF2. Genes Dev 19, 2066–2077.
10 Cao W, Jamison SF & Garcia-Blanco MA (1997) Both
phosphorylation and dephosphorylation of ASF ⁄ SF2
are required for pre-mRNA splicing in vitro. RNA 3,
1456–1467.
11 Koizumi J, Okamoto Y, Onogi H, Mayeda A, Krainer
AR & Hagiwara M (1999) The subcellular localization
of SF2 ⁄ ASF is regulated by direct interaction with SR
protein kinases (SRPKs). J Biol Chem 274, 11125–
11131.
12 Yun CY, Velazquez-Dones AL, Lyman SK & Fu XD
(2003) Phosphorylation-dependent and -independent
nuclear import of RS domain-containing splicing fac-
tors and regulators. J Biol Chem 278, 18050–18055.
13 Misteli T & Spector DL (1998) The cellular organiza-
tion of gene expression. Curr Opin Cell Biol 10, 323–
331.
14 Caceres JF, Stamm S, Helfman DM & Krainer AR
(1994) Regulation of alternative splicing in vivo by over-
expression of antagonistic splicing factors. Science 265,
1706–1709.
15 Sanford JR, Longman D & Caceres JF (2003) Multiple
roles of the SR protein family in splicing regulation.
Prog Mol Subcell Biol 31, 33–58.
16 Gilbert W, Siebel CW & Guthrie C (2001) Phosphoryla-

tion by Sky1p promotes Npl3p shuttling and mRNA
dissociation. RNA 7, 302–313.
17 Lin S, Xiao R, Sun P, Xu X & Fu XD (2005) Dephos-
phorylation-dependent sorting of SR splicing factors
during mRNP maturation. Mol Cell 20, 413–425.
18 Nikolakaki E, Meier J, Simos G, Georgatos SD &
Giannakouros T (1997) Mitotic phosphorylation of the
D. Tsianou et al. SRPK1/1a inhibition by interaction with SAFB1/2
FEBS Journal 276 (2009) 5212–5227 ª 2009 The Authors Journal compilation ª 2009 FEBS 5225
lamin B receptor by a serine ⁄ arginine kinase and
p34(cdc2). J Biol Chem 272, 6208–6213.
19 Papoutsopoulou S, Nikolakaki E & Giannakouros T
(1999) SRPK1 and LBR protein kinases show identical
substrate specificities. Biochem Biophys Res Commun
255, 602–607.
20 Takano M, Koyama Y, Ito H, Hoshino S, Onogi H,
Hagiwara M, Furukawa K & Horigome T (2004) Regu-
lation of binding of lamin B receptor to chromatin by
SR protein kinase and cdc2 kinase in Xenopus egg
extracts. J Biol Chem 279, 13265–13271.
21 Papoutsopoulou S, Nikolakaki E, Chalepakis G, Kruft
V, Chevaillier P & Giannakouros T (1999) SR protein-
specific kinase 1 is highly expressed in testis and
phosphorylates protamine 1. Nucleic Acids Res 27,
2972–2980.
22 Mylonis I, Drosou V, Brancorsini S, Nikolakaki E,
Sassone-Corsi P & Giannakouros T (2004) Temporal
association of protamine 1 with the inner nuclear
membrane protein lamin B receptor during spermio-
genesis. J Biol Chem 279, 11626–11631.

23 Hishizawa M, Imada K, Sakai T, Ueda M, Hori T &
Uchiyama T (2005) Serological identification of adult
T-cell leukaemia-associated antigens. Br J Haematol
130, 382–390.
24 Sciabica KS, Dai QJ & Sandri-Goldin RM (2003)
ICP27 interacts with SRPK1 to mediate HSV splicing
inhibition by altering SR protein phosphorylation.
EMBO J 22, 1608–1619.
25 Daub H, Blencke S, Habenberger P, Kurtenbach A,
Dennenmoser J, Wissing J, Ullrich A & Cotten M
(2002) Identification of SRPK1 and SRPK2 as the
major cellular protein kinases phosphorylating hepati-
tis B virus core protein. J Virol 76, 8124–8137.
26 Fukuhara T, Hosoya T, Shimizu S, Sumi K, Oshiro T,
Yoshinaka Y, Suzuki M, Yamamoto N, Herzenberg
LA & Hagiwara M (2006) Utilization of host SR pro-
tein kinases and RNA-splicing machinery during viral
replication. Proc Natl Acad Sci USA 103, 11329–11333.
27 Nikolakaki E, Kohen R, Hartmann AM, Stamm S,
Georgatsou E & Giannakouros T (2001) Cloning and
characterization of an alternatively spliced form of SR
protein kinase 1 that interacts specifically with scaffold
attachment factor-B. J Biol Chem 276, 40175–40182.
28 Renz A & Fackelmayer FO (1996) Purification and
molecular cloning of the scaffold attachment factor B
(SAF-B), a novel human nuclear protein that specifically
binds to S ⁄ MAR–DNA. Nucleic Acids Res 24, 843–849.
29 Oesterreich S, Lee AV, Sullivan TM, Samuel SK, Davie
JR & Fuqua SA (1997) Novel nuclear matrix protein
HET binds to and influences activity of the HSP27

promoter in human breast cancer cells. J Cell Biochem
67, 275–286.
30 Nayler O, Stratling W, Bourquin JP, Stagljar I, Linde-
mann L, Jasper H, Hartmann AM, Fackelmayer FO,
Ullrich A & Stamm S (1998) SAF-B protein couples
transcription and pre-mRNA splicing to SAR ⁄ MAR
elements. Nucleic Acids Res 26, 3542–3549.
31 Weighardt F, Cobianchi F, Cartegni L, Chiodi I, Villa
A, Riva S & Biamonti G (1999) A novel hnRNP pro-
tein (HAP ⁄ SAF-B) enters a subset of hnRNP complexes
and relocates in nuclear granules in response to heat
shock. J Cell Sci 112, 1465–1476.
32 Arao Y, Kuriyama R, Kayama F & Kato S (2000) A
nuclear matrix-associated factor, SAF-B, interacts with
specific isoforms of AUF1 ⁄ hnRNP D. Arch Biochem
Biophys 380, 228–236.
33 Li J, Hawkins IC, Harvey CD, Jennings JL, Link AJ &
Patton JG (2003) Regulation of alternative splicing by
SRrp86 and its interacting proteins. Mol Cell Biol 23,
7437–7447.
34 Stoss O, Novoyatleva T, Gencheva M, Olbrich M, Bend-
erska N & Stamm S (2004) p59(fyn)-mediated phosphor-
ylation regulates the activity of the tissue-specific splicing
factor rSLM-1. Mol Cell Neurosci 27, 8–21.
35 Traweger A, Fuchs R, Krizbai IA, Weiger TM, Bauer
HC & Bauer H (2003) The tight junction protein ZO-2
localizes to the nucleus and interacts with the heteroge-
neous nuclear ribonucleoprotein scaffold attachment
factor-B. J Biol Chem 278, 2692–2700.
36 Townson SM, Kang K, Lee AV & Oesterreich S (2006)

Novel role of the RET finger protein in estrogen recep-
tor-mediated transcription in MCF-7 cells. Biochem
Biophys Res Commun 349, 540–548.
37 Scott RE, Giannakouros T, Gao S & Peidis P (2003)
Functional potential of P2P-R: a role in the cell cycle
and cell differentiation related to its interactions with
proteins that bind to matrix associated regions of
DNA? J Cell Biochem 90, 6–12.
38 Sergeant KA, Bourgeois CF, Dalgliesh C, Venables JP,
Stevenin J & Elliott DJ (2007) Alternative RNA splicing
complexes containing the scaffold attachment factor
SAFB2. J Cell Sci 120, 309–319.
39 Townson SM, Kang K, Lee AV & Oesterreich S (2004)
Structure–function analysis of the estrogen receptor
alpha corepressor scaffold attachment factor-B1: identi-
fication of a potent transcriptional repression domain.
J Biol Chem 279, 26074–26081.
40 Debril MB, Dubuquoy L, Feige JN, Wahli W, Desver-
gne B, Auwerx J & Gelman L (2005) Scaffold attach-
ment factor B1 directly interacts with nuclear receptors
in living cells and represses transcriptional activity.
J Mol Endocrinol 35, 503–517.
41 Jiang S, Meyer R, Kang K, Osborne CK, Wong J &
Oesterreich S (2006) Scaffold attachment factor SAFB1
suppresses estrogen receptor alpha-mediated transcrip-
tion in part via interaction with nuclear receptor
corepressor. Mol Endocrinol 20, 311–320.
42 Townson SM, Dobrzycka KM, Lee AV, Air M,
Deng W, Kang K, Jiang S, Kioka N, Michaelis K &
SRPK1/1a inhibition by interaction with SAFB1/2 D. Tsianou et al.

5226 FEBS Journal 276 (2009) 5212–5227 ª 2009 The Authors Journal compilation ª 2009 FEBS
Oesterreich S (2003) SAFB2, a new scaffold attachment
factor homolog and estrogen receptor corepressor.
J Biol Chem 278, 20059–20068.
43 Ivanova M, Dobrzycka KM, Jiang S, Michaelis K,
Meyer R, Kang K, Adkins B, Barski OA, Zubairy S,
Divisova J et al. (2005) Scaffold attachment factor B1
functions in development, growth, and reproduction.
Mol Cell Biol 25 , 2995–3006.
44 Chan CW, Lee YB, Uney J, Flynn A, Tobias JH &
Norman M (2007) A novel member of the SAF (scaf-
fold attachment factor)-box protein family inhibits gene
expression and induces apoptosis. Biochem J 407,
355–362.
45 Lee YB, Colley S, Norman M, Biamonti G & Uney JB
(2007) SAFB re-distribution marks steps of the apopto-
tic process. Exp Cell Res 313, 3914–3923.
46 Nikolakaki E, Simos G, Georgatos SD &
Giannakouros T (1996) A nuclear envelope-associated
kinase phosphorylates arginine–serine motifs and
modulates interactions between the lamin B receptor
and other nuclear proteins. J Biol Chem 271,
8365–8372.
47 Cazalla D, Zhu J, Manche L, Huber E, Krainer AR &
Caceres JF (2002) Nuclear export and retention signals
in the RS domain of SR proteins. Mol Cell Biol 22,
6871–6882.
48 Ding JH, Zhong XY, Hagopian JC, Cruz MM,
Ghosh G, Feramisco J, Adams JA & Fu XD (2006)
Regulated cellular partitioning of SR protein-specific

kinases in mammalian cells. Mol Biol Cell 17, 876–885.
49 Xiao SH & Manley JL (1998) Phosphorylation–dephos-
phorylation differentially affects activities of splicing
factor ASF ⁄ SF2. EMBO J 17, 6359–6367.
50 Nikolakaki E, Drosou V, Sanidas I, Peidis P, Papamar-
caki T, Iakoucheva LM & Giannakouros T (2008)
RNA association or phosphorylation of the RS domain
prevents aggregation of RS domain-containing proteins.
Biochim Biophys Acta 1780, 214–225.
51 Ngo JC, Giang K, Chakrabarti S, Ma CT, Huynh N,
Hagopian JC, Dorrestein PC, Fu XD, Adams JA &
Ghosh G (2008) A sliding docking interaction is essen-
tial for sequential and processive phosphorylation of an
SR protein by SRPK1. Mol Cell 29, 563–576.
52 Nolen B, Yun CY, Wong CF, McCammon JA, Fu XD
& Ghosh G (2001) The structure of Sky1p reveals a
novel mechanism for constitutive activity. Nat Struct
Biol 8, 176–183.
53 Aubol BE, Chakrabarti S, Ngo J, Shaffer J, Nolen B,
Fu XD, Ghosh G & Adams JA (2003) Processive
phosphorylation of alternative splicing factor ⁄
splicing factor 2. Proc Natl Acad Sci USA 100,
12601–12606.
54 Ma CT, Velazquez-Dones A, Hagopian JC, Ghosh G,
Fu XD & Adams JA (2008) Ordered multi-site phos-
phorylation of the splicing factor ASF ⁄ SF2 by SRPK1.
J Mol Biol 376, 55–68.
55 Chiodi I, Biggiogera M, Denegri M, Corioni M,
Weighardt F, Cobianchi F, Riva S & Biamonti G
(2000) Structure and dynamics of hnRNP-labelled

nuclear bodies induced by stress treatments. J Cell Sci
113, 4043–4053.
56 Denegri M, Chiodi I, Corioni M, Cobianchi F, Riva S
& Biamonti G (2001) Stress-induced nuclear bodies are
sites of accumulation of pre-mRNA processing factors.
Mol Biol Cell 12 , 3502–3514.
57 Takeuchi M & Yanagida M (1993) A mitotic role for a
novel fission yeast protein kinase dsk1 with cell cycle
stage dependent phosphorylation and localization. Mol
Biol Cell 4, 247–260.
58 Lamond AI & Spector DL (2003) Nuclear speckles: a
model for nuclear organelles. Nat Rev Mol Cell Biol 4,
605–612.
59 Saitoh N, Spahr CS, Patterson SD, Bubulya P, Neuwald
AF & Spector DL (2004) Proteomic analysis of inter-
chromatin granule clusters. Mol Biol Cell 15, 3876–3890.
60 Mermoud JE, Cohen PT & Lamond AI (1994) Regula-
tion of mammalian spliceosome assembly by a protein
phosphorylation mechanism. EMBO J 13, 5679–5688.
61 Misteli T (2008) Physiological importance of RNA and
protein mobility in the cell nucleus. Histochem Cell Biol
129, 5–11.
62 Dignam JD, Lebovitz RM & Roeder RG (1983) Accu-
rate transcription initiation by RNA polymerase II in a
soluble extract from isolated mammalian nuclei. Nucleic
Acids Res 11, 1475–1489.
63 Jiang M, Axe T, Holgate R, Rubbi CP, Okorokov AL,
Mee T & Milner J (2001) p53 binds the nuclear matrix
in normal cells: binding involves the proline-rich
domain of p53 and increases following genotoxic stress.

Oncogene 20, 5449–5458.
D. Tsianou et al. SRPK1/1a inhibition by interaction with SAFB1/2
FEBS Journal 276 (2009) 5212–5227 ª 2009 The Authors Journal compilation ª 2009 FEBS 5227