Báo cáo khoa học: Hypoxia-driven proliferation of embryonic neural stem ⁄ progenitor cells – role of hypoxia-inducible transcription factor-1a ppt

Hypoxia-driven proliferation of embryonic neural
stem
⁄
progenitor cells – role of hypoxia-inducible
transcription factor-1a
Tong Zhao
1,
*, Cui-ping Zhang
1,
*, Zhao-hui Liu
1
, Li-ying Wu
1
, Xin Huang
1
, Hai-tong Wu
1
,
Lei Xiong
1
, Xuan Wang
2
, Xiao-min Wang
2
, Ling-ling Zhu
1
and Ming Fan
1,2
1 Department of Brain Protection and Plasticity, Institute of Basic Medical Sciences, Beijing, China
2 Key Laboratory for Neurodegenerative Disorders of the Ministry of Education and Department of Physiology, Capital Medical University,
Beijing, China

Neural stem ⁄ progenitor cells (NPCs), which exist in
the developing and adult mammalian brain, are self-
renewing and can differentiate into neurons, astrocytes
or oligodendrocytes in vitro [1–3]. Stem cells derived
from the embryonic midbrain have been successfully
engrafted into the central nervous system (CNS) to
cure diseases such as stroke, ischemia and Parkinson’s
disease [4–8]. A recent encouraging report has raised
hopes of using human NPCs for patients with brain
trauma [9]. Although some growth factors, such as epi-
dermal growth factor, glial cell line-derived neuro-
trophic factor, leukemia inhibitory factor, and vascular
Keywords
embryonic neural stem or progenitor cells;
HIF-1a; hypoxia; proliferation
Correspondence
L l. Zhu, Department of Brain Protection
and Plasticity, Institute of Basic Medical
Sciences, Beijing, China
No. 27 Taiping Rd, Beijing 100850, China
Fax: +86 10 6821 3039
Tel: +86 6821 0077 ext. 931315
E-mail:
M. Fan, Department of Brain Protection and
Plasticity, Institute of Basic Medical
Sciences, Beijing, China
No.27 Taiping Rd, Beijing 100850, China
Fax: +86 10 6821 3039
Tel: +86 10 6821 4026
E-mail:

*These authors contributed equally to this
work
(Received 20 November 2007, revised 3
February 2008, accepted 15 February 2008)
doi:10.1111/j.1742-4658.2008.06340.x
We recently reported that intermittent hypoxia facilitated the proliferation
of neural stem ⁄ progenitor cells (NPCs) in the subventricule zone and hip-
pocampus in vivo. Here, we demonstrate that hypoxia promoted the prolif-
eration of NPCs in vitro and that hypoxia-inducible factor (HIF)-1a, which
is one of the key molecules in the response to hypoxia, was critical in this
process. NPCs were isolated from the rat embryonic mesencephalon
(E13.5), and exposed to different oxygen concentrations (20% O
2
, 10% O
2
,
and 3% O
2
) for 3 days. The results showed that hypoxia, especially
10% O
2
, promoted the proliferation of NPCs as assayed by bromodeoxy-
uridine incorporation, neurosphere formation, and proliferation index. The
level of HIF-1a mRNA and protein expression detected by RT-PCR and
western blot significantly increased in NPCs subjected to 10% O
2
. To fur-
ther elucidate the potential role of HIF-1a in the proliferation of NPCs
induced by hypoxia, an adenovirus construct was used to overexpress HIF-
1a, and the pSilencer 1.0-U6 plasmid as RNA interference vector targeting

HIF-1a mRNA was used to knock down HIF-1a. We found that over-
expression of HIF-1a caused the same proliferative effect on NPCs under
20% O
2
as under 10% O
2
. In contrast, knockdown of HIF-1a inhibited
NPC proliferation induced by 10% O
2
. These results demonstrated
that moderate hypoxia was more beneficial to NPC proliferation and that
HIF-1a was critical in this process.
Abbreviations
BrdU, bromodeoxyuridine; CKO, conditioned knockout; CNS, central nervous system; eGFP, enhanced green fluorescent protein;
HIF, hypoxia-inducible factor; mNPC, mouse neural precursor cell; m.o.i., multiplicity of infection; MSC, mesenchymal stem cell; NPC,
neural stem ⁄ neural progenitor cell; PI, proliferation index; RNAi, RNA interference; shRNA, short hairpin RNA; siRNA, small interfering RNA;
VEGF, vascular endothelial growth factor.
1824 FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS
endothelial growth factor (VEGF), can regulate the
proliferation of NPCs in vitro [10–12], the expansion
of NPCs in vitro is too slow to meet the huge demand
for NPCs, which can be used in clinical transplanta-
tion without side-effects. The development of more
effective methods for expansion of NPCs has become
urgent and important both in vitro and in vivo.
Recently, reports have shown that hypoxia can reg-
ulate the proliferation and differentiation of stem
cells, and that, especially, mild hypoxia has salutary
effects on stem ⁄ progenitor cells [12–14]. Cytotropho-
blasts proliferate at low O

2
tensions and differentiate
into a highly invasive phenotype at high O
2
tensions
[15,16]. Mesenchymal stem cells (MSCs) from rat
bone marrow display enhanced colony-forming capa-
bility and increased proliferation at 5% O
2
as com-
pared to those at 20% O
2
[17]. Studer and Morrison
reported that O
2
lowered to more physiological levels
(3%) produced marked trophic and proliferative
effects on neural precursors and significantly changed
developmental kinetics and outcome as compared
with traditional culture conditions (20%) [13,14]. We
also found that hypoxia (3% O
2
) increased the prolif-
eration of human MSCs, myoblasts, and neural stem
cells [12]. These observations indicate that mild
hypoxia may be a useful tool for expansion of some
stem cells for clinical use in vitro at low cost. How-
ever, the molecular mechanisms involved in prolifera-
tion of stem cells under hypoxic conditions are not
well understood.

Hypoxia-inducible factor (HIF)-1 is one of the key
transcription factors in the response to hypoxia; it
mediates a variety of adaptive cellular and systemic
responses to hypoxia by upregulating the expression
of > 50 different genes to assist animals in their
adaptation and survival [18]. HIF is a heterodimeric
DNA-binding complex consisting of a- and b-sub-
units, which are members of the bHLH-PAS
(PER-ARNT-SIM) superfamily of proteins [19,20].
The increase in HIF-1 activity is primarily due to the
hypoxia-induced stabilization and activation of HIF-
1a, which is degraded by the ubiquitin–proteasome
system under normoxic conditions [21]. It has been
reported that a hypoxic environment is essential for
early development, and that HIF-1a induced by a
low O
2
tension plays an important role in maintain-
ing the proliferative and undifferentiated phenotype
in human trophoblasts [15,16]. In addition, HIF-1a
conditioned knockout (CKO) caused midbrain-specific
impairment. Survival of mouse neural precursor cells
(mNPCs) and expression of VEGF mRNA was
reduced in HIF-1a CKO. However, treatment of
HIF-1a CKO mNPCs with 50 ngÆmL
)1
VEGF only
partially restored proliferation [22]. On other hand, it
was reported that low O
2

could increase the expres-
sion of fibroblast growth factor 8 and erythropoietin
during proliferation of NPCs. Furthermore, research
findings showed that NPCs exposed to 250 ng Æ mL
)1
fibroblast growth factor 8 could partly recapitulate
the proliferation–trophic effects of lowered O
2
on
CNS stem cells [13]. Recently, we demonstrated that
hypoxia promoted human bone barrow-derived MSC
proliferation in vitro. The gene profile assayed by
using cDNA microarrays showed that only four genes
among 282 differentially expressed genes were known
to be HIF-1-targeted genes [23]. From the above, we
wondered whether HIF-1a induced by lowered O
2
is
a contributory factor in hypoxia-driven proliferation
of NPCs in vitro.
In the present study, different O
2
concentrations
(20% O
2
, 10% O
2
, and 3% O
2
) were adopted for cul-

turing NPCs to further assess the effect of hypoxia on
NPC proliferation. In an attempt to elucidate the role
of HIF-1a in the hypoxia-induced proliferative effect,
we investigated the expression of HIF-1a mRNA
and protein during the proliferation of NPCs under
hypoxia, and the effect of overexpression or knock-
down of HIF-1a on NPC proliferation.
Results
Hypoxia promotes the proliferation of NPCs
Neurosphere formation
It has been reported that lowered O
2
(3 ± 2%) pro-
motes the survival and growth of neural stem cells
derived from the neural crest and midbrain [13,14]. In
order to further elucidate the effect of hypoxia on
NPC proliferation, different O
2
concentrations were
employed, and the neural stem cells derived from the
embryonic mesencephalon (E13.5) were used in the
present study. Generally, neural stem cells were grown
to form as neurospheres in vitro. The ability of stem
cells to form neurospheres is one of the indicators for
proliferation of neural stem cells in vitro. The passaged
neurospheres were dissociated into single cells and
planted in four-well plates at a density of 5 · 10
4
cells
per well, and then cultured under different O

2
concen-
trations (20% O
2
, 10% O
2
, and 3% O
2
) for 3 days.
The number of neurospheres formed in each well was
counted blindly after 3 days of culture. We found that
the numbers of neurospheres in 10% O
2
and 3% O
2
were increased 2.5-fold and 1.5-fold, respectively, as
compared with that in 20% O
2
(Fig. 1A–C). These
data showed that hypoxia, especially 10% O
2
, signifi-
cantly increased the number of neurospheres.
T. Zhao et al. HIF-1a in hypoxia-driven proliferation of NPCs
FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS 1825
Proliferation index (PI)
We then determined the PI of NPCs by performing
a flow cytometric measurement of DNA distributions
of cells. Phase fractions calculated from such distri-
butions are used to study the growth characteristics

of NPCs. The NPCs were stained with propidium
iodide after being subjected to different O
2
concen-
tration for 3 days. Three cell subpopulations (G
1
,S
and G
2
+ M) were estimated. Under lower O
2
0
200
400
600
800
1000
1200
**
**
Number of neural spheres
**
**
0
100
200
300
400
500
600

700
800
900
1000
20% 10% 3%
Number of BrdU positive cells
0
5
10
15
20
25
30
35
40
20 % 10 % 3 %
20 % 10 % 3 %
**
*
Proliferation index (%)
AB
D
control 10%
750600450
390 520 650
300
260
150
130
0

0
0 1000
DNA content
0 1000
DNA content
Counts
Counts
EF
GH
I
C
Fig. 1. Hypoxia promoted the proliferation of embryonic NPCs. (A) Phase contrast images of neurospheres formed under normoxic
(20% O
2
) conditions. (B) Phase contrast images of neurospheres formed under hypoxic (10% O
2
) conditions. (C) The number of neuro-
spheres produced under hypoxic conditions, especially 10% O
2
, increased significantly as compared with control. Hypoxia promoted the for-
mation of neurospheres. (D, E) Flow cytometric analysis showed that hypoxia, especially 10% O
2
, led to more NPCs in the S phase and
G
2
⁄ M phase of the cell cycle. (F) Cartogram of flow cytometric analysis. Hypoxia increased the PI. BrdU was added to the culture medium
(10 l
M), and NPCs were cultured in different O
2
concentrations (20% O

2
, 10% O
2
, and 3% O
2
) for 3 days. (G) Representative photograph of
BrdU-labeled cells in the control (20% O
2
). (H) Representative photograph of BrdU-labeled cells under hypoxia (10% O
2
). (I) Hypoxia signifi-
cantly enhanced the number of BrdU-labeled cells. The data are the means ± SD (n = 4). *P < 0.05, **P < 0.01, as compared with control
(20% O
2
). Scale bar = 100 l m.
HIF-1a in hypoxia-driven proliferation of NPCs T. Zhao et al.
1826 FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS
conditions, especially under 10%, more NPCs were
in S phase and G
2
⁄ M phase of the cell cycle as com-
pared with NPCs grown in 20% O
2
(PI values were
23.87 ± 0.5 in the 20% group, 31.08 ± 1.7 in
the 10% group, and 25.23 ± 0.3 in the 3% group;
Fig. 1D–F). The data here suggested that more
neural stem cells entered the proliferative phase
under hypoxia, which was consistent with the above
data.

Bromodeoxyuridine incorporation assay
Incorporation of Bromodeoxyuridine (BrdU) into
growing (DNA-synthesizing) S phase cells is more
accurate in determining phase fractions. We further
used BrdU incorporation to determine whether
hypoxia affects the DNA synthesis phase of NPCs.
BrdU (10 lm) was added to the culture medium, and
the NPCs were exposed to different O
2
concentrations
(20% O
2
, 10% O
2
, and 3% O
2
). The number of
BrdU-positive cells among the newly divided cells was
measured after 3 days by BrdU immunohistochemis-
try. The numbers of BrdU-positive cells under
10% O
2
and 3% O
2
showed an 88% and a 63%
increase, respectively, as compared with the control
(20% O
2
; Fig. 1G–I). These results showed that
hypoxia could increase the number of BrdU-positive

NPCs.
Expression of HIF-1a in NPCs under hypoxia (10%)
The above data demonstrate that hypoxia, especially
10% O
2
, promoted the proliferation of neural stem
cells in vitro. We further investigated the expression
of HIF-1a during proliferation of NPCs, which is the
key molecular event in the response to hypoxia. The
NPCs were exposed to 10% O
2
for different periods
of time (1, 3, 6, 12, 24, 48, and 72 h). Then, the cells
were collected at different time points; the expression
of HIF-1a mRNA was detected by RT-PCR, and
HIF-1a protein was detected by western blot. The
data showed that HIF-1a mRNA in NPCs was
expressed constantly under both normoxia and
hypoxia, and increased from 6 to 72 h (Fig. 2A,B).
However, expression of HIF-1a protein was undetect-
able under normoxic conditions, whereas a strong
signal was observed in the hypoxic group. The level
of HIF-1a protein expression increased from 6 h
onwards, and lasted for 3 days in the hypoxic group,
as compared with the control at the same time point
(Fig. 2C,D). These results demonstrate that hypoxia
induced the expression of HIF-1a during the prolifer-
ation of NPCs.
Overexpression of HIF-1a promotes NPC proliferation
To investigate the role of HIF-1a in hypoxia-driven

proliferation of NPCs, an adenovirus construct con-
taining CMV HIF-1a was used to overexpress HIF-1a
in NPCs [CMV-enhanced green fluorescent protein
(eGFP) vector was used as control]. As detailed in
Experimental procedures, the NPCs were dissociated
into single cells, and infected with adenovirus at a titer
of 50 multiplicity of infection (m.o.i.) for 2 h. Then
these cells were exposed to either hypoxia (10% O
2
)or
normoxia (20% O
2
) for 3 days. The adenovirus at a
C H C H C H C H C H C H C H
1
8SRNA
HIF-1α
*
*
*
**
**
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7

0.8
1h 3h 6h 12h 24h 48h 72h
HIF-1α / 18S
Control
Hypoxia
C H C H C H C H C H C H C H
β-Actin
HIF-1α
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
1 h 3 h 6 h 12h 24 h 48h 72 h
HIF-1α / actin
*
*
*
*
*
*
A
B
C
D

Fig. 2. Hypoxia increased the expression of HIF-1a in NPCs. Cells
were exposed to 20% O
2
or 10% O
2
for different periods of time,
and then collected for RT-PCR and western blot assay. (A) Repre-
sentative photograph for HIF-1a mRNA tested by RT-PCR (C, con-
trol; H, hypoxia). (B) The level of HIF-1a mRNA expression
measured by densitometry analysis. The HIF-1a mRNA expression
value was normalized to that of 18S. (C) Representative photograph
for HIF-1a protein tested by western blot (C, control; H, hypoxia). A
strong signal was observed in the groups exposed to hypoxia from
6 h to 3 days, whereas no expression of HIF-1a protein could be
detected in the control.
T. Zhao et al. HIF-1a in hypoxia-driven proliferation of NPCs
FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS 1827
titer of 50 m.o.i. resulted in an infection rate of almost
95%, with no significant increase in viral toxicity. The
expression of HIF-1a protein showed an increase after
infection with Ad–HIF-1a (Fig. 3A). The total number
of cells in NPCs infected with Ad–HIF-1a increased in
comparison to those in the Ad–eGFP group under
normal condition (Fig. 3B). Flow cytometric analyses
showed that overexpression of HIF-1a enhanced the
PI of NPCs under normal conditions, and that the
Ad–HIF-1a groups had a significantly increased PI
(Fig. 3C,D). These results suggest that overexpression
of HIF-1a could partially mimic the effect of hypoxia
on proliferation of NPCs in vitro.

Knockdown of HIF-1a expression inhibits NPC
proliferation
To knock down HIF-1a expression, the pSilencer 1.0-
U6 plasmid was constructed as an HIF-1a-targeted
RNA interference (RNAi) vector. Three selected small
interfering (si)RNAs targeting HIF-1 a sequences were
designed. The efficiency of the RNAi was estimated by
con
HIF-1α
β-Actin
0
5
10
15
20
25
30
35
Proliferation index (%)
con con/HIF 10% 10%/HI
F
**
*
**#
0
50
100
150
200
250

Number of total cells (x10
4
·mL
–1
)
con con/HIF 10% 10%/HIF
**
**
#
**
A
B
D
C
con GFP
10% GFP 10% HIF
con HIF
650
4503602701809000 100 200 300 400 500
52039026013006505203902601300
0 1000
DNA content
0 1000
DNA content
0 1000
DNA content
0 1000
DNA content
CountsCounts
CountsCounts

10%/HIF10%con/HIF
Fig. 3. Overexpression of HIF-1a promoted proliferation of NPCs under normoxic conditions. Cells infected with adenovirus at a titer of
50 m.o.i. were exposed to either 10% or 20% O
2
for 3 days. (A) Expression of HIF-1a protein was analyzed by western blot; expression of
HIF-1a in NPCs infected with Ad–HIF under normoxia increased as compared with the control. (B) Data for number of total cells counted by
hematocytometer. The total number of cells in the con ⁄ HIF group infected with Ad–HIF under normoxia increased significantly as compared
with that in the control group. (C) Representative flow cytometric analyses. (D) Cartogram of flow cytometric analyses. The data showed
that overexpression of HIF-1a enhanced the PI of NPCs. The data are the means ± SD. **P < 0.01 as compared with the control group;
#
P < 0.01 as compared with the 10% O
2
group.
HIF-1a in hypoxia-driven proliferation of NPCs T. Zhao et al.
1828 FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS
testing the expression of HIF-1a after transfection. We
found that RNAi could significantly reduce the expres-
sion of HIF-1a, and RNAi was consequently used for
the following experiment. The NPCs were transfected
with the pSilencer 1.0-U6 plasmid by Lipofecta-
mine 2000, and then cells were exposed to either norm-
oxia (20% O
2
) or hypoxia (10% O
2
) for 3 days. The
percentage of GFP-positive cells was about 70% of
that of total neural stem cells after 3 days of transfec-
tion (Fig. 4A). The expression of HIF-1a was detected
by western blot, which showed that the level of HIF-

1a protein decreased in the RNAi group as compared
with the negative control in the hypoxic condition
(Fig. 4B). Flow cytometric analyses showed that the PI
of GFP-positive cells decreased in the RNAi group as
compared with the negative control in the hypoxic
condition (Fig. 4C,D). These results suggest that
knockdown of HIF-1a could partially decrease the
proliferation of NPCs induced by hypoxia (10% O
2
).
Discussion
In the present study, we demonstrated that hypoxia
promoted the proliferation of NPCs in vitro and that
HIF-1a played a key role in this process: (a) hypoxia,
especially 10% O
2
, had a more potent proliferative
effect on NPCs; (b) the level of HIF-1a mRNA and
protein expression in NPCs increased significantly dur-
ing proliferation of NPCs under hypoxia; and (c) over-
expression of HIF-1a could mimic the hypoxia-driven
proliferative effect in NPCs under 20% O
2
. Con-
versely, lowering HIF-1a levels by RNAi reduced the
0
5
10
15
20

25
30
35
Proliferation index (%)
con conRNAi 10% 10%RNAi
**
**
HIF-1α
β-actin
con conRNAi 10% 10%RNAi
AB
DC
con
con RNAi
10% RNAi
10%
2000
0 1000
DNA content
0 1000
DNA content
0 1000
DNA content
0 1000
DNA content
Counts
2000
Counts
2000
Counts

2000
Counts
Fig. 4. Knockdown of HIF-1a repressed hypoxia-driven proliferation of NPCs. (A) Photographs of NPCs transfected with empty vector (green:
GFP; scale bar = 200 lm). (B) Evaluation of HIF-1a protein expression (lane 1, normoxia + empty vector; lane 2, normoxia + RNAi vector;
lane 3, hypoxia + empty vector; lane 4, hypoxia + RNAi vector). Downregulation of HIF-1a decreased the enhanced PI of NPCs induced by
hypoxia. (A) Cytometry analysis indicates that the PI of NPCs was decreased by downregulation of HIF-1a. (B) Graph of the PI of NPCs.
Each bar represents the mean ± SD **P < 0.01 as compared with control;
##
P < 0.01, as compared with 10% O
2
.
T. Zhao et al. HIF-1a in hypoxia-driven proliferation of NPCs
FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS 1829
ability of hypoxia to induce proliferation. These sug-
gest that mild hypoxia is a useful measure for expan-
sion of embryonic NPCs in vitro and that HIF-1a is
the causative molecule in this process.
Lowered O
2
culture favors the proliferation of NPCs
Standard conditions for culture of mammalian cells
employ about 20% O
2
in vitro. Exposure of cells to
O
2
deprivation in vitro has been shown to reduce pro-
liferation and ⁄ or lead to programmed cell death
[24,25]. However, there is considerable controversy in
the literature regarding cellular responses under

hypoxia [26–28], and most of the discrepancies can be
explained by differences in O
2
concentration, exposure
time, and type of cells. In general, O
2
concentrations
over 1%, rather than arresting the growth of most
kinds of cells, promote the proliferation of some
types of cells. There is increasing evidence that mild
hypoxia acts as a potent regulator of various types of
stem cells [12]. Therefore, the effects of hypoxia
on the stem cells are extensive, cell-type specific, and
O
2
-regulated.
The modulation of cell proliferation in NPCs is
believed to play a role in neuronal regeneration. In
2000, Morrison and Studer reported for the first time
that culturing NPCs from E12 rat mesencephalon and
peripheral nerve crest in a decreased O
2
(3 ± 2%)
environment promoted their survival, proliferation,
and differentiation [13,14]. They also found that the
cells yielded greater numbers of precursors and showed
less apoptosis after being grown in low O
2
(3 ± 2%)
for 6 days. Storch and colleagues cultured human me-

sencephalic neural precursor cells in low O
2
(3%), and
found long-term proliferation of these cells, which
could grow and survive for up to 11 months [11,30].
To mimic physiological or pathological hypoxia, in the
present study different O
2
concentrations were adopted
to investigate the effects of hypoxia on NPC prolifera-
tion in vitro.
The results of BrdU administration, neurosphere
counting and PI determination demonstrated that
hypoxia (3% O
2
) promoted NPC proliferation in vitro,
which is consistent with previous reports [13,14]. In
addition, we also found that 10% O
2
is more beneficial
to NPC proliferation in vitro than 3% O
2
. The above
data indicate that mild hypoxia promoted the prolifer-
ation of NPCs in both the peripheral nervous system
and CNS of rat and human in vitro. These results sug-
gest that lowered O
2
conditions favor neural NPCs,
and that a suitable level of hypoxia could be a useful

tool for expansion of NPCs for ex vivo cell therapy
and for a mechanism study of neural development.
Possible role of HIF-1a in hypoxia-driven proliferation
of NPCs
HIF-1 has been identified as an important transcription
factor that mediates the cellular response to hypoxia,
promoting either cellular survival or apoptosis under
different conditions [24,25]. Activation of HIF-1a
under < 1% O
2
in the pathogenesis of cancer cells has
been widely studied, and the involvement of HIF-1a in
antiproliferation, migration and invasion of cancer cells
has been shown [31–35]. However, the role of HIF-1a
in hypoxia-driven proliferation is less well understood.
HIF-1 is composed of two subunits: HIF-1a and
HIF-1b. HIF-1b, also called ARNT, is expressed con-
stitutively in all cells and does not respond to changes
in O
2
tension, whereas HIF-1a is specific in its response
to hypoxia [36]. It has been reported that hypoxia
induces the transcription of HIF-1a mRNA, which
increases the level of HIF-1a protein in the presence
of continued hypoxia [37,38]. Expression of HIF-1
(protein level) was markedly upregulated by hypoxia
[36,39]. Consistent with the above, our data showed
that the expression of HIF-1a mRNA in NPCs
increased from 6 h to 72 h during exposure to hypoxia
(Fig. 2A). Under normoxic conditions, HIF-1a is con-

stitutively synthesized and sent to be destroyed by the
ubiquitin–proteasome pathway (half-life < 5 min), so
HIF-1a protein is absent or nearly absent in most
normoxic cells [40,41]. Consistent with this, we did not
detect the expression of HIF-1a protein in NPCs under
normoxic conditions. With the onset of hypoxia
(10% O
2
), we found that HIF-1a protein in NPCs was
highly expressed and that this lasted for at least 3 days.
Therefore, HIF-1a protein expression is stable under
hypoxic conditions from 6 to 72 h as compared with
the control at each time point (Fig. 2C). From our
quantification of the data in Fig. 2D, the expression of
HIF-1a protein indicates a very dynamic regulation
pattern during hypoxia. Under hypoxia, HIF-1a sub-
units are stabilized, translocated to the nucleus, dimer-
ized with the stable b-subunit ARNT, and promote
O
2
-regulated gene expression. These results indicate
that HIF-1a might play an important role in this
process.
To determine whether HIF-1a plays a key role in
hypoxia-driven NPC proliferation, overexpression of
HIF-1a and RNAi were applied to study the role of the
HIF-1a gene in NPCs. First, overexpression of HIF-1a
by transient adenovirus transfection caused the same
proliferative effect under normal conditions as that in
hypoxia. HIF-1a overexpression could mimic the prolif-

eration of NPCs under normal conditions. This suggests
that activation of HIF-1a is the primary hypoxia-driven
HIF-1a in hypoxia-driven proliferation of NPCs T. Zhao et al.
1830 FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS
signaling pathway in NPCs, as well as in human pulmo-
nary artery fibroblasts [26,39] and human vascular
smooth muscle cells [42]. Second, specific inhibition of
HIF-1a by RNAi technology was achieved. With this
approach, it was found that short hairpin RNA
(shRNA) targeting human HIF-1a was transferred into
human endothelial progenitor cells by an adenoviral
vector. HIF-1a mRNA and protein expression were
dramatically and specifically downregulated after
siRNA–HIF-1a infection in cells under hypoxia.
HIF-1a knockdown via adenoviral siRNA transfer
inhibited endothelial progenitor cell colony formation,
differentiation, and proliferation [43]. Consistent with
this, this effect in our study persisted for at least 72 h
and was accompanied by suppression of HIF-1a protein
expression (Fig. 4B). Knockdown of HIF-1a expression
inhibits NPC proliferation induced by 10% O
2
. These
observations suggest that HIF-1a plays an important
role in hypoxia-induced NPC proliferation. The above
data support the conclusion that HIF-1a is critical in
hypoxia-induced NPC proliferation.
Conclusion
Efficient generation of NPCs in vitro may serve as a
source of cells for brain repair and treatment of neuro-

degenerative diseases. Moreover, to eliminate the risk
of transformation in culture, an ideal expansion proto-
col would produce rapid proliferation without the need
for prolonged passage in cell culture. In this study, we
found that hypoxia provides an easily expandable
source of NPCs in vitro for transplantation, and we
confirmed for the first time that the HIF-1 signaling
pathway was activated and critical in hypoxia-driven
proliferation of NPCs. On the basis of this result, we
believe that elucidation of the molecular mechanisms
mediating this phenomenon may stimulate new strate-
gies for expansion of NPCs.
Experimental procedures
Animals
Pregnant 13.5-day-old Wistar rats were used. The Institu-
tional Animal Care and Use Committee (IACUC) of the
Academy of Military Medical Science gave consent for the
use of rats in all of the experiments.
Isolation and culture of NPCs
Cells derived from Wistar rat mesencephalon (E13.5) were
mechanically dissociated and grown in DMEM ⁄ F-12 (1 : 1)
medium containing 2 mml-glutamine, 5 IU of penicillin,
5 lgÆmL
)1
streptomycin, 1% N
2
, 1% B27 (Invitrogen,
Grand Island, NY, USA), 20 ngÆmL
)1
EGF (Sigma, St

Louis, MO, USA) and 20 ngÆmL
)1
basic fibroblast growth
factor (Invitrogen). The primary neurospheres were defined
as passage zero (P0) NPCs. The NPCs were subcultured
into two to five generations, and used in the following
experiments.
Hypoxic conditions
For decreased O
2
conditions, an incubator chamber
(Therm 3111; Billups-Rothenberg, Del Mar, CA, USA),
which is adjustable for the desired O
2
concentration, was
used. The incubator chamber was flushed with 5% CO
2
(bal-
ance N
2
). The actual concentrations of 20% O
2
, 10% O
2
and 3% O
2
inside the chamber were based on direct mea-
surement with a microelectrode (Animus Corp., Malvern,
PA, USA). The time of hypoxia was calculated from the
measurement indicating the desired O

2
concentration.
Neurosphere formation
Cells were seeded in four-well plates at 5 · 10
4
cells per well
(Costar, Cambridge, MA, USA; culture area per well
1.9 cm
2
). The total number of neurospheres (size>5 cells) in
each well was counted, after exposure to hypoxia for 3 days.
The observers were blinded to the experimental conditions.
Each experiment was repeated three times independently.
Cell counting
Cells infected with adenovirus were seeded at a density of
4 · 10
5
cellsÆmL
)1
in 35 mm plates (Costar) and then
placed in either the hypoxic or normoxic condition for
3 days; the neurospheres were trypsinized, and cells were
counted with a hemocytometer.
Cell cycle analysis
The neural spheres under hypoxic or normal conditions
were dissociated by using 0.25% trypsin ⁄ EDTA. Single cell
suspensions were obtained and washed with NaCl ⁄ P
i
three
times. After fixation with 75% ethanol, cells were digested

with DNase-free RNase in NaCl ⁄ P
i
containing 5 lgÆmL
)1
propidium iodide for DNA staining (45 min at 37 °C) [44].
The propidium iodide fluorescence and forward light scat-
tering were detected with a flow cytometer (FACS scan;
Beckton Dickinson) equipped with cellquest (Largo, FL,
USA) software.
BrdU administration and immunohistochemistry
Cells were plated on 35 mm dishes (Costar) precoated with
polylysine. BrdU (Sigma) (10 lm) was added to the
T. Zhao et al. HIF-1a in hypoxia-driven proliferation of NPCs
FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS 1831
medium, and cells were exposed to hypoxia for 3 days. The
cells were then fixed with 4% paraformaldehyde at 4 °C for
2 h. For BrdU immunohistochemistry, the cells were pre-
treated with 2 m HCl to denature the DNA and incubated
with a mouse mAb against BrdU (Molecular Probes, NY,
USA; diluted 1 : 1000) for 48 h at 4 °C. After being washed
in 0.1 m phosphate buffer, the cells were incubated with
biotinylated anti-(mouse IgG; Vector Laboratories, Burlin-
game, CA, USA; diluted 1 : 1000) at 4 °C overnight. BrdU-
positive cells were visualized as a black nuclear precipitate,
using a nickel-intensified 3,3V-diaminobenzidine procedure
[45].
RNA extraction and RT-PCR
Cultures were washed once with NaCl ⁄ P
i
before solubiliza-

tion in Trizol (Invitrogen) and then stored at )80 °C. Total
RNA extraction was performed according to the recom-
mendations of the manufacturer. The program for PCR
was as follows: primers for HIF-1a (5¢-TGCTTGGT
GCTGATTTGTGA-3¢ and 5¢-GGTCAGATGATCAGA
GTCCA-3¢) were used to yield a 209 bp product for
30 cycles at 58 °C; m18S rRNA primers (forward, 5¢-TT
ATGGTTCCTTTGGTCGCT-3¢; reverse, 5¢-ATGTGGTA
GCCGTTTCTCAG-3¢) were used to yield a 355 bp prod-
uct for 30 cycles at 56 °C. The level of HIF-1a mRNA
expression was semiquantified relative to the endogenous
expression level of 18S rRNA.
Protein extraction and western blot
Cells were harvested quickly after either hypoxic or norm-
oxic culture for the desired times, and the total protein was
extracted with lysis buffer, which contained 100 mm
Tris ⁄ HCl (pH 7.5), 300 mm NaCl, 2% (v ⁄ v) Tween-20,
0.4% NP-40, and 20% glycerol, supplemented with pro-
tease inhibitors (1 lgÆmL
)1
leupeptin and pepstatin,
2 lgÆmL
)1
aprotinin, and 1 mm phenylmethanesulfonyl
fluoride) and phosphatase inhibitors (10 mm NaF and
1mm Na
3
VO
4
). Then, western blot analyses were carried

out. Extracts were quantified with a protein assay kit
(Bio-Rad, Hercules, CA, USA), fractionated by 6%
SDS ⁄ PAGE, and transferred to a poly(vinylpyrrolidone
difluoride) membrane (Immobilon-P; Millipore, Bedford,
MA, USA). The membrane was blocked with NaCl ⁄ Tris
containing 5% dry milk at room temperature for 2 h.
Membranes were incubated with mouse mAb to HIF-1a
(Chemicon, Temecula, CA, USA; dilution 1 : 500) in
NaCl ⁄ Tris containing 5% nonfat dry milk. Membranes
were treated with secondary antibody, goat anti-(mouse
IgG), conjugated with horseradish peroxidase (Santa Cruz,
CA, USA; dilution 1 : 1000) in NaCl ⁄ Tris containing 5%
nonfat dry milk. Immune complexes on the membrane were
visualized by using an enhanced chemiluminescence detec-
tion system (Amersham Biosciences, Piscataway, USA).
Construction of the recombinant adenoviral
vector Ad–HIF-1a
The recombinant adenovirus overexpressing the human
HIF-1a gene was a kind gift from T. Hong (Institute of
Microbiology, Chinese Academy of Science). The AdEasy
system was used to generate recombinant adenoviruses.
The complete cDNA of human HIF-1a with a length
of 3720 bp contained an ORF of 2478 bp and a 1242 bp
5¢-UTR and 3 ¢-UTR. An ORF of 2478 bp, which encoded
a sequence of 826 amino acids, was constructed into the
recombinant adenoviral vector. The recombinant adenoviral
vector, digested with PacI to linearize the plasmid and etha-
nol-precipitated, was used for transfection into HEK293
cells. The recombinant virus produced in HEK293 cells
could then be further purified and then viral titers were

assayed.
Adenovirus infection assay
Neurospheres were dissociated into single cells before infec-
tion with adenovirus. After 2 h of incubation, the virus-
containing medium was replaced by fresh complete growth
medium. Then, the NPCs were cultured for 72 h, and the
expression of HIF-1a was measured. The modified con-
structs contained HIF-1a coupled to GFP in separate
expression cassettes. The rate of infection with the adeno-
virus was determined by the percentage of GFP-positive
cells detected by flow cytometry.
HIF-1a-targeted RNAi plasmid construction and
transfection in NPCs
The sequence of HIF-1a mRNA was found in GenBank
(GenBank accession no. for rat HIF-1a: NM_024359) and
segments of siRNA targeting HIF-1a mRNA were designed
by using siRNA-designing software. The sense strand con-
taining 19 nucleotides was followed by a short space
(TTCAAGAGA), and the reverse complement of the sense
strand was followed by six thymidines as an RNA polymer-
ase III transcriptional stop signal. The sequences were: for-
ward, 5¢-
GCCTTAACCTATCTGTCACTTCAAGAGAGT
GACAGATAGGTTAAGGC TTTTTT-3¢; and reverse,
5¢-AATTAAAAAA
GCCTTAACCTATCTGTCACTCTCT
TGAA
GTGACAGATAGGTTAAGGC GGCC-3 ¢ (reverse
complement sequences to form stem-loop structure in RNAi
are underlined). The oligonucleotides were annealed in

the buffer [100 mmolÆL
)1
potassium acetate, 30 mmolÆL
)1
Hepes ⁄ KOH (pH 7.4), magnesium acetate 2 mmolÆL
)1
],
and the mixture was incubated at 90 °C for 3 min, and
then at 37 °C for 1 h. The double-stranded oligonucleotides
were cloned into an ApaI–EcoRI site in the pSilenc-
er 1.0-U6 vector (Ambion, Austin, TX, USA), in which
shRNAs were expressed under the control of the U6
promoter. A negative control scrambled siRNA, which
HIF-1a in hypoxia-driven proliferation of NPCs T. Zhao et al.
1832 FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS
had no significant homology to rat gene sequences, was
designed to detect any nonspecific effects. The plasmids
were transfected into NPCs by using Lipofectamin 2000
(Invitrogen, CA, USA), and the transfection rate was
determined by the percentage of GFP-positive cells.
Statistical analysis
All the experimental data shown were from experiments
that were repeated at least three times, unless otherwise
indicated. Data are presented as mean ± SD. Statistical
analysis was performed by t-test. A statistical probability of
P < 0.05 was considered to be significant.
Acknowledgements
This work was supported by grants from the National
Basic Research Program of China (nos. 2006CB504100
and 2006CB943703), the Nature and Sciences Founda-

tion of China (no. 30393130), the Hi-tech Research
and Development Program of China (no.
2006AA02A101) and Grant of Beijing for Tibet (no.
Z0006342040191).
References
1 Reynolds BA, Tetzlaff W & Weiss S (1992) A multi-
potent EGF-responsive striatal embryonic progenitor
cell produces neurons and astrocytes. J Neurosci 12 ,
4565–4574.
2 McKay R (1997) Stem cells in the central nervous sys-
tem. Science 276, 66–71.
3 Gage FH (2000) Mammalian neural stem cells. Science
287, 1433–1438.
4 Svendsen CN, Clarke DJ, Rosser AE & Dunnett SB
(1996) Survival and differentiation of rat and human
epidermal growth factor-responsive precursor cells fol-
lowing grafting into the lesioned adult central nervous
system. Exp Neurol 137, 376–388.
5 Svendsen CN, Caldwell MA, Shen J, ter Borg MG,
Rosser AE, Tyers P, Karmiol S & Dunnett SB (1997)
Long-term survival of human central nervous system
progenitor cells transplanted into a rat model of
Parkinson’s disease. Exp Neurol 148 , 135–146.
6 Storch A & Schwarz J (2002) Neural stem cells and
neurodegeneration. Curr Opin Investig Drugs 3,
774–781.
7 Storch A, Sabolek M, Milosevic J, Schwarz SC &
Schwarz J (2004) Midbrain-derived neural stem cells:
from basic science to therapeutic approaches. Cell
Tissue Res 318, 15–22.

8 Ishibashi S, Sakaguchi M, Kuroiwa T, Yamasaki M,
Kanemura Y, Shizuko I, Shimazaki T, Onodera M,
Okano H & Mizusawa H (2004) Human neural
stem ⁄ progenitor cells, expanded in long-term neurosphere
culture, promote functional recovery after focal ischemia
in Mongolian gerbils. J Neurosci Res 78, 215–223.
9 Zhu J, Zhou L & XingWu F (2006) Tracking neural
stem cells in patients with brain trauma. N Engl J Med
355, 2376–2378.
10 Kuhn HG, Winkler J, Kempermann G, Thal LJ &
Gage FH (1997) Epidermal growth factor and fibroblast
growth factor-2 have different effects on neural
progenitors in the adult rat brain. J Neurosci 17,
5820–5829.
11 Storch A, Paul G, Csete M, Boehm BO, Carvey PM,
Kupsch A & Schwarz J (2001) Long-term proliferation
and dopaminergic differentiation of human mesence-
phalic neural precursor cells. Exp Neurol 170, 317–325.
12 Zhu LL, Wu LY, Yew DT & Fan M (2005) Effects of
hypoxia on the proliferation and differentiation of
NSCs. Mol Neurobiol 31, 231–242.
13 Studer L, Csete M, Lee SH, Kabbani N, Walikonis J,
Wold B & McKay R (2000) Enhanced proliferation,
survival, and dopaminergic differentiation of CNS pre-
cursors in lowered oxygen. J Neurosci 20, 7377–7383.
14 Morrison SJ, Csete M, Groves AK, Melega W, Wold B
& Anderson DJ (2000) Culture in reduced levels of
oxygen promotes clonogenic sympathoadrenal differen-
tiation by isolated neural crest stem cells. J Neurosci 20,
7370–7376.

15 Genbacev O, Zhou Y, Ludlow JW & Fisher SJ (1997)
Regulation of human placental development by oxygen
tension. Science 277, 1669–1672.
16 Caniggia I, Mostachfi H, Winter J, Gassmann M, Lye
SJ, Kuliszewski M & Post M (2000) Hypoxia-inducible
factor-1 mediates the biological effects of oxygen on
human trophoblast differentiation through TGFbeta(3).
J Clin Invest 105, 577–587.
17 Lennon DP, Edmison JM & Caplan AI (2001) Cultiva-
tion of rat marrow-derived mesenchymal stem cells in
reduced oxygen tension:effects on in vitro and in vivo
osteochondrogenesis. J Cell Physiol 187, 345–355.
18 Semenza G (1999) Regulation of mammalian O
2
homeostasis by hypoxia-inducible factor1. Annu Rev
Cell Dev Biol 15, 551–578.
19 Wang GL & Semenza GL (1993) General involvement
of hypoxia-inducible factor1 in transcriptional response
to hypoxia. Proc Natl Acad Sci USA 90, 4304–4308.
20 Wang GL, Jiang BH, Rue EA & Semenza GL (1995)
Hypoxia-inducible factor 1 is a basic-helix-loop-helix-
PAS heterodimer regulated by cellular O
2
tension. Proc
Natl Acad Sci USA 92, 5510–5514.
21 Wang GL & Semenza GL (1995) Purification and
characterization of hypoxia-inducible factor1. J Biol
Chem 270, 1230–1237.
22 Milosevic J, Maisel M, Wegner F, Leuchtenberger J,
Wenger RH, Gerlach M, Storch A & Schwarz J (2007)

T. Zhao et al. HIF-1a in hypoxia-driven proliferation of NPCs
FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS 1833
Lack of hypoxia-inducible factor-1 alpha impairs mid-
brain neural precursor cells involving vascular endothe-
lial growth factor signaling. J Neurosci 27, 412–421.
23 Wu EH, Li HS, Zhao T, Fan JD, Ma X, Xiong L, Li
WJ, Zhu LL & Fan M (2007) Effect of hypoxia on the
gene profile of human bone marrow-derived mesenchy-
mal stem cells. Acta Physiol Sin 59, 227–232.
24 Marx J (2004) How cells endure low oxygen. Science
303, 1454–1456.
25 Goda N, Dozier SJ & Johnson RS (2003) HIF-1 in cell
cycle regulation, apoptosis, and tumor progression.
Antioxid Redox Signal 5, 467–473.
26 Rose F, Grimminger F, Appel J, Heller M, Pies V,
Weissmann N, Fink L, Schmidt S, Krick S, Camenisch
G, et al. (2002) Hypoxic pulmonary artery fibroblasts
trigger proliferation of vascular smooth muscle cells:
role of hypoxia-inducible transcription factors. FASEB
J 16, 1660–1661.
27 Cogo A, Napolitano G, Michoud MC, Barbon DR,
Ward M & Martin JG (2003) Effects of hypoxia on rat
airway smooth muscle cell proliferation. J Appl Physiol
94, 1403–1409.
28 Galvin DJ, Watson RW, O’Neill A, Coffey RN, Taylor
C, Gillespie JI & Fitzpatrick JM (2004) Hypoxia inhi-
bits human bladder smooth muscle cell proliferation: a
potential mechanism of bladder dysfunction. Neurourol
Urodyn 23, 342–348.
29 Kung AL, Wang S, Klco JM, Kaelin WG & Livingston

DM (2000) Suppression of tumor growth through dis-
ruption of hypoxia-inducible transcription. Nat Med 6,
1335–1340.
30 Milosevic J, Schwarz SC, Krohn K, Poppe M, Storch A
& Schwarz J (2005) Low atmospheric oxygen avoids
maturation, senescence and cell death of murine mesen-
cephalic neural precursors. J Neurochem 92, 718–729.
31 Semenza GL (2000) HIF-1: mediator of physiological
and pathophysiological responses to hypoxia. J Appl
Physiol 88, 1474–1480.
32 Swinson DE & O’Byrne KJ (2006) Interactions between
hypoxia and epidermal growth factor receptor in non-
small-cell lung cancer. Clin Lung Cancer 7, 250–256.
33 Krieg M, Haas R, Brauch H, Acker T, Flamme I &
Plate KH (2000) Up-regulation of hypoxia-inducible
factors HIF-1alpha and HIF-2alpha under normoxic
conditions in renal carcinoma cells by von Hippel-
Lindau tumor suppressor gene loss of function.
Oncogene 19, 5435–5443.
34 Chen J, Zhao S, Nakada K, Kuge Y, Tamaki N, Okada
F, Wang J, Shindo M, Higashino F, Takeda K, et al.
(2003) Dominant-negative hypoxia-inducible factor-1
alpha reduces tumorigenicity of pancreatic cancer cells
through the suppression of glucose metabolism. Am J
Pathol 162, 1283–1291.
35 Stoeltzing O, McCarty MF, Wey JS, Fan F, Liu W,
Belcheva A, Bucana CD, Semenza GL & Ellis LM
(2004) Role of hypoxia-inducible factor 1alpha in gas-
tric cancer cell growth, angiogenesis, and vessel matura-
tion. J Natl Cancer Inst 96, 946–956.

36 Greijer AE, van der Groep P, Kemming D, Shvarts A,
Semenza GL, Meijer GA, van de Wiel MA, Belien JA,
van Diest PJ & van der Wall E (2005) Up-regulation of
gene expression by hypoxia is mediated predominantly
by hypoxia-inducible factor 1 (HIF-1). J Pathol 206,
291–304.
37 Wenger RH (2002) Cellular adaptation to hypoxia:
O
2
-sensing protein hydroxylases, hypoxia-inducible
O
2
-regulated gene expression, Transcription factors,
and O
2
. FASEB J 16, 1151–1162.
38 Ratcliffe PJ, O’Rourke JF, Maxwell PH & Pugh CW
(1998) Oxygen sensing, hypoxia-inducible factor-1 and
the regulation of mammalian gene expression. J Exp
Biol 201, 1153–1162.
39 Krick S, Ha
¨
nze J, Eul B, Savai R, Seay U, Grimminger
F, Lohmeyer J, Klepetko W, Seeger W & Rose F
(2005) Hypoxia-driven proliferation of human pulmon-
ary artery fibroblasts: cross-talk between HIF-1alpha
and an autocrine angiotensin system. FASEB J 19, 857–
859.
40 Salceda S & Caro J (1997) Hypoxia-inducible factor1a
(HIF-1a) protein is rapidly degraded by the ubiquitin–

proteasome system under normoxic conditions. Its
stabilization by hypoxia depends on redox-induced
changes. J Biol Chem 272, 22642–22647.
41 Huang LE, Gu J, Schau M & Bunn HF (1998) Regula-
tion of hypoxia-inducible factor 1alpha is mediated by
an O
2
-dependent degradation domain via the ubiquitin-
proteasome pathway. Proc Natl Acad Sci USA 95,
7987–7992.
42 Schultz K, Fanburg BL & Beasley D (2006) Hypoxia
and hypoxia-inducible factor-1alpha promote growth
factor-induced proliferation of human vascular smooth
muscle cells. Am J Physiol Heart Circ Physiol 290,
H2528–2534.
43 Jiang M, Wang B, Wang C, He B, Fan H, Guo TB,
Shao Q, Gao L & Liu Y (2006) Inhibition of hypoxia-
inducible factor-1alpha and endothelial progenitor cell
differentiation by adenoviral transfer of small interfer-
ing RNA in vitro. J Vasc Res 43, 511–521.
44 Krishan A (1975) Rapid flow cytofluorometric analysis
of mammalian cell cycle by propidium iodide staining.
J Cell Biol 66, 188–193.
45 Zhu LL & Onaka T (2002) Involvement of medullary
A2 noradrenergic neurons in the activation of oxytocin
neurons after conditioned fear stimuli. Eur J Neurosci
16, 2186–2198.
HIF-1a in hypoxia-driven proliferation of NPCs T. Zhao et al.
1834 FEBS Journal 275 (2008) 1824–1834 ª 2008 The Authors Journal compilation ª 2008 FEBS