Báo cáo khoa học: Cloning and functional analysis of 5¢-upstream region of the Pokemon gene pptx

Cloning and functional analysis of 5¢-upstream region
of the Pokemon gene
Yutao Yang, Xiaowei Zhou, Xudong Zhu, Chuanfu Zhang, Zhixin Yang, Long Xu and
Peitang Huang
Laboratory of Protein Engineering, Beijing Institute of Biotechnology, China
The poxvirus and zinc finger (POZ) domain, formerly
termed the broad complex, tramtrack and bric-a-brac
(BTB) domain, was initially characterized in the
Drosophila proteins broad complex, tramtrack and
bric-a-brac [1]. It is  120 amino acids long and usu-
ally exists in a few transcriptional repression complexes
[2]. The POZ domain is highly conserved from yeast to
humans, and is involved in many critical cellular pro-
cesses such as development [3,4], oncogenesis [5,6],
apoptosis [7] and ion channel activity [8].
More than 200 proteins have been found in associa-
tion with the POZ domain [9], and they are usually
grouped according to their distinct C-terminal struc-
tures, such as the zinc finger motif, basic zipper motif,
actin-binding repeats, kech domains and ion channel
motifs [10]. Proteins containing the POZ domain and
zinc finger motif are termed POZ-ZF or POK proteins.
Via the POZ domain, many POK proteins can recruit
transcriptional co-repressors such as nuclear co-repres-
sor (N-CoR), silencing mediator of retinoic acid,
thyroid hormone receptor (also known as N-CoR2),
mSin3A and histone deacetylases to the target gene
promoter regions, thereby decreasing these gene tran-
scriptional activities [11–14].
Currently,  60 POK genes have been identified in
the human genome [15]. Many of them, such as PLZF,

BCL-6, Zbtb7 and HIC1, are involved in development,
differentiation and oncogenesis [2]. Pokemon, the POK
erythroid myeloid ontogenic factor, was previously
known by several names (LRF, OCZF and FBI-1) and
was originally identified as a protein that binds specifi-
cally to the inducer of short transcripts (IST) element
Keywords
DNA decoy; element; mutation; Pokemon;
promoter
Correspondence
P. Huang, Laboratory of Protein Engineering,
Beijing Institute of Biotechnology,
Beijing 100071, China
Fax ⁄ Tel: +86 10 6381 0272
E-mail:
(Received 15 October 2007, revised 12
February 2008, accepted 18 February 2008)
doi:10.1111/j.1742-4658.2008.06344.x
Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates
the expression of many genes, but also plays an important role in cell
tumorigenesis. To investigate the molecular mechanism regulating expres-
sion of the Pokemon gene in humans, its 5¢-upstream region was cloned
and analyzed. Transient analysis revealed that the Pokemon promoter is
constitutive. Deletion analysis and a DNA decoy assay indicated that the
NEG-U and NEG-D elements were involved in negative regulation of the
Pokemon promoter, whereas the POS-D element was mainly responsible
for its strong activity. Electrophoretic mobility shift assays suggested that
the NEG-U, NEG-D and POS-D elements were specifically bound by the
nuclear extract from A549 cells in vitro. Mutation analysis demonstrated
that cooperation of the NEG-U and NEG-D elements led to negative regu-

lation of the Pokemon promoter. Moreover, the NEG-U and NEG-D ele-
ments needed to be an appropriate distance apart in the Pokemon
promoter in order to cooperate. Taken together, our results elucidate the
mechanism underlying the regulation of Pokemon gene transcription, and
also define a novel regulatory sequence that may be used to decrease
expression of the Pokemon gene in cancer gene therapy.
Abbreviations
BTB, broad complex, tramtrack and bric-a-brac domain; EMSA, electrophoretic mobility shift assay; Pokemon, POK erythroid myeloid
ontogenic factor; POZ, poxvirus and zinc finger domain; SRE, sterol regulatory element; SREBP, SRE-binding protein.
1860 FEBS Journal 275 (2008) 1860–1873 ª 2008 The Authors Journal compilation ª 2008 FEBS
on the HIV-1 genome [16]. It was first termed the fac-
tor binding to IST-1 (FBI-1) and is encoded by the
Zbtb7 gene. Pokemon not only regulates the HIV-1
Tat transactivation process [17,18], but is also involved
in human and murine adipogenesis [19]. It acts as a
transcription factor and regulates the expression of
many gene-encoding proteins such as extracellular
matrix collagen types I, II, IX, X and XI, fibronectin,
elastin, human cartilage oligomeric matrix protein
[20,21], ARF tumor suppressor [22], and the c-fos and
c-myc oncoproteins [23]. This activity is due to its
capacity to bind to the consensus sequence within the
promoters of these target genes. Furthermore, Pokemon
can regulate the expression of other genes via an inter-
action between its POZ domain and other important
transcription factors such as Sp-1 and the p65 subunit
of NF-jBorIjB [24,25].
Pokemon is also a repressor of the ARF tumor sup-
pressor gene and is a central regulator in oncogenesis.
Overexpression of the Pokemon gene can decrease

expression of the ARF gene, which in turn results in
p53 degradation and oncogenic transformation. Con-
versely, depletion of the Pokemon gene both inhibited
oncogene-mediated cellular transformation and
induced cell senescence and apoptosis [22,26]. There-
fore, Pokemon plays a crucial role in cell tumorigenesis
and may be a potential therapeutic target for human
cancer therapy.
Although considerable work has been done to eluci-
date the biological functions of the Pokemon, its regu-
lation mechanism has not been reported. In order to
identify the elements that regulate Pokemon gene
expression, we cloned and characterized the Pokemon
promoter. Our results suggest a role for two strongly
negative elements and one positive element in regula-
tion of the Pokemon gene. However, the two negative
elements could not individually exhibit the negative
regulatory activity; they required mutual cooperation
with each other in order to negatively regulate the
Pokemon promoter. In conclusion, our studies are the
first to elucidate transcriptional regulation mechanism
of the Pokemon gene, and this will be beneficial for
gene therapy in cancer.
Results
Cloning of the 5¢-upstream region of the
Pokemon gene
To identify the regulatory sequences that control
expression of the Pokemon gene, a 2204-bp section of
the 5¢-upstream region of the Pokemon gene was
cloned by PCR using human genomic DNA as the

template. Figure 1 shows the nucleotide sequence of
the 2204-bp promoter region and a short stretch of the
transcription region. The translation start site was des-
ignated as +1, and the transcribed region was shaded.
Some reports showed that the Pokemon gene can be
expressed in different cell lines and different human tis-
sues [25,27]; later reports also confirmed these results
[22,26]. To examine whether the Pokemon promoter
can drive reporter gene expression in a similar manner,
the 2204-bp promoter linked to the luciferase reporter
gene was used in transient transfection studies with dif-
ferent cell lines. Luciferase assays showed that the
Pokemon promoter could direct luciferase expression
in HeLa, A549, DU145, Jurkat and HepG2 cells,
whereas the pGL3-basic construct could not (Fig. 2);
this suggests that the Pokemon promoter can drive
reporter gene expression in different cell lines, which
was in agreement with the expression patterns of the
Pokemon gene [22,25–27]. Because Pokemon is also
highly expressed in lung and prostate carcinomas,
A549 and DU145 cells were used to study the regula-
tion mechanisms of the Pokemon gene.
Computer analysis of putative transcription
factor-binding sites
For a rough understanding of the regulation of the
Pokemon gene, the 2204-bp section of its 5¢-upstream
region was analyzed for putative cis-elements in the
TRANSFAC 7.0 database (eregulation.
com/pub/databases.html) [28]. After scanning the
TRANSFAC 7.0 database, we found that the putative

TATA and CCAAT sequences are absent in the
upstream region of the Pokemon gene; however, some
transcription factor-binding sequences, including Sp1,
AP-1, AP-2, PU.1, Hb, CBF-1, GATA-1 elements and
p53-binding sites are present in the promoter (Fig. 1),
implying their potential roles in the regulation of the
Pokemon gene.
Deletion analysis of the Pokemon promoter
To broadly determine the main regulatory regions in
the Pokemon promoter, we created five 5¢-deletion con-
structs; the activities of these deletion constructs were
measured in A549 and DU145 cells. As shown in
Fig. 3A, luciferase activity was markedly reduced when
the region from )837 to )560 was deleted, but was
dramatically increased when the region from )560 to
)233 was deleted. These results demonstrated the pos-
sible presence of some potential positive elements in
the region from )837 to )560 and negative elements in
the region from )560 to )233.
Y. Yang et al. Analysis of upstream region of the Pokemon gene
FEBS Journal 275 (2008) 1860–1873 ª 2008 The Authors Journal compilation ª 2008 FEBS 1861
To determine the regulatory region in the Pokemon
promoter more accurately, we performed further
5¢-deletion analysis with the regions from )837 to
)560 and )560 to )233. Five 5¢-deletion constructs
were constructed for the region from )837 to )560
and used in transient transfection studies. As shown in
Fig. 3B, only the deletion from )580 to )560 resulted
in a moderate reduction in luciferase activity; it
reduced the luciferase activity of A549 cells by 4.6-fold

and that of DU145 cells by 4.2-fold compared with
Fig. 1. Nucleotide sequence of the 5¢-upstream region of the Pokemon gene. The upstream region of the Pokemon gene containing the pro-
moter and a short stretch of the transcribed region is shown. The nucleotides are numbered on the left, with the translation start site desig-
nated as +1. The translation start site is indicated by an arrowhead. The transcribed region is shaded. The POS-D, NEG-U and NEG-D
elements are boxed. The putative cis-elements are underlined. The TRANSFAC database was used to identify putative cis-elements in the
5¢-upstream region of the Pokemon gene.
Analysis of upstream region of the Pokemon gene Y. Yang et al.
1862 FEBS Journal 275 (2008) 1860–1873 ª 2008 The Authors Journal compilation ª 2008 FEBS
F-580, suggesting the presence of potential positive
element(s) in this region. Six 5¢-deletion constructs
were constructed for the region from )560 to )233,
and their activities were measured in A549 and DU145
cells. Figure 3C shows that deletion of the region from
)560 to )542 resulted in a remarkable increase in
luciferase activity, by 25-fold in A549 cells and
24.6-fold in DU145 cells compared with F-560, sug-
gesting the presence of a strong negative element in
this region. This negative element was termed NEG-U.
The F-233 construct still directed reporter gene
expression to a great degree, and some essential ele-
ments might be responsible for this property. Further
deletion analysis showed that the region from )83 to
)71 was responsible for the strong activity of the
0
1
2
3
4
5
6

7
8
9
HeLa A549 DU145 Jurkat HepG2
LUC activity
Fig. 2. The 2204-bp section of the Pokemon promoter can drive
luciferase gene expression in different cell lines. Different cell lines
were transfected with the 2204-bp section of the Pokemon promoter
construct or the pGL3-basic construct. Solid bars represent the
2204-bp stretch showing Pokemon promoter construct activity,
and open bars represent pGL3-basic construct activity. The values
are the mean ± SE for three independent experiments performed in
triplicate and are normalized to Renilla luciferase activity.
A
B
C
D
LUC activity
LUC activity
LUC activity
LUC activit
y
Fig. 3. 5¢-Deletion analysis of the Pokemon promoter. Progres-
sively truncated fragments of the upstream region of the Pokemon
gene were inserted into the pGL3-basic vector and their ability to
activate transcription of the luciferase gene was assessed in A549
and DU145 cells. The values are the mean ± SE for three indepen-
dent experiments performed in triplicate and are normalized to
Renilla luciferase activity. (A) Rough characterization of the Poke-
mon promoter using the larger, gradually truncated fragment from

)2220 to )233. (B) Refined analysis of the Pokemon promoter
using the smaller, progressively truncated fragment from )837 to
)560. (C) Refined analysis of the Pokemon promoter using the
smaller, progressively truncated fragment from )560 to )233.
(D) Refined analysis of the Pokemon promoter using the smaller,
progressively truncated fragment from )233 to )71.
Y. Yang et al. Analysis of upstream region of the Pokemon gene
FEBS Journal 275 (2008) 1860–1873 ª 2008 The Authors Journal compilation ª 2008 FEBS 1863
Pokemon promoter. When this region was removed,
luciferase activity was decreased by 25.6-fold in the
A549 cells and 23.4-fold in the DU145 cells compared
with F-83, indicating that the region from )83 to )71
is necessary for strong expression of the Pokemon pro-
moter in both A549 and DU145 cells (Fig. 3D); we
termed this positive element as POS-D.
Importance of the POS-D element for the strong
activity of the Pokemon promoter
Because the POS-D element plays an important role in
the strong activity of the Pokemon promoter, it may
be the target of some transcriptional factors. To deter-
mine the presence of binding sites for transcriptional
factors in this element, we performed electrophoretic
mobility shift assays (EMSAs) with A549 cell nuclear
extract. Figure 4A shows the formation of complexes
when wild-type double POS-D was used as a probe
and incubated with the nuclear extracts. The specificity
of the complexes was confirmed by incubation with a
50-fold excess of unlabeled wild-type double POS-D.
However, mutant POS-D did not compete with the
labeled wild-type probe, suggesting that the POS-D

element is specifically recognized by nuclear proteins
from A549 cells.
Because the POS-D element is responsible for the
strong activity of the Pokemon promoter, we specu-
lated whether mutation of the POS-D element would
result in a decrease in the activity of the promoter. We
mutated a 9-bp section of the POS-D element in the
F-233 construct (MF-233) and transfected MF-233
and F-233 into A549 and DU145 cells, respectively.
Luciferase assays showed that MF-233 displayed lower
luciferase activity than F-233 (Fig. 4B). In addition,
we also examined the function of the POS-D element
by using the DNA decoy technique. Our results
showed that introduction of the POS-D decoy could
efficiently suppress the F-233 activity, whereas the
mutant POS-D decoy could not (Fig. 4C). All these
results suggest that POS-D is an essential regulatory
element that is responsible for the strong activity of
the Pokemon promoter.
Role of the NEG-U element in the negative
regulation of the Pokemon promoter
5¢-Deletion analysis showed that the NEG-U element
was involved in the negative regulation of the Pokemon
A
B
C
Fig. 4. The POS-D element is necessary for strong activity of the
Pokemon promoter. (A) EMSA was performed with
32
P-labeled

POS-D element in the absence or presence of the wild-type POS-D
element or mutant POS-D element at the molar excess indicated
above each lane. (B) Activities of F-233 and MF-233 in A549 and
DU145 cells. (C) Activities of F-233 and varying amounts of the
decoy oligonucleotides in A549 and DU145 cells. WP-decoy indi-
cates the wild-type POS-D oligonucleotide, while MP-decoy indi-
cates the mutant POS-D oligonucleotide. The values are the
mean ± SE for three independent experiments performed in tripli-
cate and are normalized to Renilla luciferase activity.
Analysis of upstream region of the Pokemon gene Y. Yang et al.
1864 FEBS Journal 275 (2008) 1860–1873 ª 2008 The Authors Journal compilation ª 2008 FEBS
promoter. To examine whether the NEG-U element
shows nuclear protein-binding activity, we synthesized
double NEG-U and mutant double NEG-U elements,
and then performed EMSAs with A549 cell nuclear
extracts. As shown in Fig. 5A, specific complexes were
observed with the labeled wild-type probe; moreover,
250-fold excess of the unlabeled wild-type probe
almost entirely eliminated complex formation, whereas
250-fold excess of the unlabeled mutant probe did not.
Interestingly, we found that the mutated element can
compete with the wild-type NEG-U element to some
extent; this suggests that the corresponding nuclear
factor may bind to the region between the mutation
site and the marginal sequence in the mutant probe.
However, our decoy analysis showed that the MNEG-U
decoy had almost no effect on the activity of F-560,
indicating that the mutated competitor had only weak
nonspecific binding capacity for proteins in the A549
nuclear extract (Fig. 5B).

Because the NEG-U element lent a strong negative
character to the Pokemon promoter, we speculated
whether it could also decrease the activity of the SV40
promoter. NEG-U and mutant NEG-U elements were
cloned into the KpnI ⁄ XhoI sites of the pGL3-control
plasmid in both the normal and reverse orientations,
and the resultant constructs were used in transient
transfection studies. Interestingly, as shown in Fig. 5C,
both normally and reversely oriented NEG-U elements
increased the activity of the SV40 promoter, whereas
the mutant element did not. Therefore, the NEG-U
element could exhibit the negative regulatory function
only in a special DNA context.
Role of the NEG-D element in the negative
regulation of the Pokemon promoter
The NEG-U element alone cannot negatively regulate
the function of the Pokemon promoter, therefore, we
proposed that it might interact with other downstream
regulatory elements to exhibit negative activity. To
accurately locate the region that can cooperate with
the NEG-U element, we performed 3¢-deletion analysis
in the region from )560 to )88. All the deletion con-
structs of this region contained the region between )88
and )17 but different internal deletion fragments. As
B
A
WM
Competitor
Nuclear protein
Free probe

Complex
0 0 50× 250× 50× 250×
-+++ ++
C
SV40-Promoter
LUC
SV40-Promoter
LUC
LUC
LUC
LUC
NEG-U
SV40-Promoter
MNEG-U
SV40-Promoter
MNEG-U
SV40-PromoterNEG-U
0 50 100 150
MU- I
MU- F
WU-I
WU-F
W
LUC activit
y
A549
DU145
F-560 (ng) 300 300 300 300 300
WU-decoy (µg) 0 1 2 0 0
MU-decoy (µg) 0 0 0 1 2

0
1
2
3
4
5
6
LUC acitivity
A549
DU145
Fig. 5. The NEG-U element is involved in the negative regulation of
the Pokemon promoter. (A) EMSA was performed with
32
P-labeled
NEG-U element in the absence or presence of the wild-type NEG-U
element or mutant NEG-U element at the molar excess indicated
above each lane. (B) Activities of F-560 and varying amounts of the
decoy oligonucleotide in A549 and DU145 cells. WU-decoy indi-
cates the wild-type NEG-U oligonucleotide, wherreas MU-decoy
indicates the mutant NEG-U oligonucleotide. (C) The left-hand panel
shows the different chimeric constructs used to test the effect of
the NEG-U element on the SV40 promoter. The right-hand panel
shows the results of luciferase activity assays for different chimeric
constructs in A549 cells and DU145 cells. The values are the
mean ± SE for three independent experiments performed in tripli-
cate and are normalized to Renilla luciferase activity.
Y. Yang et al. Analysis of upstream region of the Pokemon gene
FEBS Journal 275 (2008) 1860–1873 ª 2008 The Authors Journal compilation ª 2008 FEBS 1865
shown in Fig. 6A, deleting the region from )127
to )88 resulted in a significant increase in luciferase

activity compared with F-560, whereas deleting the
region from )107 to )88 resulted in a slight increase
in luciferase activity, indicating that the region from
)127 to )107 is also involved in the negative regula-
tion of the Pokemon promoter; we termed this region
NEG-D. In addition, progressive deletion of the region
from )156 to )473 resulted in only slight changes in
luciferase activity compared with T-127, further con-
firming the importance of the NEG-D element. In
order to fully examine the function of the NEG-D ele-
ment, we performed EMSA and NEG-D decoy analy-
sis. EMSA showed that the NEG-D element could be
bound specifically by the nuclear extract from A549
cells (Fig. 6B). Decoy analysis demonstrated that the
NEG-D decoy could increase the activity of F-560; a
similar observation was made with regard to the
NEG-U decoy-treated cells (Fig. 6C). These results
indicate that the NEG-D element is also necessary for
negative regulation of the Pokemon promoter.
Because the NEG-D element also lent a strong nega-
tive character to the Pokemon promoter, we speculated
whether it might decrease the activity of the SV40
Fig. 6. The NEG-D element is involved in the negative regulation of the Pokemon promoter. (A) The left-hand panel shows 3¢-deletion con-
structs in the region between )560 and )88 of the Pokemon promoter. All these constructs contained the region between )88 and )17 of
the Pokemon promoter but had different internal deletion fragments. The right-hand panel shows the results of the luciferase activity assays
of the 3¢-deletion constructs in A549 and DU145 cells. (B) EMSA was performed with
32
P-labeled NEG-D element in the absence or pres-
ence of the wild-type NEG-D element or mutant NEG-D element at the molar excess indicated above each lane. (C) Activities of F-560 and
varying amounts of the decoy oligonucleotide in A549 and DU145 cells. WD-decoy indicates the wild-type NEG-D oligonucleotide, whereas

MD-decoy indicates the mutant NEG-D oligonucleotide. (D) The left-hand panel shows the different chimeric constructs used to test the
effect of the NEG-D element on the SV40 promoter. The right-hand panel shows the results of the luciferase activity assays for different chi-
meric constructs in A549 and DU145 cells. The values are the mean ± SE for three independent experiments performed in triplicate and are
normalized to Renilla luciferase activity.
Analysis of upstream region of the Pokemon gene Y. Yang et al.
1866 FEBS Journal 275 (2008) 1860–1873 ª 2008 The Authors Journal compilation ª 2008 FEBS
promoter. NEG-D and mutant NEG-D elements were
also cloned into the Kpn I ⁄ XhoI sites of the pGL3-con-
trol plasmid in both the normal and reverse orienta-
tions, and the activities of the resultant construct were
assayed. As shown in Fig. 6D, both normal- and
reverse-oriented NEG-D elements increased the activ-
ity of the SV40 promoter, whereas the mutant element
did not; this is similar to the function of the NEG-U
element, suggesting that a single NEG-D element alone
cannot exhibit negative activity.
The NEG-U element cooperates with the NEG-D
element to promote negative regulation of the
Pokemon promoter
To further characterize the effects of the NEG-U and
NEG-D elements on the negative regulation of the
Pokemon promoter, mutations of the NEG-U and
NEG-D elements, alone or in combination, were cre-
ated in F-560 and transiently transfected into A549
and DU145 cells. As shown in Fig. 7A, mutation of
the NEG-U element alone resulted in a significant
increase in luciferase activity; a similar result was also
observed in the construct that only harbored the
mutated NEG-D element. Interestingly, mutations in
both sites also led to a remarkable increase in lucifer-

ase activity. These results indicate that both the
NEG-U and NEG-D elements are essential for
negative regulation of the Pokemon promoter.
To examine the impact of the length between the
two elements on inter-region synergism, the effect of
deletions in the intervening sequence was evaluated.
Our results showed that the inhibition of the synergis-
tic activity of the NEG-U and NEG-D elements was
almost abolished in D-254 and D-106 (Fig. 7B), thus
suggesting that the inhibition of synergism may require
the NEG-U and NEG-D elements to be located at a
certain appropriate distance from each other.
To further determine the cooperation between the
NEG-U and NEG-D elements, we performed DNA
A
B
C
Fig. 7. The NEG-U and NEG-D elements are necessary for the neg-
ative regulation of the Pokemon promoter. (A) The left-hand panel
shows the F-560 and mutant constructs. The right-hand panel
shows the results of the luciferase activity assays for all the con-
structs in A549 and DU145 cells. M-U indicates that the NEG-U ele-
ment was mutated in F-560, M-D indicates that the NEG-D
element was mutated in F-560 and M-B indicates that both the
NEG-U and NEG-D elements were mutated in F-560. (B) The left-
hand panel shows F-560 and different mutant constructs harboring
shorter intervening sequences (254 and 106 bp) between the NEG-
U and NEG-D elements. The distance between the NEG-U and
NEG-D elements was 253 and 106 bp in D-254 and D-106, respec-
tively. The right-hand panel shows the results of the luciferase

activity assays for different constructs in A549 and DU145 cells.
(C) The effects of 2 lg of the NEG-U decoy, 2 lg of the NEG-D
decoy and a combination of 1 lg of each decoy on the activity of
F-560. The open ellipse indicates the wild-type NEG-U element,
whereas the solid ellipse indicates the mutant NEG-U element; the
open triangle indicates the wild-type NEG-D element, whereas the
solid triangle indicates the mutant NEG-D element. ‘U’ indicates
the NEG-U decoy, ‘D’ indicates the NEG-D decoy and ‘U+D’ indi-
cates the combination of the decoys. The values are the
mean ± SE for three independent experiments performed in tripli-
cate and are normalized to Renilla luciferase activity.
Y. Yang et al. Analysis of upstream region of the Pokemon gene
FEBS Journal 275 (2008) 1860–1873 ª 2008 The Authors Journal compilation ª 2008 FEBS 1867
decoy experiments using 2 lg of the NEG-U decoy,
2 lg of the NEG-D decoy, and a combination of 1 lg
each of the NEG-U and NEG-D decoys. Our results
demonstrated that the F-560 activity is increased more
by the combination of the NEG-U and NEG-D decoys
than by the individual NEG-U and NEG-D decoys
(Fig. 7C). These data demonstrate that the Pokemon
promoter can only be negatively regulated when the
NEG-U element cooperates with the NEG-D element.
Discussion
Pokemon, a member of the POK protein family, plays
an important role in cell development, differentiation
and oncogenesis. Abrogation of Pokemon often leads
to cell-cycle arrest and cellular senescence and apopto-
sis. However, overexpression of Pokemon will lead to
reduced levels of the tumor suppressor gene ARF,
resulting in degradation of the wild-type nuclear p53

and oncogenic transformation [22,26]. Although a con-
siderable amount of work has been done characterizing
the function of Pokemon, very little is known about
the mechanism that governs its expression. In this
study, we performed deletion analysis, mutation analy-
sis, as well as decoy assays, and found that the NEG-U,
NEG-D and POS-D elements play important roles in
regulation of the Pokemon promoter; this helps us
understand the transcriptional mechanism of the
Pokemon gene.
In humans, the Pokemon gene localizes in syntenic
chromosomal regions (19p13.3), and is widely
expressed in adult tissues and cell lines [27]. Reports
have shown that alternative splicing and alternative
promoters play important roles in the regulation of
some genes [29–31]. Interestingly, our previous studies
also showed that the Pokemon transcripts could be
alternatively spliced, resulting in the formation of
mRNAs with four different 5¢-untranslated regions.
Matching the nucleotide sequences of four first exons
to human genomic DNA showed that four alternative
first exons were located at )11 596, )10 224, )9109
and )17 bp upstream of the translation start site of
the Pokemon gene, suggesting that the Pokemon gene
could be regulated by four alternative promoters. We
are currently performing deletion analysis and a DNA
decoy assay to study three other alternative promoters,
which will further provide better understanding of the
Pokemon gene transcriptional mechanisms.
From the TRANSFAC 7.0 database, we found some

putative regulatory elements in the Pokemon promoter,
including binding sites for Sp1, AP-1, AP-2 and
GATA-1 elements (Fig. 1); however, deletion analysis
showed that the above-mentioned regulatory elements
cannot play decisive roles in the regulation of the
Pokemon gene, suggesting the complexity of gene regu-
lation. Fortunately, we found that three regulatory ele-
ments, namely, POS-D, NEG-U and NEG-D, play
important roles in the regulation of the Pokemon gene.
To determine whether these three elements are homo-
logous with the regulatory sequences deposited in the
database, we performed a BLAST search by using
their sequences as queries in the TRANSFAC 7.0
database. The results showed that none of them shared
a higher degree of homology with the reported regula-
tory elements, thus indicating their novel roles. Cur-
rently, we are conducting yeast one-hybridization in
order to isolate transcription factors that can interact
with these novel regulatory elements; this will help
further understand the regulatory mechanism of the
Pokemon promoter.
The DNA decoy technique, also referred to as the
transcription factor decoy technique, involves the
transfection of double-stranded oligodeoxynucleotides
corresponding to the regulatory sequence into target
cells; this results in the attenuation of authentic cis–
trans interactions, leading to the removal of transcrip-
tion factors from the endogenous regulatory element
and suppression of the expression of the regulated
genes. Recently, some reports showed that the DNA

decoy technique is a powerful tool for therapy related
to various diseases [32–34]. In this experiment, we used
the DNA decoy technique to successfully confirm the
function of the POS-D, NEG-U and NEG-D elements,
proving that the transcription factor decoy technique
can be a powerful tool for the study of transcriptional
regulation mechanisms. However, we also found that
the wild-type POS-D decoy cannot completely abolish
reporter gene expression; this may occur for two rea-
sons. First, some DNA decoys may be degraded by
endogenous nuclease. Second, in the amounts used, the
POS-D decoy cannot completely abolish the inter-
action between the wild-type POS-D element and its
corresponding transcription factor. Although POS-D
decoys cannot completely abolish the activity of the
Pokemon promoter, they are still potential oligodeoxy-
nucleotides that can be used to decrease the Pokemon
gene expression in cancer gene therapy.
The SV40 early promoter contains a TATA box,
three copies of a 21-bp GC-rich repeat, and two copies
of a 72-bp repeat. The 72-bp repeat acts as an enhan-
cer to increase the activity of the SV40 promoter,
whereas the 21-bp GC-rich repeat is the main recogni-
tion signal for eukaryotic RNA polymerase II and is
necessary for promoter activity [35]. Deletion analysis
and the decoy assay showed that the NEG-U and
NEG-D elements were involved in the negative
Analysis of upstream region of the Pokemon gene Y. Yang et al.
1868 FEBS Journal 275 (2008) 1860–1873 ª 2008 The Authors Journal compilation ª 2008 FEBS
regulation of the Pokemon gene. However, our gain-

of-function experiment interestingly revealed that both
the NEG-U and NEG-D elements could increase the
activity of the SV40 promoter. The negative function
of the NEG-U element is strictly dependent on the
NEG-D element. When incorporated upstream of the
SV40 promoter, the NEG-U element may interact with
the 72-bp repeat enhancer to increase promoter activ-
ity. In addition, there may be a similar reason why
NEG-D element could increase the activity of the
SV40 promoter. Therefore, a DNA context in which
different regulatory elements exist also plays an impor-
tant role in gene regulation, and incorporating these
elements into new promoters may alter their original
functions.
Eukaryotic gene expression is often controlled by
multiprotein transcriptional complexes that bind differ-
ent elements in the 5¢-upstream regions of target genes
[36]. Gallagher et al. showed that the GATA-1 and
Oct-1 elements were required for the expression of the
gene encoding human a-hemoglobin-stabilizing protein
[37]. Recently, Griffin et al. showed that E-box and
sterol regulatory element (SRE) could mediate syner-
gistic activation of the fatty acid synthase promoter
[38]. NEG-U and NEG-D elements were necessary and
sufficient for the negative regulation of the Pokemon
gene, but the NEG-U or NEG-D element alone could
not negatively affect gene expression, further confirm-
ing the importance of combinatorial control. In this
study, we also found that mutations in both NEG-U
and NEG-D elements had the same effect as each sin-

gle mutation. This is because negative regulation of the
Pokemon gene is strictly dependent on an interaction
between NEG-U and NEG-D elements. Mutations in
both sites or mutation in a single site could abolish an
interaction between them. Therefore, all mutated con-
structs displayed high luciferase activities.
In many eukaryotic genes, transcription factors bind
to promoters located at sites distant from one another,
yet they act synergistically via DNA looping to acti-
vate transcription [39,40]. The insulin gene promoter
contains three SREs and two E-boxes; two of the
SREs overlap with the E-boxes that can be bound by
the BETA2 ⁄ E47 protein. Activation of the insulin pro-
moter by SRE-binding protein (SREBP-1c) was mark-
edly enhanced by the co-expression of BETA2 ⁄ E47.
Synergistic activation by SREBP-1c and BETA2⁄ E47
was not mediated via SREs but via the E-boxes.
Reducing the distance between the two E-boxes abol-
ished synergistic activation. Therefore, the synergistic
action required the presence of two E-boxes separated
by an appropriate distance in a looped form, presum-
ably to form a DNA and SREBP-1c ⁄ BETA2 ⁄ E47
complex [41]. To determine whether the length between
the NEG-U and NEG-D elements also plays an
important role in the regulation of the Pokemon gene,
the distance between them was reduced to 254 and
106 bp. Our results showed that synergistic inhibition
via the interaction between the NEG-U and NEG-D
elements was almost abolished when the distance
between the two elements was reduced, suggesting that

synergistic inhibition also requires the regulatory ele-
ments to be separated by a certain distance. It is likely
that the appropriate distance facilitates DNA looping
structure formation and is the threshold distance for
the interaction between the NEG-U and NEG-D ele-
ments. Deviation from the appropriate distance pre-
vented the corresponding cis–trans complexes from
acting synergistically with DNA looping to activate or
suppress transcription.
In conclusion, our studies are the first to elucidate
the mechanism of the Pokemon gene transcription reg-
ulation. Future studies will focus on the identification
of proteins that can specifically bind to the NEG-U,
NEG-D, and POS-D elements; this will provide a bet-
ter understanding of the mechanisms of the Pokemon
gene regulation.
Experimental procedures
Cells and cell culture
Human lung carcinoma A549 cells were grown in Ham’s
F12K medium containing 10% fetal bovine serum (Invitro-
gen Corp., Carlsbad, CA, USA), human prostate carci-
noma DU145 cells and human tumor of cervix uteri HeLa
cells were grown in Dulbecco’s modified Eagle’s medium
containing 10% fetal bovine serum (Invitrogen), human
hepatocyte carcinoma HepG2 cells and human acute T-cell
leukemia cells were maintained in RPMI-1640 medium con-
taining 10% fetal bovine serum (Invitrogen). All these cells
were incubated in a humidified 5% CO
2
incubator at

37 °C.
Creation of deletion constructs of the upstream
region of the Pokemon gene
The 2204-bp upstream region of the Pokemon gene, which
spans the region )2220 to )17, was amplified by PCR from
human blood genomic DNA by using the primers YU and
YD (Table 1). The PCR products were cloned into the
pGEM-T easy vector (Promega, Madison, WI, USA) and
sequenced; then, the 2204-bp promoter fragment was
cloned into the BglII ⁄ HindIII sites of the pGL-3 basic vec-
tor (Promega), and the resultant construct was designated
as F-2220. The 5¢-deletion constructs with their endpoints
Y. Yang et al. Analysis of upstream region of the Pokemon gene
FEBS Journal 275 (2008) 1860–1873 ª 2008 The Authors Journal compilation ª 2008 FEBS 1869
at )2116, )1712, )837, )685, )637, )619, )599, ) 580,
)560, )542, )523, )503, )466, ) 418, )381, )233, )113,
)97, )83 and )71 were created by amplifying the F-2220
plasmid by using different upstream PCR primers
(Y1–Y20, Table 1) and a single downstream primer YD
(Table 1). All these PCR products were digested at the
XhoI and HindIII sites and cloned into the pGL-3 basic
vector. The resultant constructs were mainly termed accord-
ing to the nucleotide location of the 5¢-end of the forward
primer used in the PCR reaction, e.g., F-2116, F-1712,
F-837 and F-71. All the vector constructs were confirmed
by DNA sequence analysis.
Because the ApaI site is located in the region between )88
and )83 of the Pokemon promoter, all 3¢-deletion constructs
were obtained with this restriction site as reference. 3¢-Dele-
tion constructs with endpoints at )107, )127, )156, )210,

)331, )377 and )473 were created by PCR using different
downstream PCR primers (Y21–Y27, Table 1) and a single
upstream primer Y9 (Table 1). The PCR products were
digested at the XhoI and ApaI sites and cloned into the
corresponding sites of the F-233 plasmid and sequenced.
The resultant constructs were designated as T-107, T-127,
T-156, T-210, T-331, T-377 and T-473, based on the
above-mentioned endpoints. All these constructs contained
the region between ) 88 and )17 of the Pokemon promoter
but had different internal deletion fragments. All these vector
constructs were confirmed by DNA sequence analysis.
Transient transfection and luciferase assay
To analyze a series of promoter activities, an empty pGL3-
basic vector (Promega) was used as a negative control, and
the pRL-TK vector (Promega) was cotransfected as an
internal control. A day before transfection, 1 · 10
5
cells ⁄
well were seeded in 24-well plates, and triplicate wells were
set up for each group. After the cells reached  90% con-
fluence, they were transfected with of 30 ng of the pRL-TK
vector and 300 ng of the pGL3 vectors containing different
lengths of the Pokemon promoter fragment to each well by
using Lipofectamine
TM
2000 (Invitrogen). After 48 h of
transfection, cells were harvested and lysed in 200 lLof
reporter lysis buffer (Promega). A luciferase assay was car-
ried out using a dual luciferase assay kit (Promega), and
the enzymatic activity of luciferase was measured using a

luminometer (Promega).
Table 1. Oligonucleotide primers used to construct reporter plasmids. Restriction sites are underlined.
Name Sequence (5¢-to3¢) Restriction sites Position
a
YU TCAATAGATCTCCCGTGCTCAGATCAACAGG BglII )2220 ⁄ )2201
YD ATACT
AAGCTTTGCAGCAGTGGGGAAGGAGA HindIII )36 ⁄ )17
Yl TCTAC
CTCGAGTTCCAACACGGAGTTTCGCT XhoI )2116 ⁄ )2097
Y2 TCTAC
CTCGAGGCGATTCTTCTGCCTCAGCG XhoI )1712 ⁄ )1693
Y3 TTTAC
CTCGAGCAGGACATCTGACCATTCTC XhoI )837 ⁄ )818
Y4 ACTAC
CTCGAGGTGCCGTGGTTCATGCCTGT XhoI )685 ⁄ )666
Y5 TCTAC
CTCGAGGTTGGATCATTTGAGGCCAG XhoI )637 ⁄ )618
Y6 TCTAC
CTCGAGAGGGTTTTTTGATTTGTTTT XhoI )619 ⁄ )600
Y7 TCTAC
CTCGAGGTTTTTTTGAGATGGAGTCT XhoI )599 ⁄ )580
Y8 TCTAC
CTCGAGTTGCTCTGTTGCCCAGGCTG XhoI )580 ⁄ )561
Y9 TCTAC
CTCGAGGAGTGCAGTGGCGTGATCTC XhoI )560 ⁄ )541
Y10 TCTAC
CTCGAGTCAGCTCACTGCAAGCTCTG XhoI )542 ⁄ )523
Yll TCTAC
CTCGAGGCCTCCTGGGTTCATGCCAT XhoI )523 ⁄ )504
Y12 TCTAC

CTCGAGTCTCCTGCCTCAGCCTCCCG XhoI )503 ⁄ )484
Y13 TCTAC
CTCGAGGCCCCCGCCAACACGCCCGG XhoI )466 ⁄ )147
Y14 TCTAC
CTCGAGGGGGTTTCACTGTGTTAGCC XhoI )418 ⁄ )399
Y15 TCTAC
CTCGAGCTGACCTCATGATCTGCCTG XhoI )381 ⁄ )362
Y16 TCTAC
CTCGAGAGAGGCTGGAGGCAGGGCAT XhoI )233 ⁄ )214
Y17 TCTAC
CTCGAGGGAACGCTGCTTCTCAAGGG XhoI )113 ⁄ )94
Y18 TCTAC
CTCGAGAGGGCCTCGGGCCCTTGTCA XhoI )97 ⁄ )78
Y19 TCTAC
CTCGAGTTGTCAGTGGGCACAGGAAC XhoI )83 ⁄ )64
Y20 TCTAC
CTCGAGACAGGAACCCCCGCACCCCC XhoI )71 ⁄ )52
Y21 ATCAT
GGGCCCCGTTCCACCCTGCTCCCCCA ApaI )126 ⁄ )107
Y22 TTCAT
GGGCCCGCCTCACATTCCCACCTGCA ApaI )146 ⁄ )127
Y23 ATCAT
GGGCCCGGTCAGATGTCGCGCCTTTC ApaI )175 ⁄ )156
Y24 CTCAT
GGGCCCTACATGCCCTGCCTCCAGCC ApaI )229 ⁄ )210
Y25 TTCAT
GGGCCCCTGTAATCCCAGCACTTTGG ApaI )350 ⁄ )331
Y26 TTCAT
GGGCCCTCAGGGGATGGAGACCATCC ApaI )396 ⁄ )377
Y27 ATCAT

GGGCCCTCCAGCTACTCGGGAGGCTG ApaI )492 ⁄ )473
a
In relation to the translation start site.
Analysis of upstream region of the Pokemon gene Y. Yang et al.
1870 FEBS Journal 275 (2008) 1860–1873 ª 2008 The Authors Journal compilation ª 2008 FEBS
EMSAs
Binding reactions and preparation of the nuclear extract
from A549 cells were carried out as described previously
[42]. Equimolar complementary oligonucleotides were
annealed to create double-stranded oligonucleotides. The
sequences of the probes (only the sense strand is shown)
used were as follows: POS-D, 5¢-GGCCCTTGTCAGTG
GGCACAGG-3¢; NEG-U, 5¢-TGGAGTGCAGTGGCGT
GATCTCAGCT-3¢; and NEG-D, 5¢-CTGGGGGAGCAG
GGTGGAACGC-3¢. The mutated probes (only the sense
strand is shown) used were as follows: MPOS-D, 5¢GGCC
CC
CACTGACAAUGGCACAAGG-3¢; MNEG-U, 5¢-TG
GAGT
TCATTGTTAUTGATCTCAGCT-3¢; and MNEG-D,
5¢-CTGGGG
TCTTCTTTCUGGAACGC-3¢. Mutated sites
are underlined.
Site-directed mutagenesis analysis
In order to further study the function of the NEG-U and
NEG-D elements in the Pokemon promoter, base mutations
were performed using the QuikChange site-directed muta-
genesis kit (Stratagene, La Jolla, CA, USA). Three mutant
constructs, MF-233 (the POS-D element was mutated in
F-233), M-U (the NEG-U element was mutated in F-560)

and M-D (the NEG-D element was mutated in F-560) were
obtained from F-233 and F-560, according to the manufac-
turer’s protocol. The mutant construct M-B (both the
NEG-U and NEG-D elements were mutated in F-560) was
constructed using M-U as the backbone according to the
protocol. The primers used were as follows: MF-233 sense
primer, 5¢-TTCTCAAGGGCCTCGGGCCCC
CACTGA
CAAGGCACAGGAACCCCCGCACC-3¢; MF-233 anti-
sense primer, 5¢-GGTGCGGGGGTTCCTGTGCC
TTGT
CAGTGGGGGCCCGAGGCCCTTGAGAA-3¢; M-U
sense primer, 5¢-CTCTGTTGCCCAGGCTGGAGTCATT
GTTATGATCTCAGCTCACTGCAAG-3¢; M-U antisense
primer, 5¢-CTTGCAGTGAGCTGAGATCATAA
CAAT
GACTCCAGCCTGGGCAACAGAG-3¢; M-D sense
primer, 5¢-TGGGAATGTGAGGCTGGGGG
TCTTCTTT
CGGAACGCTGCTTCTCAAGGG-3¢; and M-D antisense
primer, 5¢-CCCTTGAGAAGCAGCGTTCC
GAAAGA
AGACCCCCAGCCTCACATTCCCA-3¢. Mutated sites
are underlined.
Construction of other reporter plasmids
To determine the effect of the NEG-U and NEG-D ele-
ments on the activity of the SV40 promoter, we cloned
these elements and their mutants into the KpnI ⁄ XhoI sites
of the pGL3-control (Promega) in both the normal and
reverse orientations. The resultant constructs were

sequenced to verify their fidelity, and they were termed
WU-F, WU-I, MU-F, MU-I, WD-F, WD-I, MD-F and
MD-I. In order to determine the impact of the length
between the NEG-U and NEG-D elements on the regula-
tion of the Pokemon promoter, we inserted the NEG-U ele-
ment into the KpnI ⁄ XhoI sites of F-381 and F-233 and
sequenced them. The resultant plasmids were termed D-254
and D-106, respectively.
Decoy technique assay
To further determine whether the POS-D, NEG-U and
NEG-D elements play important roles in regulation of the
Pokemon promoter, the DNA decoy technique was
employed. Briefly, 300 ng of reporter plasmid, 30 ng of the
pRL-TK vector, 0–2 lg of the double POS-D, NEG-U or
NEG-D decoy oligonucleotides were cotransfected into A549
and DU145 cells using the lipofection method. After 24 h of
transfection, a luciferase assay was performed using the dual
luciferase assay kit (Promega). For control experiments, the
MPOS-D, MNEG-U and MNEG-D double oligonucleotides
were used as described in EMSAs. To further determine the
cooperation between the NEG-U and NEG-D elements, 2 lg
of the NEG-U decoy, 2 lg of the NEG-D decoy, and a
combination of 1 lg of each of the decoys were used, and the
above-mentioned methods followed.
Acknowledgements
This study was supported by Chinese National Sci-
ences Fund Committee (Grant No.30470379) in China.
References
1 Albagli O, Dhordain P, Deweindt C, Lecocq G &
Leprince D (1995) The BTB ⁄ POZ domain: a new pro-

tein–protein interaction motif common to DNA- and
actin-binding proteins. Cell Growth Differ 6, 1193–1198.
2 Kelly KF & Daniel MJ (2006) POZ for effect – POZ-
ZF transcription factors in cancer and development.
Trends in Cell Biol 16, 578–587.
3 Farkas G, Gausz J, Galloni M, Reuter A, Gyurkovics
H & Karch F (1994) The Trithorax-like gene encodes
the Drosophila GAGA factor. Nature 371, 806.
4 Barna M, Hawe N, Niswander L & Pandolfi PP (2000)
Plzf regulates limb and axial skeletal patterning. Nat
Genet 25, 166–172.
5 Chen Z, Brand NJ, Chen A, Chen SJ, Tong JH, Wang
ZY, Waxman S & Zelent A (1993) Fusion between a
novel Kruppel-like zinc finger gene and the retinoic acid
receptor-a locus due to a variant t (11;17) translocation
associated with acute promyelocytic leukaemia. EMBO
J 12, 1161–1167.
6 Kerckaert JP, Deweindt C, Tilly H, Quief S, Lecocq G
& Bastard C (1993) LAZ3, a novel zinc-finger encoding
gene, is disrupted by recurring chromosome 3q27 trans-
locations in human lymphomas. Nat Genet 5, 66–70.
Y. Yang et al. Analysis of upstream region of the Pokemon gene
FEBS Journal 275 (2008) 1860–1873 ª 2008 The Authors Journal compilation ª 2008 FEBS 1871
7 Yamochi T, Kaneita Y, Akiyama T, Mori S &
Moriyama M (1999) Adenovirus-mediated high expres-
sion of BCL-6 in CV-1 cells induces apoptotic cell death
accompanied by down-regulation of BCL-2 and BCL-
X(L). Oncogene 18, 487–494.
8 Aravind L & Koonin EV (1999) Fold prediction and
evolutionary analysis of the POZ domain: structural

and evolutionary relationship with the potassium
channel tetramerization domain. J Mol Biol 285, 1353–
1361.
9 Stogios PJ, Downs GS, Jauhal JJ, Nandra SK & Prive
´
GG (2005) Sequence and structural analysis of BTB
domain proteins. Genome Biol 6, R82.
10 Collins T, Stone JR & Williams AJ (2001) All in the
family: the BTB ⁄ POZ, KRAB, and SCAN domains.
Mol Cell Biol 21, 3609–3615.
11 David G, Alland L, Hong SH, Wong CW, DePinho
RA & Dejean A (1998) Histone deacetylase associated
with mSin3A mediates repression by the acute promye-
locytic leukemia-associated PLZF protein. Oncogene 16,
2549–2556.
12 Melnick A, Carlile G, Ahmad KF, Kiang CL,
Corcoran C, Bardwell V, Prive GG & Licht JD (2002)
Critical residues within the BTB domain of PLZF and
Bcl-6 modulate interaction with corepressors. Mol Cell
Biol 22, 1804–1818.
13 Ahmad KF, Melnick A, Lax S, Bouchard D, Liu J,
Kiang CL, Mayer S, Takahashi S, Licht JD & Prive
´
GG (2003) Mechanism of SMRT corepressor recruit-
ment by the BCL6 BTB domain. Mol Cell 12, 1551–
1564.
14 Yoon HG, Chan DW, Reynolds AB, Qin J & Wong J
(2003) N-CoR mediates DNA methylation-dependent
repression through a methyl CpG binding protein
Kaiso. Mol Cell 12, 723–734.

15 Van Roy FM & McCrea PD (2005) A role for Kaiso–
p120ctn complexes in cancer? Nat Rev Cancer 5, 956–
964.
16 Pessler F, Pendergrast PS & Hernandez N (1997) Purifi-
cation and characterization of FBI-1, a cellular factor
that binds to the human immunodeficiency virus type 1
inducer of short transcripts. Mol Cell Biol 17, 3786–3798.
17 Morrison DJ, Pendergrast PS, Stavropoulos P,
Colmenares SU, Kobayashi R & Hernandez N (1999)
FBI-1, a factor that binds to the HIV-1 inducer of short
transcripts (IST), is a POZ domain protein. Nucleic
Acids Res 27, 1251–1262.
18 Pendergrast PS, Wang C, Hernandez N & Huang S
(2002) FBI-1 can stimulate HIV-1 Tat activity and is
targeted to a novel subnuclear domain that includes the
Tat-P-TEFb-containing nuclear speckles. Mol Biol Cell
13, 915–929.
19 Laudes M, Christodoulides C, Sewter C, Rochford JJ,
Considine RV, Sethi JK, Vidal-Puig A & O’Rahilly S
(2004) Role of the POZ zinc finger transcription factor
FBI-1 in human and murine adipogenesis. J Biol Chem
279, 11711–11718.
20 Widom RL, Lee JY, Joseph C, Gordon-Froome I &
Korn JH (2001) The hcKrox gene family regulates mul-
tiple extracellular matrix genes. Matrix Biol 20, 451–
462.
21 Liu CJ, Prazak L, Fajardo M, Yu S, Tyagi N &
Di Cesare PE (2004) Leukemia ⁄ lymphoma-related fac-
tor, a POZ domain-containing transcriptional–transcrip-
tional repressor, interacts with histone deacetylase-1

and inhibits cartilage oligomeric matrix protein gene
expression and chondrogenesis. J Biol Chem 279,
47081–47091.
22 Maeda T, Hobbs RM, Merghoub T, Guernah I,
Zelent A, Cordon-Cardo C, Teruya-Feldstein J &
Pandolfi PP (2005) Role of the protooncogene Pokemon
in cellular transformation and ARF repression. Nature
433, 278–285.
23 Pessler F & Hernandez N (2003) Flexible DNA binding
of the BTB ⁄ POZ domain protein FBI-1. J Biol Chem
278, 29327–29335.
24 Lee DK, Suh D, Edenberg HJ & Hur MW (2002) POZ
domain transcription factor, FBI-1, represses transcrip-
tion of ADH5 ⁄ FDH by interacting with the zinc finger
and interfering with DNA binding activity of Sp1.
J Biol Chem 277, 26761–26768.
25 Lee DK, Kang JE, Park HJ, Kim MH, Yim TH,
Kim JM, Kwon HJ & Hur MW (2005) FBI-1 enhances
transcription of the nuclear factor-kB (NF-kB)-respon-
sive E-selectin gene by nuclear localization of the p65
subunit of NF-kB. J Biol Chem 280, 27783–27791.
26 Maeda T, Hobbs RM & Pandolfi PP (2005) The tran-
scription factor Pokemon: a new key player in cancer
pathogenesis. Cancer Res 65, 8575–8578.
27 Davies JM, Hawe N, Kabarowski J, Huang QH, Zhu J,
Brand NJ, Leprince D, Dhordain P, Cook M,
Morriss-Kay G et al. (1999) Novel BTB ⁄ POZ domain
zinc-finger protein, LRF, is a potential target of the
LAZ-3 ⁄ BCL-6 oncogene. Oncogene 18, 365–375.
28 Matys V, Kel-Margoulis OV, Fricke E, Liebich I,

Land S, Barre-Dirrie A, Reuter I, Cheekmenev D, Krull
M, Hornischer K et al. (2006) TRANSFAC
Ò
and its
module TRANSCompel
Ò
: Transcriptional gene regula-
tion in eukaryotes. Nucleic Acids Res 34(Suppl. 1),
D108–D110.
29 Umenishi F & Verkman AS (1998) Isolation and func-
tional analysis of alternative promoters in the human
aquaporin-4 water channel gene. Genomics 50, 373–377.
30 Scohy S, Gabant P, Szpirer C & Szpirer J (2000) Identi-
fication of an enhancer and an alternative promoter in
the first intron of the a-fetoprotein gene. Nucleic Acids
Res 28, 3743–3751.
31 Yan Y, Phan L, Yang F, Talpaz M, Yang Y, Xiong Z,
Ng B, Timchenko NA, Wu CJ, Ritz J et al. (2004) A
novel mechanism of alternative promoter and splicing
Analysis of upstream region of the Pokemon gene Y. Yang et al.
1872 FEBS Journal 275 (2008) 1860–1873 ª 2008 The Authors Journal compilation ª 2008 FEBS
regulates the epitope generation of tumor antigen
CML-L1. J Immunol 172, 651–660.
32 Tomita N, Morishita R, Higaki J & Ogihara T (1997)
Strategy for functional inactivation of genes: a novel
strategy for gene therapy and gene regulation analysis
using transcriptional factor decoy oligonucleotides. Exp
Nephrol 5, 429–434.
33 Morishita R, Higaki J, Tomita N & Ogihara T (1998)
Application of transcription factor ‘decoy’ strategy as

means of gene therapy and study of gene expression in
cardiovascular disease. Circ Res 82, 1023–1028.
34 Yamasaki K, Asai T, Shimizu M, Aoki M, Hashiya N,
Sakonjo H, Makino H, Kaneda Y, Ogihara T & Mo-
rishita R (2003) Inhibition of NF kappa B activation
using cis-element ‘decoy’ of NF kappa B binding site
reduces neointimal formation in porcine balloon-injured
coronary artery model. Gene Ther 10 , 356–364.
35 Byrne BJ, Davis M, Yamaguchi J, Bergsma DJ &
Subramanian KN (1982) Definition of the simian virus
40 early promoter region and demonstration of a host
range bias in the enhancement effect of the simian virus
40 72-base-pais repeat. Proc Natl Acad Sci USA 80,
721–725.
36 Fiala-Beer E, Lee AC & Murray M (2007) Regulation
of the rat CYP4A2 gene promoter by c-Jun and
octamer binding protein-1. Int J Biochem Cell Biol 39,
1235–1247.
37 Gallagher PG, Liem RL, Wong E, Weiss MJ & Bodine
DM (2005) GATA-1 and Oct-1 are required for expres-
sion of the a-hemoglobin-stabilizing protein gene. J Biol
Chem 280, 39016–39023.
38 Griffin MJ, Wong RHF, Pandya N & Sul HK (2007)
Direct interaction between USF and SREBP-1c medi-
ates synergistic activation of the fatty-acid synthase pro-
moter. J Biol Chem 282, 5453–5467.
39 Wolberger C (1998) Combinatorial transcription fac-
tors. Curr Opin Genet Dev 8, 552–559.
40 Schleif R (1992) DNA looping. Annu Rev Biochem 61,
199–223.

41 Amemiya-Kudo M, Oka J, Ide T, Matsuzaka T, Sone
H, Yoshikawa T, Yahagi N, Ishibashi S, Osuga J &
Yamada N (2005) Sterol regulatory element-binding
proteins activate insulin gene promoter directly and
indirectly through synergy with BETA2 ⁄ E47. J Biol
Chem 280, 34577–34589.
42 Schreiber E, Matthias P, Muller MM & Schaffner W
(1989) Rapid detection of octamer binding proteins with
‘mini-extracts’ prepared from a small number of cells.
Nucleic Acids Res 17, 6419–6421.
Y. Yang et al. Analysis of upstream region of the Pokemon gene
FEBS Journal 275 (2008) 1860–1873 ª 2008 The Authors Journal compilation ª 2008 FEBS 1873