Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf

A fluorescence energy transfer-based mechanical stress
sensor for specific proteins in situ
Fanjie Meng, Thomas M. Suchyna and Frederick Sachs
Center for Single Molecule Biophysics, Department of Physiology and Biophysics, State University of New York at Buffalo, NY, USA

Keywords
Cerulean; fluorescence resonance energy
transfer; relative orientation factor; Venus;
a-helix linker
Correspondence
F. Sachs, Center for Single Molecule
Biophysics, Department of Physiology and
Biophysics, State University of New York at
Buffalo, 3435 Main Street, Buffalo, NY,
14214 USA
Fax: +1 716 829 2569
Tel: +1 716 829 3289 ext. 105
E-mail:
(Received 15 December 2007, revised 9
April 2008, accepted 11 April 2008)
doi:10.1111/j.1742-4658.2008.06461.x

To measure mechanical stress in real time, we designed a fluorescence resonance energy transfer (FRET) cassette, denoted stFRET, which could be
inserted into structural protein hosts. The probe was composed of a green
fluorescence protein pair, Cerulean and Venus, linked with a stable a-helix.
We measured the FRET efficiency of the free cassette protein as a function
of the length of the linker, the angles of the fluorophores, temperature and
urea denaturation, and protease treatment. The linking helix was stable to
80 °C, unfolded in 8 m urea, and rapidly digested by proteases, but in all
cases the fluorophores were unaffected. We modified the a-helix linker by
adding and subtracting residues to vary the angles and distance between

the donor and acceptor, and assuming that the cassette was a rigid body,
we calculated its geometry. We tested the strain sensitivity of stFRET by
linking both ends to a rubber sheet subjected to equibiaxial stretch. FRET
decreased proportionally to the substrate strain. The naked cassette
expressed well in human embryonic kidney-293 cells and, surprisingly, was
concentrated in the nucleus. However, when the cassette was located into
host proteins such a-actinin, nonerythrocyte spectrin and filamin A, the
labeled hosts expressed well and distributed normally in cell lines such as
3T3, where they were stressed at the leading edge of migrating cells and
relaxed at the trailing edge. When collagen-19 was labeled near its middle
with stFRET, it expressed well in Caenorhabditis elegans, distributing similarly to hosts labeled with a terminal green fluorescent protein, and the
worms behaved normally.

Mechanical stress is one of the most influential
physical factors in biology and one of the least characterized. Whereas it is obvious from molecular dynamics [1–4] and force spectroscopy [5–12] that forces
deform molecules, the mechanics of cells are much
more complicated, involving the interaction of heterogeneous polymers and membranes and their interaction
with both two-dimensional heterogeneous liquid membranes [13,14] and three-dimensional cytoplasmic solutions, where signaling factors can vary in time and
space [15–17]. Mechanical interactions at the levels of

cells, organs and organisms are responsible for such
familiar physiological functions as motor function,
hearing [18], touch [19], and the regulation of blood
pressure [20], but the interactions are also deeply
embedded in the biochemistry of the cell, affecting
such varied processes as the phenotype of stem cells
[21], DNA transcription [22,23], translation of cellular
components by motor proteins such as kinesin [5],
stress-induced changes of structure, such as occur in
shear stress modulation of the cytoskeleton of the

endothelia [24,25], and more general interactions due

Abbreviations
CFP, cyan fluorescent protein; COL-19, collagen-19; D ⁄ A ratio, donor emission to acceptor emission ratio; DIC, differential interference
contrast; E, fluorescence resonance energy transfer energy transfer efficiency; FRET, fluorescence resonance energy transfer; GFP, green
fluorescent protein; HEK, human embryonic kidney; YPF, yellow fluorescent protein.

3072

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works


F. Meng et al.

to the physical chemistry of concentrated protein solutions [26]. To dissect which stresses affect which functions, we need labels that are sensitive to mechanical
stress and that can be attached to specific proteins.
To meet that need, we designed a cassette
(denoted stFRET) that can be inserted into structural proteins and reports molecular strain via
changes in fluorescence resonance energy transfer
(FRET), and, with appropriate calibration, molecular
stress. The cassette consists of the green fluorescent
protein (GFP) monomers Cerulean and Venus
[27–31], linked by a stable a-helix [32]. This article
characterizes the properties of the probes, and shows
that they can be efficiently incorporated into structural proteins such as collagen-19 (COL-19), nonerythrocyte spectrin, a-actinin and filamin A within
living cells, and that the FRET from this cassette
changes with stress in situ.
The efficiency of energy transfer for a FRET pair
is E µ 1 ⁄ [1 + (R ⁄ RO)6], where R is the distance
between the dipoles and RO is the characteristic

distance for 50% energy transfer [33]. The maximal
sensitivity for changes in R occurs at R = RO. For
Venus and Cerulean, RO is $ 5 nm [34], so we linked
them with a 5 nm a-helix. The efficiency is affected
by the angle between the transition dipoles as well as
the distance between them, and we estimated the
probe geometry by varying the number of residues in
the linker. Removing one residue caused a large
change in angle with a small change in distance, and
adding or removing a full turn produced a change in
distance with no change in angle. We used six
mutants to solve for the three relevant angles of the
dipoles, assuming that the cassette was rigid. stFRET
was stable over temperature and mild urea denaturing
conditions, but with 8 m urea, the linker unfolded
and the fluorophores remained stable. Thus, stFRET
is robust.
stFRET expressed well in various biological systems,
including 3T3 and human embryonic kidney (HEK)293 cells and in Caenorhabditis elegans. After insertion
into a variety of structural host proteins such as collagen, filamin, actinin and spectrin, it distributed in the
same manner as the same hosts with terminal GFP
tags. stFRET changed FRET with the spontaneous
movement of motile cells, decreasing efficiency in
regions under tension and increasing it in regions
expected to be free of significant stress. By axially
stretching C. elegans, we could demonstrate acute
reversible changes in FRET associated with tension
and relaxation. stFRET opens the door to studying in
real time many physiological processes that are modulated or driven by mechanical stress.

Mechanical stress sensor

Results
General configuration and FRET spectra of
stFRET and its variants
Figure 1 is a diagram of stFRET geometry as deduced
from the procedure described in Modeling and calibration in the Experimental procedures. Figure 2A shows
the general configuration of six stFRET variants. The
inward arrows show the excitation wavelength, and the
outward arrows show the emission wavelength. Width
of arrows denotes light intensity. Figure 2B shows the
alignment of the DNA sequence of the linker with five
modified versions (the predicted geometrical changes
are shown in Table 1). As shown in Table 1, according
to the general property of a-helices, one amino acid
deletion produces a change ()100°) in angle with negli˚
gible change ()1.5 A) in length. A five residue deletion
of the helix rotates the structure by 360° but shrinks
the helix by 2.7 nm. Deletion or addition of two and a
half turns of the helix twists the structure by )180° or
+180° and decreases or increases the length by
1.35 nm. Figure 2C gives the amino acid sequence
and the segments of the helix linker that we modified.
Deletion of 18 amino acids eliminates five turns of the
helix, and a nine amino acid deletion eliminates two
and half turns.
Figure 3A shows the emission spectrum of stFRET
with excitation at 433 nm. There are peaks at 475 nm

Fig. 1. Geometry of stFRET. D and A are donor and acceptor

dipole vectors, and r is the length of the linker. The three angles
(hA, hD, U) are the unknown parameters. RA–D is the distance
between acceptor and donor chromophores.
Table 1. Changes in stFRET geometry caused by adding and deleting amino acids. Positive symbols indicate an increasing amount,
and negative symbol indicate a decreasing amount.
No. amino acids
added or subtracted

Change in length
of linker (nm)

Change in angle
of linker (radians)

)1
)2
+9
)9
)18

)0.15
)0.3
+1.35
)1.35
)2.7

5p ⁄ 9
10p ⁄ 9
p
p

0

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3073


Mechanical stress sensor

F. Meng et al.

A

B

Fig. 2. Construction of stFRET protein and
five variants. (A) Schematic structure of
stFRET. Cyan is the donor, Cerulean; yellow
is the acceptor, Venus. The height of the
b-can structure is 4.2 nm. The black helix is
the linker, and it nominal length is 5.0 nm.
Incoming arrows indicate excitation, and
outgoing arrows indicate emission, with the
wavelength marked next to them; the width
of the arrows is proportional to the light
intensity. (B) Alignment of the primary and
modified linker DNA sequences. (C) Modifications to the linker with DNA and amino
acid sequences.

C

and 527 nm, with the 475 nm emission from the donor
Cerulean and 527 nm from the acceptor Venus having
robust energy transfer. A 100 lm solution of unlinked
donor and acceptor (1 : 1 mixture, green filled squares
and line with 433 nm excitation) had a small emission
at 527 nm due to the bleed-through from Cerulean,
the donor (blue filled inverted triangle and line) and
some direct excitation of the acceptor Venus by
433 nm (black triangle and line). The donor and acceptor mixture had E = 0 and donor emission to acceptor
emission ratio (D ⁄ A ratio) = 2.47 ± 0.05 (Fig. 3B).
However, for stFRET, E = 44 ± 2.5% and D ⁄ A
3074

ratio = 0.47 ± 0.02, showing efficient energy transfer
(for E and D ⁄ A ratio calculation, see Experimental
procedures).
Calibration of three angles and j2
Confident in the origin of stFRET energy transfer, we
purified the other five variants and measured their fluorescence (Fig. 4A). All mutants exhibited robust
FRET (Table 2). stFRET itself had 44 ± 2.5% energy
transfer, and the 5T construct had the highest efficiency, E = 56 ± 4.5%, the 2.5T construct increased

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works


F. Meng et al.

E to 47 ± 2.1%, whereas the 2.5I construct decreased
E to 37 ± 0.9%. FT1AA and FT2AA, presumably

only having their angles changed, decreased E to
29 ± 7.1% and 38 ± 4.3%, respectively (Fig. 4B).
Table 2 summarizes the apparent change of angles and
distances obtained by modifying the linker and the
corresponding energy transfer efficiency.
If we assume that a single residue alters the linker
length by a translation of 0.15 nm and 100°, and that
the structure is rigid, we can use the data in Table 2 to
solve for the probe geometry (see Experimental procedures). The numerical solutions gave hA = 3.83,
hD = )0.78 and U = 1.97 radians, and j2 = 0.86,
which is 30% higher than 2 ⁄ 3, the j2 value that one
would obtain assuming random rotation of the donor
and acceptor (Fig. 1). However, it should be pointed
out that a value of j2 $ 2 ⁄ 3 does not necessarily imply
that the probes are moving randomly.
Stability of the linker as perturbed by urea,
temperature, and proteinase K
We did a number of tests to assess linker integrity. If
the linker was an a-helix, then melting would increase
the end–end spacing and the efficiency would decrease.
With urea as a denaturant [35,36], Fig. 5A shows that
the efficiency of stFRET declined with concentration
up to 8 m, and the previously quenched donor emission recovered. Remarkably, the fluorophore spectra
were almost unaffected by urea, with < 10–15%
change in amplitude (Fig. 5C,D). Figure 5B shows
that 1–8 m urea caused the D ⁄ A ratio to increase
from 0.46 to 1.21, as expected if the helix unfolded
into a random coil allowing the donor and acceptor to
move further apart and reducing energy transfer
(Fig. 5E).

As a second test of the helix stability, we tried to
melt stFRET at elevated temperatures, but the protein
proved stable up to 80 °C. Figure 6A shows the temperature dependence of fluorescence of 100 lm
stFRET protein excited at 433 nm from room temperature to 80 °C. Donor and acceptor emission both
declined somewhat as the temperature increased, probably due to a direct change in quantum efficiency, but
there was no significant change in transfer efficiency
from 60 °C to 80 °C, the upper limit of our measurements, so that the linker structure can be considered to
be quite robust.
As a final test of linker integrity, we digested
stFRET with proteases that cut the linker but left the
fluorophores intact. Figure 7 shows that proteinase K
led to a rapid fall in efficiency that was complete
within 1 min. The D ⁄ A ratio changed from 0.42 to

Mechanical stress sensor

1.95 over 30 min (Fig. 7B), as compared to a change
from 0.46 to only 1.21 when the protein was treated
with 8 m urea (Fig. 5B). Similar behavior was found
for all six constructs (data not shown). The donor and
acceptor fluorophore spectra were unaffected by proteinase K after 30 min of digestion (Fig. 7C,D).
Figures 5E and 7E are diagrammatic models summarizing the energy transfer between donor and acceptor
under different treatments (the width of the arrows
represents signal intensity).
In vitro measurement of strain sensitivity
To verify the strain responsiveness, we bonded the
ends of derivatized stFRET to a silicone rubber sheet
using StreptagII–Streptactin and stretched the sheet
equibiaxially on the fluorescence microscope. When
the C-terminal and N-terminal ends of stFRET were

derivatized so that it would be stretched with the sheet,
there was a reversible $ 11% decrease in the D ⁄ A
ratio (Fig. 8). As a control, we measured FRET from
stFRET that was derivatized at one end only so that it
was simply immobilized but not stretched and there
was no significant change in FRET with strain
(Fig. 8). Nonspecific binding of double-tagged stFRET
to an untreated silicone surface also produced no significant change in FRET with strain. Thus, stFRET is
sensitive to strain, as expected from the solution assays
and the design of the probe.
Eukaryotic expression and targeting property
of stFRET
Before inserting stFRET into host proteins, we placed
the gene under a eukaryotic promoter (human cytomegalovirus) and transiently transfected HEK cells
with stFRET alone. Control transfections with Venus
or Cerulean monomers showed no preferential localization and no obvious energy transfer (Fig. 9A–F).
Cells transfected with stFRET displayed significant
energy transfer (Fig. 9I). stFRET localized to the
nucleus with an extremely high density in the nucleoli
(Fig. 9K).
Nuclear targeting proteins have a consensus amino
acid sequence of lysine ⁄ arginine [K ⁄ R(4–6)] or smaller
clusters
separated
by
10–12
amino
acids:
[K ⁄ R(2)X(10–12)K ⁄ R(3)] [37]. The linker has multiple
arginine clusters similar to the nuclear targeting

sequence, but simply removing one or the other fluorophores from stFRET produced a uniform cytoplasmic
distribution showing that the linker’s sequence alone
was not sufficient for targeting. These unexpected
nuclear targeting properties of stFRET may provide

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3075


Mechanical stress sensor

F. Meng et al.

A

A

B

B

C

Fig. 3. FRET efficiency and D ⁄ A ratio (mean ± SD). (A) Spectra of
stFRET, Cerulean and Venus monomers and Cerulean and Venus in
a 1 : 1 mixture. Venus + Cerulean mixture, green filled squares.
Donor Cerulean, blue inverted triangles and line. Acceptor Venus,
black triangles and line. Pure stFRET protein, red filled circles and
line. (B) FRET efficiency and D ⁄ A ratio of stFRET with Cerulean

and Venus in a 1 : 1 mixture. Data were obtained with protein from
three separate purifications. CV is Cerulean and Venus in a 1 : 1
mixture. FT, stFRET. Excitation 433 nm; emission 460–550 nm.

a useful tool for understanding nuclear protein
transport.
Host proteins of stFRET with normal expression
showing stress sensitivity
We inserted stFRET into various host proteins, including COL-19 (Fig. 10G), nonerythrocyte spectrin
(Fig. 10E), filamin A (Fig. 10C), and a-actinin
(Fig. 10A), and expression systems including HEK-293,
3T3 and C. elegans, and the insertion locations were
optimized to obtain protein distributions similar to
those observed for the host protein C-terminus tagged
with GFP or Cerulean (Fig. 10B,D,F,H). Inserting
stFRET into host proteins eliminated nuclear targeting.
The fluorescence of stFRET in cultured cells was
3076

Fig. 4. Modification of the linker change FRET efficiency of six constructs. (A) Fluorescence spectra of stFRET and its five variants
(scan parameters as in Fig. 3). (B) FRET efficiency of the six constructs. (C) SDS ⁄ PAGE gel of the purified proteins, and Cerulean
and Venus monomers. FT stands for stFRET; 5T and 2.5T are constructs with five-turn or 2.5-turn deletions from the linker; 2.5I is
the construct with a 2.5-turn insert; FT1AA and FT2AA are the constructs with one amino acid or two amino acid deletions. All values
are means ± SD, and the data were obtained with proteins from
three separate purifications.

located in the cytoplasm and ⁄ or the cell membrane,
depending on the host (Fig. 10A,C,E). We expressed
the construct of the most abundant collagen in C.
elegans, COL-19, and the protein was properly assembled, showing the typical striated pattern, and the

worms behaved normally. When we stretched the worm
with micromanipulators, the labeled COL-19 showed a
decrease in FRET efficiency with stretch, and in convex
regions as it actively wiggled (Fig. 10G,H).
Figure 11 indicates that stFRET integrated into
actinin and filamin can sense tension in situ. Migrating

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works


F. Meng et al.

Mechanical stress sensor

Table 2. Values of parameters in Eqn (8) of six stFRET variants as described in Fig. 4.
Protein
constructs

Energy transfer
efficiency (E) (%)

r (linker length)
(nm)

Z (H ⁄ 2 of b-Can)
(nm)

hA (unknown
parameter 1)

hD (unknown
parameter 2)

U (unknown
parameter 3)

stFRET
5T
2.5T
2.5I
FT1AA
FT2AA

44
56
47
37
29
38

5.0
5.0
5.0
5.0
5.0
5.0

2.1
No change

hA
No change

hD
No change

U
U
U
U
U
U

±
±
±
±
±
±

2.5
4.5
2.1
0.9
7.1
4.3

– 2.7 = 2.3
– 1.35 = 3.65
+ 1.35 = 6.35

– 0.15 = 4.85
– 0.3 = 4.7

+
+
+
+

p
p
5p ⁄ 9
10p ⁄ 9

Fig. 5. Melting the linker. (A) Spectra from
stFRET treated with 1–8 M urea (scan
parameters as in Fig. 3B). (B) D ⁄ A ratio of
stFRET after treatment with different concentrations of urea (means ± SD, n = 3 in
each treatment); increasing D ⁄ A ratio indicates the recovery of donor emission and
decrease of energy transfer. (C) Cerulean
monomer fluorescence with urea treatments (scan parameters as in Fig. 3). (D)
Venus monomer fluorescence with urea
(excitation at 515 nm and scan 520–
600 nm). (E) Urea melts the linker and
leaves the donor and acceptor intact,
decreasing FRET energy transfer as donor
emission recoverers and D ⁄ A ratio increases
(definitions as in Fig. 2A).

3T3 cells have a characteristic leading and lagging
edge, and Fig. 11A–C shows the donor, acceptor and

FRET images from three confocal microscopy chan-

nels. stFRET was distributed evenly across the cytoplasm as visualized with a 16-color pseudocolor map
(Fig. 11C,D). Transfection with actinin–stFRET

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3077


Mechanical stress sensor

F. Meng et al.

Figure 11K is the FRET efficiency image in which
three domains were selected. The efficiency in the redoutlined domain is twice as high as that in the blue
and green domains (Fig. 11L). These data suggest that
tension in both actinin and filamin is lower in domains
close to the lagging edge (where adhesion to the substrate is released), and higher at the leading edge where
adhesions pull the cell forward.

A

Discussion

B

Fig. 6. a-Helix linker in stFRET is resistant to temperature melting.
(A) stFRET spectra obtained at 60 °C for 2 min, 60 °C for 5 min,
70 °C for 5 min and 80 °C for 5 min (scan parameters as in Fig. 3).

(B) stFRET D ⁄ A ratio after different temperature treatments
(means ± SD, n = 3 in each treatment). Temperatures are given in
degrees Celsius; roomtem, room temperature.

revealed that during migration, the lagging edge
showed higher energy transfer than the leading edge
(Fig. 11E,F), i.e. it was relaxed. We measured the efficiency of various domains in the lagging and leading
edges from 14 confocal image stacks. The lagging
edges (the red-outlined domain) nearly doubled the
FRET efficiency as compared to the leading edge
(blue- and green-outlined domains). Multiple cells had
the same behavior, but because of the complexity of
the various shapes it was difficult to arrive at any useful statistic for frequency. We have shown a typical
cell with different domains as an internal control. The
same phenomenon was observed in filamin–stFRETtransfected 3T3 cells (Fig. 11G–L). Figure 11G–I
shows three confocal image channels, and Fig. 11J is
the pseudocolor image of stFRET protein distribution.
3078

Designed to be an in situ stress sensor, stFRET has
robust and predictable energy transfer both in vitro
and in vivo. We were able to explore the geometry of
stFRET by perturbing the linker length and terminal
angles using the known properties of a-helices. FRET
efficiency changed in a predictable manner with the
postulated geometry, suggesting that the fluorophores
are not free to rotate. A recent molecular dynamics
simulation study of FRET in lysozyme found that j
and RO could be correlated by as much as 0.8, so that
FRET measurements that assume random rotational

freedom are likely to be in error [38]. The ability to
change angle and distance by varying the linker can be
used in vivo to examine the effect of host proteins on
probe geometry. Regardless of the coupling of the fluorophores to the linker, all of the host proteins that
we studied were coiled-coiled dimers or trimers, so that
the fluorophores of stFRET would not be able to
rotate freely.
Figure 2A shows the predicted mean structure of
free stFRET. The three unknown angles of Eqn (8)
(see Experimental procedures) were solved using data
for the six mutants using the least squares equation
solver in maple. The solutions were stable to perturbations of the starting values, suggesting that we were
measuring a constrained system. Our final solution was
hA = 3.83, hD = )0.78, and U = 1.97, yielding
j2 = 0.86. There will be bending and flexing motions
of the structure in solution, but we obtained consistent
answers from the overdetermined set of equations, suggesting that the calculated mean values are at least
self-consistent. The geometric values that we have calculated would represent mean values weighted by the
efficiency. Fluctuations that bring the dipoles closer
are more heavily weighted than those that move them
further away, although the probability of occupancy of
these conformations is another weighting factor. A
detailed molecular dynamics simulation would be useful, but is not essential for the use of stFRET as a
probe of molecular stress, as the most important variables are the differences in efficiency, i.e. the gradients
of stress.

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works


F. Meng et al.

Mechanical stress sensor

A

B

C

D

Fig. 7. Two units of proteinase K
(1 unitỈlL)1) digests the linker but not
Cerulean or Venus. (A, C, D) Spectra of
stFRET protein (A), Cerulean (C) and Venus
(D) digested for 20 s, 1 min, 2 min, 3 min,
5 min, 10 min, 15 min and 30 min at room
temperature with 200 lL of 100 lM protein.
(B) Time course of D ⁄ A ratio for proteinase K digestion of stFRET. (E) Proteinase K
cleaved the linker and eliminated FRET
in stFRET protein. PK, proteinase K; S,
seconds; M, minutes; n = 3.

The robust nature of stFRET was clear from the
melting experiments. stFRET was thermally stable up
to at least 80 °C, with the FRET efficiency being virtually unchanged. Melting the linker with urea (Fig. 5)
[39] left the fluorophores untouched (Fig. 5C,D), but
decreased the energy transfer, consistent with unfolding of the linker (Fig. 5B,E). Two models have been
proposed for urea-induced protein denaturation: the
binding model, in which the denaturant binds weakly

but specifically to sites exposed by the unfolded proteins [40], and a solvent exchange model, in which the
interaction of the solvent and the denaturant is a onefor-one substitution reaction at particular sites [41].
stFRET might serve as a useful probe to examine these
alternatives.
The sensitivity of stFRET to protease cleavage has
both positive and negative implications. If proteases
are accidentally present in situ, they could cleave

E

Proteinase K

stFRET and provide misleading results. We saw no
evidence of protease activity in HEK or 3T3 cells
or C. elegans. However, the presence of intracellular
proteases has been associated with acute pancreatitis,
proposed to arise from trypsin overactivation in
large endocytotic vacuoles of acinar cells [42]. Thus, to
study pancreatitis, stFRET may be a useful probe
(Fig. 7).
Having established the basic physical properties of
stFRET, we expressed it in HEK cells (Fig. 9) and
evaluated the energy transfer by Xia’s method [43],
using confocal microscopy. The surprising localization
of stFRET to the nucleus was proved not to be a
result of the linker possessing a consensus nuclear targeting sequence, as deletion of either fluorophore from
the construct destroyed localization. This adaptability
suggests that stFRET can serve as a useful probe of
nuclear targeting.

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3079


Mechanical stress sensor

F. Meng et al.

100 mmHg
1s

3.0

FRET ratio

11%
2.5

2.0

1.5

Untreated - double Strep-Tag2
Strep-tactin treated - double Strep-Tag2
Strep-tactin treated - single Strep-Tag2

Fig. 8. Double Streptag II-tagged stFRET shows a decrease in
FRET ratio when stretched on silicone rubber disks. Single and double Streptag II-tagged stFRETs were allowed to bind to either
untreated or Strep-tactin-modified silicone disks. The FRET ratio

was monitored in 10 spots on each disk during application of the
suction stimulus shown. Only the disks with Strep-tactin-treated
surfaces and stFRET proteins with Streptag tags at both the C-terminus and N-terminus showed a significant change in FRET ratio
when stretched.

Knowing how native stFRET itself distributes,
we incorporated it into host proteins, including
nonerythrocyte spectrin, filamin A and a-actinin
(Fig. 10A,C,E) in 3T3 cells, and COL-19 in C. elegans
(Fig. 10G). The distribution of the probe depended
upon where the cassette was placed within the host.
When it was inserted towards the middle, the fluorescence distribution appeared similar to that of the host
protein tagged with GFP or cyan fluorescent protein
(CFP) at the C-terminus (Fig. 10B,D,F,H). Insertion
of the cassette towards the termini of the host led to
different spatial distributions. There is no gold standard for the proper localization of proteins in cells, as
fixation and exposure to various tracer ligands can
produce changes in structure, but, to first order, the
stFRET probes placed in the middle of the hosts
appeared to cause minimal perturbation.
Under physiological conditions, FRET efficiency
varied in different regions of the cells (Fig. 11), and
these seemed to be correlated with the anticipated
distribution of stress. Efficiency should be reduced
when the host is under tension. Actinin–stFRET and
filamin–stFRET generally showed lower efficiency than
free stFRET (Fig. 3B), suggesting that those proteins
were normally under tension (Fig. 11E,F,K,L, green-

A

B

C

D

E

F

G

I

J

3080

H

K

L

Fig. 9. stFRET expressed in HEK-293 cells
exhibits efficient FRET. (A–C) Confocal reference image of Cerulean taken from the CFP
channel (A) and the DIC channel (B), with
the overlap in (C). (D–F) Reference image of
Venus from the YFP (D) and DIC channels

(E), with the overlap in (F). (G–K) Images of
stFRET using the CFP channel (G), YFP
channel (H), FRET channel (I) and DIC channel (J), with the overlap of these four channels in (K). (L) The vFRET index was
calibrated pixel by pixel using Xia’s method
[43]. Hollow black regions were excluded
from the calculation because of intensity
saturation. stFRET is localized in the nucleus
and especially concentrated in the nucleoli
(arrowheads).

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works


F. Meng et al.

Mechanical stress sensor

A

B

C

D

E

F

G

H

efficiency associated with increased tension in the leading edge as the cell was pulled forward.
To turn stFRET from a strain sensor into a stress
sensor, we need to measure its force–distance properties.
At the current time, we only have estimates from published atomic force microscopy data on the stretching
of the coiled-coil myosin II [44]. Schweiger et al. [45]
obtained a three-phase force–distance relationship: a
linear phase of $ 1 mNỈm)1, a plateau of $ 25 pN, and
a wormlike chain phase as the helices were stretched
closer to the contour length. The presence of a force
plateau implies that if monomeric stFRET was subjected to a force of > 10–25 pN, it would unfold in an
all-or-none manner for about 3 nm, producing a large
drop in FRET. We do not see this, probably in part
because the in situ probes are not homomers, but are
coiled coils where the stress is shared with labeled and
unlabeled neighbors. It may be possible to knock down
the background hosts to at least create homogeneously
labeled hosts. In addition, stress is shared between
different proteins within the cell, and at the current
time, we are only probing one of those components.
stFRET can be applied to any biological system
with large covalently bonded proteins. It is possible to
examine the role of stress in selected proteins within
cells or even within free-ranging organisms. With
organ targeting in small organisms such as C. elegans
and zebrafish, it should be possible to develop highcontrast video images of specific parts of the organism
during controlled or natural behavior. We look forward to finding out how mechanical stress is coupled
to biochemistry and to cell biology.

Experimental procedures
Gene construction and protein purification
Fig. 10. Normal expression of stFRET in various host proteins.
a-Actinin–stFRET (A), a-actinin–GFP (B), filamin A–stFRET (C), filamin A–CFP (D), spectrin–stFRET (E) and spectrin–CFP (F) in 3T3 fibroblast cells; Collagen-19–stFRET (G) and COL-19–GFP (H) in
C. elegans (with assistance of R. Gronostajski; Biochemistry
Department, State University of New York at Buffalo, NY, USA).
Arrowheads indicate the striated expression pattern and central line
in the worm cuticle.

line and blue-line domains). However, as cells migrate,
the stress in the leading and trailing edges changes.
Connections to the extracellular matrix in the lagging
edge must be disengaged and the connections at the
leading edge put under tension. Figure 11E,F,K,L
shows increased FRET efficiency in the lagging edge
as the filopodia were released from the substrate and
tension decreased (red-line domains), and decreased

pEYFP-C1 Venus and pECFP-C1 Cerulean plasmids were
generous gifts from D. W. Piston (Department of Molecular
Physiology and Biophysics, Vanderbilt University Medical
Center, Nashville, TN, USA) [45]. The Cerulean gene was
subcloned
from
pECFP-C1
with
the
primers
5¢-GCAGGTGTGAATTCCATGGTGAGCAAGGGCGAG

GAGC-3¢ and 5¢-CCAGATCGCGGCCGCCTTGTACAG
CTCGTCATGCCGAGAG-3¢; EcoRI and ApaI restriction
enzyme sites were introduced into the 5¢-end and 3¢-end of
the Cerulean DNA fragment. This DNA fragment was
inserted into multiple cloning sites of pEYFP-C1 Venus by
EcoRI and ApaI digestion and ligation. The resulting vector
has Venus followed closely by Cerulean, and between them
there are two restriction enzyme sites, BglII and EcoRI,
which then were employed to insert the a-helix linker. The
a-helix linker DNA, 5¢-GGCCTGCGCAAGCGCTTACG

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3081


Mechanical stress sensor

F. Meng et al.

A

B

C

D

E

F

G

H

I

J

K

L

Fig. 11. stFRET senses the strain change in actinin and filamin. Actinin–stFRET-transfected 3T3 fibroblast confocal images were taken in
three channels: (A) CFP donor channel, (B) FRET channel, and (C) YFP acceptor channel. Actinin–stFRET protein expression levels were
displayed by applying the IMAGE J lookup table (LUT) 16-color color map to the YFP acceptor channel image. Arrows show the leading edge,
lagging edge, and the cell domains with missing filopodia (D). FRET efficiency was calculated by E = nF ⁄ (nF + ID), in which nF is the net
FRET from the FRET channel, and ID is the donor intensity from the donor channel. (E) The E-value was shown by the IMAGE J LUT 16-color
color map. (F) Three cell domains were selected for statistical analysis of E, and 14 confocal stacks of each domain were measured
and analyzed. (G–L) Histogram bars have the same colors as the related domains in (E). Filamin–stFRET confocal images. Three scan
channels (G, H, I) are as for actinin–stFRET images. Arrangements and statistics of filamin–stFRET images (J, K, L) are as for actinin–stFRET
images.

3082

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works


F. Meng et al.

AAAATTTAGAAACAAGATTAAAGAAAAGCTTAAA
AAAATTGGTCAGAAAATCCAGGGTTTCGTGCCGAA
ACTTGCAGGTGT-3¢, was synthesized by Operon (Huntsville, Alabama, USA) and amplified by PCR, and BglII and
EcoRI sites were introduced into the 5¢-end and 3¢-end. The
final construct with a-helix connecting Venus and Cerulean
was named stFRET and was ready for eukaryotic expression. In order to purify the protein, stFRET gene was
subcloned into the prokaryotic expression vector
PinPoint Xa-3 (Promega, Madison, WI, USA), using
BamHI and NotI restriction sites, which were introduced
into FRET DNA fragment by using the following primers: 5¢-GCTTCAGCTGGGATCCGGTGGTATGGTGAG
CAAGG-3¢; and 5¢-CCAGATCGCGGCCGCTTAGTGG
TGATGATGGTGGTGATGATGCTTGTACAGCTCGT
CC-3¢. Following the His8-tag, a TAA stop codon was
inserted in front of the NotI site, to ensure that the His-tag
was located in the C-terminus and was well exposed to the
solution. By modifying the linker in PinPoint–stFRET constructs, we created five other constructs and named them on
the basis of the modification. They are: 5T, with five turns
of the peptide chain truncated off the a-helix; 2.5T, with 2.5
turns truncated off; 2.5I, with 2.5 turns of the linker
duplicated and inserted back into the a -helix; and FT1AA
and FT2AA, with one and two amino acid residues
deleted from the linker. The primers used for PCR were as
follows: 5T sense primer, 5¢-GCGCAAGCGCTTACGAA
AATTCGTGCCGAAACTTGCA-3¢; 5T antisense primer,
5¢-TTTTCGTAAGCGCTTGCGCTGCAAGTTTCGGCAC
GAA-3¢; 2.5T sense primer, 5¢-GCGCAAGCGCTTACG
ACTTAAAAAAATTGGTCAGAAAATCCAGG-3¢; 2.5T
antisense primer, 5¢-CCTGGATTTTCTGACCAATTTTT
TTAAGTCGTAAGCGCTTGCGC-3¢; 2.5I sense primer,

5¢-GAAACAAGATTAAAGAAAAGAAAATTTAGAAAC
AAGATTAAAGAAAAGCTTAAAAAAATTGGTCAGA
AAATC-3¢; 2.5I antisense primer, 5¢-GATTTTCTGAC
CAATTTTTTTAAGCTTTTCTTTAATCTTGTTTCTAA
ATTTTCTTTTCTTTAATCTTGTTTC-3¢; FT1AA sense
primer,
5¢-GATTAAAGAAAAGCTTAAAATTGGTCA
GAAAATCC-3¢; FT1AA antisense primer, 5¢-GGA
TTTTCTGACCAATTTTAAGCTTTTCTTTAATC-3¢;
FT2AA sense primer, 5¢-CAAGATTAAAGAAAAGCT
TATTGGTCAGAAAATCC-3¢; FT2AA antisense primer,
5¢-GGATTTTCTGACCAATAAGCTTTTCTTTAATCT
TG-3¢. All the insertions and deletions were performed
with a site-directed mutagenesis kit from Stratagene (La
Jolla, CA, USA). As host proteins for stFRET, the COL-19
gene was subcloned into the Pinpoint Xa-3 vector, and the
filamin A, a-actinin and nonerythrocytic spectrin genes were
subcloned into the pEYFP-C1 vector in which the yellow
fluorescent protein (YFP) gene was deleted. Different
sites in these host proteins were tested to maximally
retain their function after integrating stFRET into them. All
constructs were confirmed by sequencing data from Roswell
Park Cancer institute (Buffalo, NY, USA).

Mechanical stress sensor

Plasmid DNA of six proteins constructs and Venus and
Cerulean monomers were transformed into Escherichia coli
cells [BL21(DE3pLacI) from Novagen, Gibbstown, NJ,
USA] for expression. Proteins were purified as previously

described [45]. Five hundred milliliters of LB broth containing 50 mgỈmL)1 ampicillin was inoculated with 5 mL of
overnight cell culture from a single colony of each construct.
Cells were cultured at 37 °C and with 250 r.p.m orbital
shaking until the attenuance value reached 0.6. Isopropyl
thio-b-d-galactoside (1 mm final concentration) (Sigma, St
Louis, MO, USA) was applied to the culture to induce protein expression, and the temperature was adjusted to 30 °C
for overnight expression. The cells were harvested by centrifugation at 4000 g for 10 min at 4 °C. The pellets were
stored at )20 °C for later use, or used immediately for the
lysis step. Five milliliters of bugbuster protein extraction
reagent (Novagen) containing 25 unitsỈmL)1 Benzonase
(Novagen), 1000 unitsỈmL)1 rLysozyme(Sigma), 1 mm phenylmethylsulfonyl fluoride, 10 lgỈmL)1 pepstatin and
20 lgỈmL)1 leupeptin was used for protein extraction from
each gram cell pellet. Cells were kept at room temperature
for 30 min for the lysis. Soluble proteins were separated by
centrifuging for 30 min at 10 000 g at 4 °C. Ni–nitrilotriacetic acid His-tag elution buffer (250 mm imidazole, 300 mm
NaCl, 50 mm Na2HPO4, 0.2% Tween-20, pH 8.0) was
added to the protein solution to give a final concentration
of imidazole of 20 mm. One milliliter of Ni–nitrilotriacetic
acid His.bind slurry (Novagen) was used per 4 mL of clear
lysate, and gently mixed by shaking at 4 °C for 60 min. The
solution was loaded on a column and washed with 10 bed
volumes of washing buffer (20 mm imidazole, 300 mm
NaCl, 50 mm Na2HPO4, 0.2% Tween-20, pH 8.0) by gravity flow. Proteins retained on the column were washed off
with elution buffer. The protein concentration was determined with a bicinchoninic acid protein kit (Pierce, Rockford, IL, USA) and measured with an ND-1000
spectrophotometer (Nanodrop, Wilmington, DE, USA).
SDS ⁄ PAGE analysis was used to check the protein purity.
Proteins with > 95% purity were used for further assays;
otherwise, proteins were dialyzed against Tris ⁄ HCl buffer
(10 mm Tris ⁄ HCl, 1 mm dithiothreitol, 50 mm NaCl, 0.2%
Tween-20, pH 7.4), and then the Ni–nitrilotriacetic acid

His-tag purification procedure was repeated to achieve a
purity of 95%. All purified proteins were finally exchanged
into 10 mm Tris ⁄ HCl buffer with a Spectra ⁄ Pro Dispodyalyzer (Spectrum, relative molecular mass cut-off 10 000) for
further spectroscopy measurements.

Cell culture and transfection
HEK-293 and 3T3 fibroblast cells were cultured in DMEM
(Gibco, Gaithersburg, MD, USA) supplemented with 10%
fetal bovine serum and antibiotics. Cells were spread on
3.5 mm coverslips and allowed to grow for 24 h, and
1.0 lg of plasmid DNA for each coverslip was delivered

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3083


Mechanical stress sensor

F. Meng et al.

into cells with a Fugene6 kit (Roche, Indianapolis, IN,
USA). After 24–36 h of growth, cells displaying significant
fluorescent protein expression were used for confocal
microscopy.

Confocal microscopy and data analysis
Cerulean-, Venus- and stFRET-transfected HEK cells were
visualized with an LSM510 META confocal microscope
(Carl Zeiss, Jena, Germany) 48 h after transfection. Ar

laser (458 and 514 nm) lines were employed for excitation
of FRET donor and acceptor. One multichannel stack of
the confocal images of Cerulean, Venus and FRET was
obtained with an oil-merged 63·, 1.4 numerical aperture
apochromat objective lens (Carl Zeiss) and CFP, YFP or
FRET filter sets; meanwhile, differential interference contrast (DIC) images were taken. The sensitized emission
method was used to collect the images from the donor
channel, acceptor channel and FRET channel. Data acquisition and processing were performed with FRET plus
macro with Xia’s method [43]. The normalized FRET index
was calculated pixel by pixel with the equation
NFRET ¼

IFRET À IYFP Â a À ICFP Â b
pffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
IYFP Â ICFP

in which the numerator is the net fluorescence energy transfer nFRET and constants a and b are the ratios of bleedthrough of the YFP signal into the FRET channel and the
CFP signal into the FRET channel [46].

ð2Þ

In Eqn (1), IDFree was obtained from a Cerulean ⁄ Venus
1 : 1 mixture, and IDA is the fluorescence intensity of the
donor when it is linked to the acceptor; in Eqn (2), ID is
the donor emission at 475 nm, and IA is the acceptor emission at 527 nm. Excitation and emission wavelengths for
data acquisition are shown in parentheses.

Modeling and calibration
For an a-helix, deletion of one amino acid changes the
length by 0.15 nm and the angle between the termini by

100°. Assuming that the cassette was a rigid body, we made
six mutants that would have known spacing and angles to
calculate the probe geometry. Figure 1 is a diagram of
stFRET geometry as deduced from the following proce!
!
dure. H C is the donor dipole vector and G B is the
!
acceptor dipole vector. RD–A (B C ) is the distance between
!
donor and acceptor, and r (GH ) is the length of the linker.
hA is the angle between the acceptor and the linker axis,
and hD is the angle between donor and linker axis. hT is the
angle between the acceptor and donor. U is the dihedral
angle between plane (D. r) and plane (A. r). In the dia!
!
gram, B I is equal and parallel to F E , and both are perpen! !
! !
dicular to line GH . B F is parallel and equal to I E . C E is
!
also perpendicular to E I . Let CH = GB = Z; then Z is
the half-height of the Cerulean and Venus b-cans. After

some trigonometry and algebra, we found that:
ỵ 2rZcoshD ỵ coshA ị ỵ r 2

We used a uorescence spectrometer (Aminco, Bowman
Series 2) to measure the fluorescence of purified proteins in
solution. All purified proteins were exchanged into 10 mm
Tris ⁄ HCl buffer before processing. The efficiency was usually measured at room temperature with 200 lL of 100 lm
protein. The spectrometer was set as follows: bandpass,

4 nm, 1 nm step size, and emission scan range 450–550 nm
for measuring FRET, 450–500 nm for Cerulean monomer,
and 520–600 nm for Venus monomer. Cerulean excitation
was at 433 nm and Venus excitation was at 515 nm.

FRET efficiency
We used two indexes of energy transfer; first [47]:
IDFreeð475Emission;433ExcitationÞ À IDAð475Emission;433ExcitationÞ
IDFreeð475Emission;433ExcitationÞ
ð1Þ
in which IDFree is the signal intensity of free donor, and
IDA is the donor fluorescence intensity when connected to
acceptor, and second [48]:

3084

ID475Emission;433Excitationị
IA527Emission;433Excitationị

RAD ẳ 2Z 2 1 sinhA sinhD cos/ ỵ coshA coshD ị

In vitro uorescence energy transfer
measurement

Eẳ

D=ARatio ẳ

3ị

The relative orientation factor j2 and coshT are defined
in [49] as:
j2 ẳ coshT 3coshD coshA ị2

4ị

coshT ẳ sinhD sinhA cos/ỵcoshD coshA

ð5Þ

The distance Ro, at which E = 50%, is given implicitly
by [50]:
Z
9000ln10ịj2 /d 1
R6 ẳ
f kịekịk4 dk ẳ j2 C
6ị
o
128p5 Nn4
0
where C is a constant characteristic of the spectral properties of Cerulean and Venus and Ro = 4.9 nm [34], so that
C = Ro6 ⁄ (2 ⁄ 3) = 4.96 (2 3). As

Eẳ

R6
o
R6 ỵ RAD 6
o

7ị

substituting Eqns (3,4,5,6) into Eqn (7) yielded:

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works


F. Meng et al.

EstFRET ¼

Mechanical stress sensor

ðsinhD sinhA cos/À2coshD coshA ị2 C
sinhD sinhA cos/2coshD coshA ị2 C ỵ ẵZsinhD ị2 þ ðZsinhA Þ2 À 2Z2 sinhD sinhA cos/þðr þ ZcoshA þZcoshD Þ2 Š3
ð8Þ

There are only three unknowns in Eqn (8), hA, hD and
U, which determine the orientation factor j2 as well as the
global configuration of the protein. With six linker mutants,
we had six equations to calculate the three unknowns,
which we did with a least squares solution in maple.

Testing of the linker in purified stFRET
Purified proteins were subjected to proteinase K digestion,
temperature and or urea melting. One unit of proteinase K
(500 unitsỈmL)1) was used to digest 200 lL of protein solution (100 lm) in Hepes buffer (100 mm Hepes, 100 mm
NaCl, 10 mm Na2HPO4, pH 7.4) for 20 s, 1 min, 2 min,
5 min, 10 min or 30 min. Cerulean and Venus monomers
were also treated with proteinase K under the same conditions as used for controls. For urea treatment, we used

10 lL of protein (10 mgỈmL)1 in 10 mm Tris ⁄ HCl buffer)
diluted into 200 lL of 8 m, 7 m, 6 m, 5 m, 4 m, 3 m, 2 m,
1 m of Hepes buffer or Hepes buffer only, and incubation
at room temperature for 10 min. Thermal melting was done
by heating the stFRET solutions to 60 °C, 70 °C and 80 °C
for 2–5 min and immediately measuring the fluorescence
energy transfer with a spectrometer.

Stretching stFRET on a silicone rubber sheet
Silicone rubber disks with amino modified surfaces (Flexcell
International, Hillsborogh, NC, USA) were converted to
carboxyl groups with 0.1 mm methyl N-succinimidyl adipate in NaCl ⁄ Pi for 1 h at room temperature. These groups
were converted to crosslinkers by treating them with 2 mm
1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride and 5 mm N-hydroxysuccinimide in 0.1 m Mes buffer
(pH 6) for 15 min. Strep-tactin (a streptavidin variant;
IBA, St Louis, MO, USA) at 1 mgỈmL)1 in NaCl ⁄ Pi was
then crosslinked to the surface for 2 h at room temperature.
Derivatized stFRET proteins were constructed with
Streptag II linked to the C-terminaus for single-tagged
stFRET and to the C-terminus and N-terminus for doubletagged stFRET. These proteins were allowed to bind overnight to untreated and to Strep-tactin-modified disks in
NaCl ⁄ Pi ⁄ 0.05% Tween-20 ⁄ 1% BSA. The disks were then
washed three times for 2 h with NaCl ⁄ Pi ⁄ 0.05% Tween20 ⁄ 1% BSA. Membranes were placed on a modified StageFlexer (Flexcell International, Hillsborogh, NC, USA),
which allowed us to apply equibiaxial strain to the disks

with suction from an HSPC-1 Pressure Clamp (ALA
Instruments, Westbury, NY, USA) controlled by Axon
Instruments pclamp software (Molecular Devices, Sunnydale, CA, USA). Application of )200 mmHg of suction
produced 10–15% strain (strained diameter ⁄ initial diameter). CFP–YFP emission intensities were monitored on
an Axiovert 135 microscope (Zeiss) equipped with a DualView DV-CC beam splitter (Photometrics, Ottobrunn,
Germany) with CFP–YFP splitter optics and an iXon DV887 EM cooled CCD camera (Andor, UK). The FRET

ratio was determined using imagej software (NIH) to analyze and process the video data of the stretched membrane.
FRET ratio = (I535 – I535 CFP Bleed) ⁄ I470, where I470 =
emission intensity at 470 nm, I535 = emission intensity at
535 nm, and I535 CFP Bleed = calculated fractional bleed of
CFP fluorescence (0.9 · I470) into the 535 nm channel.
The equibiaxial strain was measured by placing fiducial
marks on the rubber and measuring the resulting strain.

Acknowledgements
We acknowledge the assistance of the Confocal Microscope and Flow Cytometry Facility in the School of
Medicine and Biomedical Sciences, University at
Buffalo, and Mr Jeff Niggel for assistance with the
spectrofluorometer. We thank Dr Richard M. Gronostajski and Dr Elena Lazakovitch for helping us to
make transgenic worms. This work was supported by
the NIH.

References
1 Ortiz V, Nielsen SO, Klein ML & Discher DE (2005)
Unfolding a linker between helical repeats. J Mol Biol
349, 638–647.
2 Craig D, Gao M, Schulten K & Vogel V (2004) Structural insights into how the MIDAS ion stabilizes integrin binding to an RGD peptide under force. Structure
12, 2049–2058.
3 Kosztin I, Bruinsma R, O’Lague P & Schulten K (2002)
Mechanical force generation by G proteins. Proc Natl
Acad Sci USA 99, 3575–3580.
4 Marszalek PE, Lu H, Li H, Carrion-Vazquez M, Oberhauser AF, Schulten K & Fernandez JM (1999)
Mechanical unfolding intermediates in titin modules.
Nature 402, 100–103.

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3085


Mechanical stress sensor

F. Meng et al.

5 Carter NJ & Cross RA (2006) Kinesin’s moonwalk.
Curr Opin Cell Biol 18, 61–67.
6 Gosse C & Croquette V (2002) Magnetic tweezers:
micromanipulation and force measurement at the
molecular level. Biophys J 82, 3314–3329.
7 Wang MD, Yin H, Landick R, Gelles J & Block SM
(1997) Stretching DNA with optical tweezers. Biophys J
72, 1335–1346.
8 Brown AEX, Litvinov RI, Discher DE & Weisel JW
(2007) Forced unfolding of coiled-coils in fibrinogen by
single-molecule AFM. Biophys J 92, L39–L41.
9 Lu ZY, Nowak W, Lee GR, Marszalek PE & Yang
WT (2004) Elastic properties of single amylose chains in
water: a quantum mechanical and AFM study. J Am
Chem Soc 126, 9033–9041.
10 Walther KA, Brujic J, Li H & Fernandez JM (2006)
Sub-angstrom conformational changes of a single molecule captured by AFM variance analysis. Biophys J 90,
3806–3812.
11 Sarkar A, Caamano S & Fernandez JM (2005) The
elasticity of individual titin PEVK exons measured by
single molecule atomic force microscopy. J Biol Chem
280, 6261–6264.

12 Li H & Fernandez JM (2003) Mechanical design of the
first proximal Ig domain of human cardiac titin revealed
by single molecule force spectroscopy. J Mol Biol 334,
75–86.
13 Lele TP, Sero JE, Matthews BD, Kumar S, Xia S,
Montoya-Zavala M, Polte T, Overby D, Wang N &
Ingber DE (2007) Tools to study cell mechanics and
mechanotransduction. Cell Mechanics 83, 443–472.
14 Matthews BD, Thodeti CK & Ingber DE (2007) Activation of mechanosensitive ion channels by forces transmitted through integrins and the cytoskeleton.
Mechanosensitive Ion Channels A 58, 59–85.
15 Discher DE, Boal DH & Boey SK (1998) Simulations
of the erythrocyte cytoskeleton at large deformation. II.
Micropipette aspiration. Biophys J 75, 1584–1597.
16 Boey SK, Boal DH & Discher DE (1998) Simulations
of the erythrocyte cytoskeleton at large deformation. I.
Microscopic models. Biophys J 75, 1573–1583.
17 Discher DE, Mohandes N & Evans EA (1994) Molecular maps of red cell deformation: hidden elasticity and
in situ connectivity. Science 266, 1032–1036.
18 Hudspeth AJ, Choe Y, Mehta AD & Martin P (2000)
Putting ion channels to work: mechanoelectrical transduction, adaptation, and amplification by hair cells.
Proc Natl Acad Sci USA 97, 11765–11772.
19 Gillespie PG & Walker RG (2001) Molecular basis of
mechanosensory transduction. Nature 413, 194–202.
20 Acher R (2002) Water homeostasis in the living: molecular organization, osmoregulatory reflexes and evolution. Ann D Endocrinol 63, 197–218.
21 Pajerowski JD, Dahl KN, Zhong FL, Sammak PJ &
Discher DE (2007) Physical plasticity of the nucleus in

3086

22

23

24

25

26

27

28

29

30

31

32

33

34

35

stem cell differentiation. Proc Natl Acad Sci USA 104,
15619–15624.
Rief M, Clausen-Schaumann H & Gaub HE (1999)

Sequence-dependent mechanics of single DNA molecules. Nat Struct Biol 6, 346–349.
Clausen-Schaumann H, Rief M, Tolksdorf C & Gaub
HE (2000) Mechanical stability of single DNA molecules. Biophys J 78, 1997–2007.
Inai T, Mancuso MR, McDonald DM, Kobayashi J,
Nakamura K & Shibata Y (2004) Shear stress-induced
upregulation of connexin 43 expression in endothelial
cells on upstream surfaces of rat cardiac valves. Histochem Cell Biol 122, 477–483.
Papadaki M & Eskin SG (1997) Effects of fluid shear
stress on gene regulation of vascular cells. Biotechnol
Prog 13, 209–221.
Garcia-Perez AI, Lopez-Beltran EA, Kluner P, Luque
J, Ballesteros P & Cerdan S (1999) Molecular crowding
and viscosity as determinants of translational diffusion
of metabolites in subcellular organelles. Arch Biochem
Biophys 362, 329–338.
Erickson MG, Alseikhan BA, Peterson BZ & Yue DT
(2001) Preassociation of calmodulin with voltage-gated
Ca(2+) channels revealed by FRET in single living
cells. Neuron 31, 973–985.
Tolar P, Sohn HW & Pierce SK (2005) The initiation of
antigen-induced B cell antigen receptor signaling viewed
in living cells by fluorescence resonance energy transfer.
Nat Immunol 6, 1168–1176.
Joo C, McKinney SA, Nakamura M, Rasnik I, Myong
S & Ha T (2006) Real-time observation of RecA filament dynamics with single monomer resolution. Cell
126, 515–527.
Qiao W, Mooney M, Bird AJ, Winge DR & Eide DJ
(2006) Zinc binding to a regulatory zinc-sensing domain
monitored in vivo by using FRET. Proc Natl Acad Sci
USA 103, 8674–8679.

Ha T, Rasnik I, Cheng W, Babcock HP, Gauss GH,
Lohman TM & Chu S (2002) Initiation and re-initiation
of DNA unwinding by the Escherichia coli Rep helicase.
Nature 419, 638–641.
Chen C, Brock R, Luh F, Chou PJ, Larrick JW, Huang
RF & Huang TH (1995) The solution structure of the
active domain of CAP18 – a lipopolysaccharide binding
protein from rabbit leukocytes. FEBS Lett 370, 46–52.
Forster T (1949) Experimentelle und theoretische Ună
tersuchung des zwischenmolekularen Ubergangs von
Elektronenanregungsenergie. Z Naturforsch A 4, 321–
327.
Patterson GH, Piston DW & Barisas BG (2000) Forster
distances between green fluorescent protein pairs. Anal
Biochem 284, 438–440.
Courtenay ES, Capp MW, Saecker RM & Record MT
Jr (2000) Thermodynamic analysis of interactions
between denaturants and protein surface exposed on

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works


F. Meng et al.

36

37

38

39

40
41

42

unfolding: interpretation of urea and guanidinium chloride m-values and their correlation with changes in
accessible surface area (ASA) using preferential interaction coefficients and the local-bulk domain model. Proteins (Suppl. 4), 72–85.
Tezuka-Kawakami T, Gell C, Brockwell DJ, Radford
SE & Smith DA (2006) Urea-induced unfolding of the
immunity protein Im9 monitored by spFRET. Biophys
J 91, L42–L44.
Christophe D, Christophe-Hobertus C & Pichon B
(2000) Nuclear targeting of proteins: how many different signals? Cell Signalling 12, 337–341.
Vanbeek DB, Zwier MC, Shorb JM & Krueger BP
(2007) Fretting about FRET: correlation between
{kappa} and R. Biophys J 92, 4168–4178.
Scholtz JM, Barrick D, York EJ, Stewart JM & Baldwin RL (1995) Urea unfolding of peptide helices as a
model for interpreting protein unfolding. Proc Natl
Acad Sci USA 92, 185–189.
Schellman JA (1987) Selective binding and solvent
denaturation. Biopolymers 26, 549–559.
Schellman JA (1990) A simple model for solvation in
mixed solvents. Applications to the stabilization and
destabilization of macromolecular structures. Biophys
Chem 37, 121–140.
Sherwood MW, Prior IA, Voronina SG, Barrow SL,
Woodsmith JD, Gerasimenko OV, Petersen OH & Tepikin AV (2007) Activation of trypsinogen in large endocytic vacuoles of pancreatic acinar cells. Proc Natl Acad
Sci USA 104, 5674–5679.

Mechanical stress sensor

43 Xia Z & Liu Y (2001) Reliable and global measurement
of fluorescence resonance energy transfer using fluorescence microscopes. Biophys J 81, 2395–2402.
44 Schwaiger I, Sattler C, Hostetter DR & Rief M (2002)
The myosin coiled-coil is a truly elastic protein structure. Nat Materials 1, 232–235.
45 Rizzo MA, Springer GH, Granada B & Piston DW
(2004) An improved cyan fluorescent protein variant
useful for FRET. Nat Biotechnol 22, 445–449.
46 Youvan DC, Silva CM, Bylina EJ, Coleman WJ, Dilworth MR & Yang MM (1997) Calibration of fluorescence resonance energy transfer in microscopy using
genetically engineered GFP derivatives on nickel chelating beads. Biotechnol Alia 3, 1–18.
47 Gordon GW, Berry G, Liang XH, Levine B & Herman
B (1998) Quantitative fluorescence resonance energy
transfer measurements using fluorescence microscopy.
Biophys J 74, 2702–2713.
48 Yudushkin IA, Schleifenbaum A, Kinkhabwala A, Neel
BG, Schultz C & Bastiaens PI (2007) Live-cell imaging
of enzyme–substrate interaction reveals spatial regulation of PTP1B. Science (NY) 315, 115–119.
49 Dale RE, Eisinger J & Blumberg WE (1979) The orientational freedom of molecular probes. The orientation
factor in intramolecular energy transfer. Biophys J 26,
161–193.
50 Forster VT (1948) Zwischenmolekulare energiewanderung und fluoreszenz. Ann Phys 6, 54–75.

FEBS Journal 275 (2008) 3072–3087 Journal compilation ª 2008 FEBS. No claim to original US government works

3087