Báo cáo khoa học: Structural and functional insights into Erwinia carotovora L-asparaginase ppt

Structural and functional insights into Erwinia carotovora
L-asparaginase
Anastassios C. Papageorgiou
1
, Galina A. Posypanova
2
, Charlotta S. Andersson
1
,
Nikolay N. Sokolov
3
and Julya Krasotkina
3
1 Turku Centre for Biotechnology, University of Turku and A
˚
bo Akademi University, Finland
2 Institute of Molecular Medicine, Russian Academy of Medical Sciences, Moscow, Russia
3 Institute of Biomedical Chemistry, Russian Academy of Medical Sciences, Moscow, Russia
l-Asparaginases (EC 3.5.1.1) are enzymes that primar-
ily catalyze the conversion of l-asparagine to l-Asn
and ammonia, and to a lesser extent the hydrolysis of
l-Gln to l-Glu. Two types of bacterial l-asparaginase
have been identified, namely type I and type II [1].
Type I asparaginases are expressed constitutively in
the cytoplasm and characterized by enzymatic activity
for both l-Asn and l-Gln. Type II asparaginases are
expressed under anaerobic conditions in the periplas-
mic space of the bacterial membranes and display
high specific activity against l-Asn. Type II asparagin-
ases, in particular, display antitumor activity and are
used as chemotherapeutics in acute lymphoblastic leu-

kemia [2–4]. The antileukemic effect of l-asparaginas-
es is believed to result from the depletion of
circulating Asn. Certain tumors have decreased or
absent activity of Asn synthase, so they are dependent
on externally supplied l-Asn for growth [5]. Following
administration of l-asparaginase, the Asn blood levels
are reduced, leading to selectively induced inhibition
and regression of tumors. A marked reduction of
l-Asn concentration in blood and tissue fluids
(< 10% of the normal level) is required for effective
treatment.
Keywords
asparaginase; crystal structure; enzyme
therapy; Erwinia; leukemia treatment
Correspondence
A. C. Papageorgiou, Turku Centre for
Biotechnology, University of Turku and A
˚
bo
Akademi University, Turku 20520, Finland
Fax: +358 2 3338000
Tel: +358 2 3338012
E-mail: tassos.papageorgiou@btk.fi
(Received 26 May 2008, revised 22 June
2008, accepted 26 June 2008)
doi:10.1111/j.1742-4658.2008.06574.x
Bacterial l-asparaginases are enzymes that catalyze the hydrolysis of
l-asparagine to aspartic acid. For the past 30 years, these enzymes have
been used as therapeutic agents in the treatment of acute childhood
lymphoblastic leukemia. Their intrinsic low-rate glutaminase activity,

however, causes serious side-effects, including neurotoxicity, hepatitis,
coagulopathy, and other dysfunctions. Erwinia carotovora asparaginase
shows decreased glutaminase activity, so it is believed to have fewer side-
effects in leukemia therapy. To gain detailed insights into the properties of
E. carotovora asparaginase, combined crystallographic, thermal stability
and cytotoxic experiments were performed. The crystal structure of
E. carotovora l-asparaginase in the presence of l-Asp was determined at
2.5 A
˚
resolution and refined to an R
cryst
of 19.2 (R
free
= 26.6%) with good
stereochemistry. Cytotoxicity measurements revealed that E. carotovora
asparaginase is 30 times less toxic than the Escherichia coli enzyme against
human leukemia cell lines. Moreover, denaturing experiments showed that
E. carotovora asparaginase has decreased thermodynamic stability as
compared to the E. coli enzyme and is rapidly inactivated in the presence
of urea. On the basis of these results, we propose that E. carotovora
asparaginase has limited potential as an antileukemic drug, despite its
promising low glutaminase activity. Our analysis may be applicable to the
therapeutic evaluation of other asparaginases as well.
Abbreviations
ASA, solvent-accessible surface area; CS, cell survival; EcAII, Escherichia coli periplasmic asparaginase; ErA, Erwinia chrysanthemi
asparaginase; EwA, Erwinia carotovora asparaginase; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide.
4306 FEBS Journal 275 (2008) 4306–4316 ª 2008 The Authors Journal compilation ª 2008 FEBS
Escherichia coli periplasmic l-asparaginase (EcAII)
and Erwinia chrysanthemi l-asparaginase (ErA) have
been successfully used in leukemia treatment. However,

their l-glutaminase side activity limits their use and
causes severe side-effects as a result of l-Gln depriva-
tion [6]. Serious liver disorders, acute pancreatitis,
hyperglycemia, immunosuppression and other dysfunc-
tions are some of the side-effects in patients receiving
l-asparaginase treatment. Also, differences between
E. coli and Er. chrysanthemi asparaginase in respect to
toxicity and efficacy have been found [2].
All known bacterial l-asparaginases show high simi-
larity in their tertiary and quaternary structures.
l-Asparaginases crystallize mostly as homotetramers
with 222 symmetry. Structural information on several
l-asparaginases, including EcAII [7], ErA [8], Wolinel-
la succinogenes asparaginase [9] and related amido-
hydrolases from Acinetobacter glutaminasificans [10]
and Pseudomonas fluorescence [11], is available.
Recently, an X-ray structure of ErA was refined to
1.0 A
˚
resolution [12]. The enzyme monomer consists of
$ 330 amino acids arranged in two domains. The
active site of l-asparaginase is located between the
N-terminal and C-terminal domains of two adjacent
monomers. Residues responsible for ligand binding
form the rigid part of the active site. The flexible part
of the active site (residues 14–33 in ErA) controls
access to the binding pocket and carries the catalytic
nucleophile Thr15, which is highly conserved for all
l-asparaginases [8]. This region is often disordered in
the crystals of the enzyme, indicating high mobility of

the flexible loop. Suicide inhibitors bind covalently to
the primary catalytic nucleophile Thr15 and Tyr29 of
ErA, freezing the flexible loop in the ‘closed’ confor-
mation [13]. Further experiments have shown that,
indeed, substrate binding induces rapid closure of the
loop, whereas in the absence of ligands, the loop stays
predominantly open [14,15].
Desired properties for therapeutic l-asparaginases
include high l-asparaginase activity, low l-glutamin-
ase specificity, and a long half-time in the blood-
stream [16]. These criteria have directed the search
for an optimal therapeutic asparaginase that started
more than 30 years ago [17] but has not led to any
noticeable success. As a result, many asparaginases
with promising catalytic properties did not pass pre-
clinical trials, because of their therapeutic inefficiency
[18]. In most of the studies, the catalytic properties of
the enzymes were characterized in detail, but other
important parameters, such as oligomerization and
thermal stability, were overlooked. Hence, a clear
understanding of the catalytic activity, conformational
stability and structural properties is required to pro-
vide adequate and efficient criteria for evaluation and
prognosis of the therapeutic efficiency of new l-aspar-
aginases.
Recent studies have shown that Erwinia carotovora
asparaginase (EwA), similarly to EcAII, exhibits a very
low glutaminase activity – about 1.5% of its l-aspara-
ginase activity [19,20]. On the other hand, ErA, which
is more closely related to EwA at the amino acid

sequence level than to EcAII, has a glutaminase activ-
ity that is approximately 10% of its asparaginase activ-
ity but is better for medication, owing to less severe
immunorelated side-effects [21,22]. Consequently, EwA
may exhibit better therapeutic potential by combining
the advantages of both EcAII and ErA.
To gain further insights into EwA and to assess its
suitability as a drug candidate, we have determined the
crystal structure of the enzyme in the presence of Asp
and carried out stability and cytotoxicity measure-
ments. Unlike in previously reported crystal structures
of asparaginases, a dimer of homotetramers was found
in the crystals. As compared to EcAII, EwA was
found to have reduced stability with and without
l-Asp. Furthermore, its cytotoxic efficiency was 30
times lower than that of EcAII.
Results and Discussion
Quality of the structure
The structure of EwA was refined to an R
cryst
of
19.2% (R
free
= 26.6%). The final model consists of
eight monomers, eight l-Asp molecules, and a total of
708 water molecules. The first three residues and a gap
between residues 19 and 33 could not be fully modeled
in any of the eight individual monomers, due to the
lack of sufficient electron density. The Ramachandran
plot showed 89.2% of the non-Gly and non-Pro resi-

dues in the most preferable region and 0.4% in the
generously allowed region. The overall G-factor is
)0.05, which is better than expected for structures
determined at the same resolution according to
procheck. The average B-factor for all atoms in the
structure is 34.6 A
˚
2
, close to the B-factor of the col-
lected dataset calculated by Wilson plot (39.6 A
˚
2
). The
average B-factors for each monomer are: A, 29.6 A
˚
2
;
B, 29.0 A
˚
2
; C, 30.2 A
˚
2
; D, 28.7 A
˚
2
; E, 39.4 A
˚
2
;

F, 39.3 A
˚
2
; G, 39.5 A
˚
2
; and H, 39.8 A
˚
2
. The map cor-
relation is 0.95 (Fig. S1).
Overall structure
The eight monomers (indexed from A to H) are
arranged in two tetramers (ABCD and EFGH) in the
A. C. Papageorgiou et al. Erwinia carotovora L-asparaginase
FEBS Journal 275 (2008) 4306–4316 ª 2008 The Authors Journal compilation ª 2008 FEBS 4307
asymmetric unit (Fig. 1A). The rmsd values between
the monomers are no higher than 0.29 A
˚
(monomer A
will be taken as reference unless otherwise stated).
Each of the independent monomers has the charac-
teristic two-domain architecture of l-asparaginases: a
large N-terminal domain characterized by an eight-
stranded antiparallel mixed b-sheet, and a smaller
C-terminal domain that contains a parallel b-sheet
(Fig. 1B) [23]. The two domains are connected by an
approximately 20 residue flexible linker in the region
around residue 200. Of all residues in the linker,
Thr204 adopts a stereochemistry that lies in the disal-

lowed region of the Ramachandran plot, in agreement
with the corresponding Thr in EcAII and ErA.
Comparison with other asparaginase monomers
Structure-based sequence alignment was carried out
against EcAII and ErA monomers using the coordi-
nates of the 3ECA [7] and 1HG1 [8] Protein Data
Bank entries, respectively (Fig. 2). An rmsd of 0.42 A
˚
(78% sequence identity) and 0.88 A
˚
(49% sequence
identity) for Ca atoms was found for ErA and EcAII,
respectively. The symmetry found in EwA tetramers
matches that of EcAII and ErA, and the overall fold
of the monomers is also identical (Fig. 2B). As
expected, EwA and ErA keep a nearly identical fold,
whereas there are more differences between EwA and
EcAII. The largest differences are found in the flexible
parts of the surface, but these are less important for
the overall fold and active site orientation. One struc-
turally important difference found between EwA and
EcAII is the presence of a single disulfide bond in
EcAII, involving Cys77 and Cys105. This disulfide
bond is placed near the substrate entry, possibly pro-
viding extra stabilization to EcAII. Hence, site-directed
mutagenesis to engineer a similar disulfide bond into
EwA may alter the properties of the enzyme and
improve its stability.
Active site
The catalytic site of the enzyme is located between the

N-terminal and C-terminal domains of adjacent mono-
mers (A and C; B and D). Sequence comparison indi-
cates that the active site is highly conserved between
EwA, ErA, and EcAII (Fig. 2A). Strong electron den-
sity in the active site region was found and, due to its
shape, it was assigned to a bound l-Asp. The low
B-factors, around 30 A
˚
2
, for the active site residues in
monomer A indicated that there is relatively stable
binding of the ligand, as also suggested by the B-factor
(36.1 A
˚
2
)ofl-Asp itself. Higher B-factors for l-Asp
were found in other monomers, possibly due to less
tight binding. The catalytic residues are believed to be
Thr15 and Thr95 according to previous structures of
l-asparaginases. Thr15 is part of the active site flexible
loop comprising residues 14–33. Evaluation of contacts
within the structure shows that the surrounding
residues Ser62, Glu63, Asp96 and Ala120 also have
significant contacts with the ligand (Table 1). Ala120,
in particular, is approximately 0.3 A
˚
closer to the OD2
of l-Asp, and it may provide additional stabilization
for ligand binding (Fig. 3). Hence, a bulkier residue
could further reduce the size of the binding pocket,

possibly leading to an additional reduction of the glu-
taminase activity. In EcAII, Glu283 from monomer C
is involved in a strong hydrogen bond with the nitro-
gen atom of l-Asp. In contrast, only Ser254 OG from
monomer C of the AC EwA dimer makes a weak con-
tact (4.25 A
˚
) with the nitrogen atom of l-Asp, and no
structural equivalent of EcAII Glu283 is found in
EwA and ErA, due to a deletion in their primary
structure (Fig. 2A). This might explain the higher
affinity of EcAII for l-Asn (K
m
=15lm) [15] as com-
pared with EwA (K
m
=98lm) [19] or ErA
(K
m
=55lm) [24]. Close inspection of this region in
the crystal structures of EwA and EcAII reveals that
Asp287 of EwA monomer C is approximately 5.8 A
˚
away from EcAII Glu283 and hence unable to make
any contacts with l-Asp. Structural comparison with
the active site of ErA shows strong conservation of the
participating residues. One notable exception is EwA
AB
Fig. 1. (A) Ribbon diagram of EwA dimer of homotetramers. Each
monomer is shown in a different color. (B) Ribbon diagram of EwA

monomer. The coloring changes from blue (N-terminal) to red (C-
terminal). The active site location is indicated by the bound
L-Asp
(sticks). The figure was drawn with
PYMOL 0.99 (DeLano Scientific,
Palo Alto, CA, USA). Secondary structure elements were assigned
by
DSSP [45].
Erwinia carotovora
L-asparaginase A. C. Papageorgiou et al.
4308 FEBS Journal 275 (2008) 4306–4316 ª 2008 The Authors Journal compilation ª 2008 FEBS
Gly61, which corresponds to Ala61 in ErA. Given
that EcAII has also a Gly in the same position, the
presence of Ala in ErA may contribute to the increased
glutaminase activity of the latter as compared to EwA
and EcAII, because of small conformational changes
or different flexibility of the surrounding residues.
Different conformations of the active site flexible loop
may also contribute to the variations in substrate speci-
ficity among l-asparaginases [20]. Hence, the active site
flexible loop could be another good starting point for
protein engineering efforts to produce l-asparaginase
variants with altered substrate specificity.
The EwA tetramer
As the tetramer is known to be the catalytically active
form of asparaginases [25], its preservation is impor-
tant for the enzymatic and, consequently, therapeutic
properties of the enzyme. Spatial and energetic
properties of monomer interfaces in EwA and EcAII
tetramers are summarized in Tables 2 and 3. The

largest contact area is between monomers A and C,
which participate in the active site formation. This
interface corresponds to 24–28% of the dimer solvent-
accessible surface area (ASA). The asparaginase
monomers that do not contribute to the catalytic
center formation are less tightly bound. Their pairwise
contact area involves no more than 10–12% of the
dimer ASA. The strength of the intersubunit binding
correlates well with the interaction energy, which is
also significantly higher for the AC dimers than for
other dimer combinations. The comparison of EwA
crystal structures in complex with l-Asp in the active
site and in the absence of any ligand (Protein Data
Bank code 1ZCF) reveals that l-Asp binding tightens
the interaction of each monomer; for example, the
A
B
Fig. 2. (A) Structure-based alignment of
EwA, EcAII and ErA. Secondary structure
elements are shown in blue, and active site
residues are marked with black arrows. The
figure was drawn with
ESPRIPT [46]. Solvent
accessibility for EwA is also shown at the
bottom from dark blue (solvent-accessible)
to white (buried). (B) Ca-trace structural
superposition (in wall-eye stereo mode) of
EwA, ErA and EcAII in gray, yellow, and
red, respectively. Every 20th residue of
EwA is labeled. The orientation is similar to

that in Fig. 1B.
A. C. Papageorgiou et al. Erwinia carotovora
L-asparaginase
FEBS Journal 275 (2008) 4306–4316 ª 2008 The Authors Journal compilation ª 2008 FEBS 4309
number of hydrogen bonds increases and the electro-
static part of the interaction energy is reduced to half,
with the exception of the EwA AD dimer. This finding
implies that the thermodynamic stability of asparagin-
ase in solution will benefit from the presence of l-Asp.
Although EcAII and EwA do not differ significantly
with respect to the geometry of the dimer interface,
EwA is characterized by a considerably higher electro-
static energy of monomer–monomer interactions.
Although the electrostatic energy is decreased upon
binding of l-Asp to EwA, it still remains approxi-
mately three times higher than that of the correspond-
ing EcAII monomer pairs. This observation suggests
reduced thermodynamic stability of EwA and, conse-
quently, a possible decreased ability of this enzyme to
inhibit tumor cell growth. The hydrophobic inter-
actions were not taken into consideration, although
they are very important in evaluating the stability of
protein–protein complexes. However, the calculation
of the hydrophobic constituent in a vacuum using
crystal structure is not accurate, as it essentially
depends on the protein environment.
Table 1. Protein–L-Asp contacts at the active site; distances from 2.3 to 3.5 A
˚
.
L-Asp atoms EwA EcAII

a
N E63 OE1 (2.90), D96 OD2 (2.53) Q59 OE1 (2.96), D90 OD2 (3.00), N48
b
ND2 (3.47), E283
b
OE2 (2.46), E283
b
OE1 (3.05), E283
b
CD (3.12)
CA T15 OG1 (3.25), D96 OD2 (3.36) T12 OG1 (3.27), V27 CG2 (3.36), E283
b
OE2 (3.30)
CB T15 OG1 (3.19) T12 OG1 (3.11), D90 OD1 (3.37)
CG T15 CB (3.27), T15 OG1 (2.96), T95 OG1 (3.13), T N (3.31) T12 CB (3.40), T12 OG1 (2.92), T89 OG1 (2.86)
OD1 T15 OG1 (3.31), T15 CB (3.37), T15 N (3.01), T95 N (2.88),
G94 CA (3.00), G94 C (3.39)
T12 CB (3.46), T12 OG1 (3.18), T12 N (3.19),
G88 CA (2.98), G88 N (3.19), T89 N (2.56),
T89 OG1 (3.40)
OD2 A120 O (2.82), T15 CB (3.24), T15 OG1 (3.21), T95 OG1 (2.88) A114 O (3.14), T12 CB (3.42), T12 OG1 (3.29),
T89 CB (3.39), T89 OG1 (2.42)
C E63 OE1 (3.05), S62 N (3.39) S58 OG 3.36, G88 CA 3.41, S58 N (3.42)
O T95 N (3.35), D96 N (3.11), S62 OG (2.65), E63
OE1 (3.32), D96 CG (3.25), D96 OD2 (3.19),
D96 CB (3.21), S62 CB (3.42), G94 (3.33), S62 N (3.34)
G11 CA (3.31), G88 CA (3.18), G57 CA (3.22),
G57 C (3.42), S58 N (2.75)
OXT G14 CA (3.27), G61 C (3.45), G61 CA (3.28), S62 N (2.75),
G63 OE1 (3.15), G94 CA (3.32)

Ser58 OG (2.47), Gly88 CA (3.35), G88 C (3.36),
T89 N (3.25), D90 N (2.96), D90 CB (3.05), D90 CG (3.21)
a
Active site of monomer A in 3ECA crystal structure.
b
Monomer C.
A
B
Fig. 3. Stereodiagrams (wall-eye mode) of
the active site of (A) EwA and (B) EcAII
(Protein Data Bank code 3ECA) [7] with
bound
L-Asp (in green). The active site
residues involved in interactions with the
substrate and major hydrogen bonds are
shown (a full list of contacts is given in
Table 1). Glu283 from monomer C of the
EcAII homotetramer is colored yellow.
Erwinia carotovora
L-asparaginase A. C. Papageorgiou et al.
4310 FEBS Journal 275 (2008) 4306–4316 ª 2008 The Authors Journal compilation ª 2008 FEBS
Crystal packing in the asymmetric unit
EwA was found to form a dimer of homotetramers in
the asymmetric unit. The intermolecular interactions
between the two tetramers are mediated mainly by salt
bridges found between B Asp215 and G Arg148, B
Asp215 and G Lys147, and C Arg148 and F Asp215.
Calculation of the ASA between the two EwA tetramers
gives an estimated contact area of $ 3700 A
˚

2
, which is
in the upper range of contact areas (> 2000 A
˚
2
) found
in protein–protein complexes [26]. The shape comple-
mentarity S
c
[27] of the two tetramers is 0.517, which
corresponds to the lower limit of S
c
found in protein–
protein interfaces. Thus, the possibility that EwA may
be able to form higher-order oligomers under physio-
logical conditions cannot be ruled out according to
structural considerations. Changes in the oligomeric
form of l-asparaginase could be clinically important
and may require further investigation. Earlier studies
have shown that EcAII is able to form oligomers of dif-
ferent molecular masses, depending on the enzyme con-
centration and the influence of various chemicals [28].
Cytotoxicity tests
EwA showed an inhibitory effect on leukemia cell
growth (Fig. 4). Three human tumor cell lines com-
monly used to test asparaginase cytotoxicity were
employed. The enzyme concentrations used in the
experiments (from 0.01 to 15 IUÆmL
)1
) covered the

range of asparaginase concentration in blood after
injection of a standard dose of this drug (0.5–
2IUÆmL
)1
) [29]. The viabilities of acute lymphoblastic
leukemia and Burkitt’s lymphoma cells were signifi-
cantly decreased after 72 h of incubation with EwA.
Chronic myeloid leukemia cells were rather resistant to
asparaginase treatment [18]. A significant decrease in
cell viability began at an EwA concentration of
0.5 IUÆmL
)1
for K562 and MOLT-4 cells, and at
0.3 IUÆmL
)1
for Raji cells, and this was followed by a
further linear decay of the number of surviving cells up
to 0% of control. The LC
50
values were determined to
be 3.26 ± 0.29 and 7.33 ± 0.42 IUÆmL
)1
for Raji and
MOLT-4 cells, respectively. For K562 cells, the LC
50
value was not determined, as a 50% decrease in the
number of viable cells was not reached even with the
highest concentration of 15 IUÆmL
)1
used in the experi-

ment. The concentration of 5 IUÆmL
)1
marked a pla-
teau on the dose-dependence curve, suggesting that the
LC
50
level may not be reached at all for K562 cells. Sim-
ilar results were obtained with EcAII, which was
used as a reference enzyme. Only a quantitative differ-
ence between EcAII and EwA antiproliferative prop-
erties was found. The EcAII LC
50
values for both
Raji (0.11 ± 0.005 IUÆmL
)1
) and MOLT-4 (0.27 ±
0.03 IUÆmL
)1
) cells were approximately 30 times lower
than the EwA LC
50
value, suggesting that EcAII is
$ 30 times more toxic than EwA.
Table 3. Interaction energy (kJÆmol
)1
) of monomers in asparaginase tetramer calculated using GROMOS96 forcefield. Monomer partitioning
for EcAII and EwA in complex with
L-Asp corresponds to that of the 3ECA structure. Monomers A, B, C and D for EwA correspond to
monomers A, B, E and F, respectively, in 1ZCF.
Monomer

EcAII in complex with
L-Asp (3ECA) EwA in complex with L-Asp EwA (Protein Data Bank code 1ZCF)
Nonbonded Electrostatic Total Nonbonded Electrostatic Total Nonbonded Electrostatic Total
AB )340 )41 )381 )206 )15 )221 )343 )8 )351
AC )1037 )252 )1289 )939 )86 )1025 )999 )40 )1039
AD )434 )6 )440 )513 )2 )515 )297 )25 )322
Table 2. Geometric characterization of interfaces in asparaginase tetramers.
EcAII in complex with
L-Asp (3ECA) EwA in complex with L-Asp EwA free (1ZCF)
ASA
(A
2
)
Contact
area
(A
2
) (%)
Hydrogen
bonds ASA (A
2
)
Contact
area
(A
2
) (%)
Hydrogen
bonds ASA (A
2

)
Contact
area
(A
2
) (%)
Hydrogen
bonds
AB 24 267 3689 (15.2) 10 24 762 3628 (14.6) 12 26 961 3276 (12.1) 7
AC 21 945 6153 (28.0) 25 22 257 6421 (28.8) 27 25 065 6078 (24.2) 19
AD 24 508 3900 (15.9) 15 24 374 3215 (13.1) 12 27 191 2877 (10.6) 12
A. C. Papageorgiou et al. Erwinia carotovora
L-asparaginase
FEBS Journal 275 (2008) 4306–4316 ª 2008 The Authors Journal compilation ª 2008 FEBS 4311
Stability measurements
Comparative studies of thermodynamic stabilities
revealed that EwA, in contrast to EcAII, rapidly lost its
activity under denaturating conditions (Fig. 5). Incuba-
tion for 3 min at 35 °C led to a 60% irreversible
decrease of EwA activity, whereas EcAII retained most
of its initial activity after incubation under the same
conditions. EwA also displayed low stability in urea
solutions (Fig. 5B), and its enzymatic activity was com-
pletely lost after 1 h of incubation with 2 m urea. In
contrast, no decrease in activity was observed for EcAII
with up to 4 m urea. Furthermore, the presence of
l-Asp increased the stability of both asparaginases with
respect to the denaturing effect of temperature and
urea, in agreement with the structural analysis of the
tetramer. Thus, the stability of EwA remained much

lower than that of EcAII even in the presence of l-Asp.
With all of these findings, the drastic difference
between the cytotoxic activities of EcAII and EwA
may be attributed to the ability of these asparaginases
to maintain their catalytically active oligomeric con-
formation. Indeed, the rapid loss of EwA activity
20 30 40 50 60 70 80 90 100
0
20
40
60
80
100
120
A
B
Residual activity (%)Residual activity (%)
T (°C)
012345678
0
20
40
60
80
100
120
Urea (M)
Fig. 5. Stabilities of EwA ( ) and EcAII (d), (A) at different temper-
atures and (B) in urea solution. Data points represent the average
value from a triplicate experiment. Data obtained in the presence of

L-Asp are indicated by empty symbols.
120
100
80
60
40
20
0
120
100
80
60
40
20
0
120
100
80
60
40
20
0
0.01
Cell survival (%)
Cell survival (%)
Cell survival (%)
0.1 0.5 1 2 5 10 20
0.01
0.1 0.5 1
2

51020
0.01
0.1
Aspara
g
inase (IU.mL
–1
)
Asparaginase (IU.mL
–1
)
Asparaginase (IU.mL
–1
)
0.5 1
2
5
10
20
A
B
C
Fig. 4. Antiproliferative effects of EwA (d) and EcAII ( ) on human
leukemia cell growth following a 72 h incubation. (A) MOLT-4. (B)
Raji. (C) K562. Data points represent the average value from a
duplicated experiment calculated from at least three replicate wells.
Erwinia carotovora
L-asparaginase A. C. Papageorgiou et al.
4312 FEBS Journal 275 (2008) 4306–4316 ª 2008 The Authors Journal compilation ª 2008 FEBS
below 30–40 °C is due probably to disruption of the

quaternary tetrameric structure rather than to the
unfolding of individual monomers. The same is
expected for asparaginase inactivation in urea solution.
Shifrin et al. [25] have shown in sedimentation velocity
experiments, confirmed by fluorescent studies, that the
inactivation of asparaginase in urea proceeds through
tetramer dissociation.
Implications
The results presented here have unveiled a potential
correlation between the thermodynamic stability of
EwA and its cytotoxicity. Thus, two important conclu-
sions can be drawn from our studies. First, thermody-
namic stability appears to provide a new criterion that
has been previously overlooked during the search for
new therapeutic candidates in the l-asparaginase
family. Second, our analysis may help to interpret the
variations in the clinical profiles of asparaginase ther-
apy that so far are not fully understood. For example,
the recently published results of a comparative study
of therapeutic l-asparaginases conducted for 7 years
by the Dana-Farber Cancer Institute showed that ErA
is less toxic and less efficacious than EcAII [30,31]. It
is possible that ErA may dissociate rapidly and lose its
activity after injection, so becoming unable to induce
either a therapeutic effect or toxicity as compared to
EcAII. This assumption agrees well with the essentially
different half-times of these enzymes in blood (6–15 h
for ErA and 30–34 h for EcAII) [18]. Further investi-
gations are clearly necessary to obtain a complete
understanding of the interplay of therapeutic potential

and protein stability in l-asparaginases.
Experimental procedures
Cloning, expression and purification of EwA
A plasmid pACY177 ⁄ ECAR-LANS containing a 1126 bp
EwA genome fragment including the EwA gene (ansB1,
Gene ID 2884179) was kindly provided by V. V. Bogush
(Institute of Gene Biology, Moscow). EwA was PCR ampli-
fied from this plasmid using the following forward and
reverse primers: 5¢-CGT
CATATGAAAAGGATGTTTAA
GG-3¢ and 5¢-CCT
CTCGAGATAAGCGTGGAAGTAA
TCC-3¢. The NdeI and XhoI sites (underlined) were intro-
duced at the 5¢-terminus and the 3¢-terminus, respectively,
of the EwA gene for cloning into the pET22b vector
(Novagen). The resulting pET22 ⁄ EwA plasmid was inserted
into BL21 (DE3) E. coli cells after verification of construct
fidelity by sequencing. Cultures were grown in LB medium
supplemented with 100 lgÆmL
)1
ampicillin at 37 °Cto
A
600 nm
= 0.8–0.9, and EwA expression was induced with
0.5 mm isopropyl thio-b-d-galactoside for 5 h. Cells were
collected by centrifugation at 4000 g for 15 min and stored
at )20 °C until use. All purification steps were performed
at 4 °C. Cells were resuspended in water and disrupted by
sonication. Then, the pH of the cell-free extract was
decreased to 6.0 with 1 m NaH

2
PO
4
. Cell debris and precip-
itated proteins were removed by centrifugation at 10 000 g
for 20 min. The soluble fraction of the cell-free extract was
loaded onto an SP-Sepharose column (1 · 8 cm) equili-
brated with 20 m m sodium phosphate buffer (pH 6.0), and
unbound proteins were washed off with the same buffer.
EwA was eluted with 100 mL of a 0–0.8 m NaCl linear gra-
dient in column buffer, desalted on a PD10 column, and
concentrated to 10 mgÆmL
)1
.
Crystallization and data collection
EwA was crystallized in the presence of l-Asp as previously
described [32]. Briefly, a 10 mgÆ mL
)1
protein solution con-
taining 10 mml-Asp was mixed with a reservoir solution
containing 16–18% poly(ethylene glycol) 4000 and 0.2 m
NaF. Crystals usually appear after $ 5 days. Data were
collected on station X13 at EMBL Hamburg (c ⁄ o DESY)
from a single crystal at 100 K, using 20% glycerol as cryo-
protectant. A MARCCD detector and a fixed wavelength
(0.8043 A
˚
) were used during data collection. In total, 900
images with an oscillation range of 0.25° and exposure time
$ 30 s were collected, processed and scaled using xds [33].

Details of data processing are given in Table 4.
Structure determination and refinement
Initial phases were calculated with phaser [34], using a
poly-alanine model of ErA tetramer (Protein Data Bank
code 1HG1). Refinement was first carried out with cns [35],
and at the later stages with refmac5 [36]. Refinement
statistics are summarized in Table 4. Rebuilding and man-
ual fitting into 2|F
o
|–|F
c
| and |F
o
|–|F
c
| difference electron
density maps were performed in o [37] and coot [38]. Non-
crystallographic symmetry restraints were used in the initial
stages of refinement, and were gradually released at the
final stages. Water molecules were added either manually
or automatically by arp ⁄ warp [39]. Only water molecules
with B-factors < 65 A
˚
2
after a round of refinement were
kept for subsequent refinement. Bond distances and con-
tacts were analyzed by the program contact from the
ccp4i program suite [40]. The geometric quality of the
refined model was assessed with procheck [41]. Monomer
interfaces were analyzed by cache 6.1 ( />chemistry/cache), and interaction energies were calculated

using swiss-pdbviewer 3.7 with the gromos96 forcefield
( Structure-based super-
position was performed with ssm [42] and structural com-
parison between monomers with lsqkab [40].
A. C. Papageorgiou et al. Erwinia carotovora L-asparaginase
FEBS Journal 275 (2008) 4306–4316 ª 2008 The Authors Journal compilation ª 2008 FEBS 4313
Enzymatic assay
The rate of l-Asn hydrolysis by EwA was measured in a dis-
continuous assay following the formation of ammonia by
the Nessler method, as described elsewhere [43]. The aspara-
ginase activity was expressed in International Units (IU),
with 1 IU defined as 1 lmol of ammonia released per 1 min.
Antiproliferative assay
Human leukemia cell lines MOLT-4 (acute T-lymphoblastic
leukemia), Raji (Burkitt’s lymphoma) and K-562 (human
chronic myeloid leukemia) were used to test asparaginase
cytotoxicity. Cultures were maintained at 37 °C in a 5% CO
2
incubator and propagated in RPMI-1640 medium (HyClone,
Logan, UT, USA) supplemented with 10% (v ⁄ v) fetal bovine
serum (HyClone) and 50 lgÆmL
)1
gentamicin as antibiotic
solution. Cells were plated in 96-well plates (Corning-Costar,
Cambridge, MA, USA) at a density of 2.5 · 10
4
cellsÆmL
)1
in fresh medium. The range of the final l-asparaginase con-
centrations in each well was from 0.01 IUÆmL

)1
to
15 IUÆmL
)1
. Each test was performed in triplicate. Commer-
cially produced EcAII l-asparaginase (Medac, Hamburg,
Germany) was used as a reference. After 72 h of incubation
under standard conditions, a colorimetric assay using the
metabolizable salt 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-
tetrazolium bromide (MTT) (Sigma-Aldrich, St Louis, MO,
USA) was employed to measure cell survival [44]. Two hours
before the end of incubation, 50 lL of MTT (1 mgÆmL
)1
)in
the culture medium were added to each well. After staining,
the culture medium was removed, formazan crystals pro-
duced by reduction of MTT were dissolved in 100 lLof
dimethylsulfoxide, and staining intensity was measured by
absorption at 540 nm on an ELISA reader (Labsystems,
Helsinki, Finland). Cell survival (CS) was calculated by the
equation: CS = (D
treated well
⁄ mean D
control wells
) · 100%.
The enzyme concentration lethal to 50% of cells (LC
50
) was
calculated from the fit of experimental data to the dose–
response equation CSðEÞ¼A

1
þðA
2
À A
1
Þ=½1 þ 10
ðLC
50
ÀEÞ
p;
where A
1
and A
2
are the bottom and top asymptotes, E the
enzyme concentration, and p the Hill slope. Data were
processed with origin 7.0 ().
Conformational stability measurements
To test asparaginase thermal stability, 10 lL of enzyme
stock solution (150 IUÆmL
)1
) were added to 500 lL of pre-
heated 50 mm phosphate buffer (pH 7.2), supplemented
with 50 mm NaCl, mixed vigorously for a few seconds, and
incubated at a given temperature for 3 min. After that, the
assay mixture was immediately put on ice for 1 h for
refolding. Then, the residual asparaginase activity was mea-
sured under physiological temperature conditions (37 °C).
The reaction was started by addition of 40 lL of 200 mm
l-Asn solution in NaCl ⁄ P

i
, and quenched with 250 lLof
20 mm trichloroacetic acid. Empirical melting temperatures
were read at the inflection points of the resulting activity
versus temperature profiles.
The asparaginase stability was also evaluated by denatur-
ation experiments in urea solutions. In this case, 2 lLof
1000 IUÆmL
)1
enzyme stock solution was mixed with 18 lL
of increasing urea concentrations (from 0 to 7.2 m)in
50 mm phosphate buffer (pH 7.2). Following incubation for
1 h at room temperature (23 ° C), all 20 lL of the assay
mixture were added to 530 lLof50mm phosphate buffer
(pH 7.2), containing 100 mm NaCl and 15 mml-Asn. The
reaction was stopped with 250 l Lof20mm trichloroacetic
acid. Denaturation experiments in the presence of 2.7 mm
l-Asp were also conducted.
Data deposition
Atomic coordinates and structure factors have been depos-
ited in the Protein Data Bank (ID code 2jk0).
Table 4. Data collection and refinement statistics.
Data collection
Space group P2
1
2
1
2
1
Cell dimensions (A

˚
) 73.65 · 135.65 · 250.10
No. of protein molecules
in the ASU
8
Resolution range (A
˚
) 20.0–2.50 (2.60–2.50)
a
Temperature (K) 100
No. of observations 368 260 (23 099)
No. of unique reflections 83 599 (7463)
Completeness (%) 95.8 (78.0)
R
merge
(%) 7.8 (43.8)
I ⁄ sigma(I) 13.9 (3.2)
Refinement statistics
Resolution range (A
˚
) 20.0–2.5
No. of reflections
(working ⁄ test)
79 398 ⁄ 4197
R
cryst
⁄ R
free
(%) 19.2 ⁄ 26.6
Water molecules 708

rmsd
Bond lengths (A
˚
) 0.009
Bond angles (º) 1.29
Average B-factors (A
˚
2
)
Main chain 34.4
Side chain 34.5
Waters 39.4
L-Asp 50.7 (A, 36.1; B, 37.8; C,
46.6; D, 54.9; E, 62.1; F,
55.0; G, 49.7; H, 56.8)
Wilson B-factor (A
˚
2
) 39.6
Ramachandran statistics (%)
Most favored regions 89.2
Additional allowed regions 9.9
Generously allowed regions 0.5
Disallowed regions 0.4
a
Numbers in parentheses correspond to the highest resolution
shell. ASU, asymmetric unit.
Erwinia carotovora
L-asparaginase A. C. Papageorgiou et al.
4314 FEBS Journal 275 (2008) 4306–4316 ª 2008 The Authors Journal compilation ª 2008 FEBS

Acknowledgements
This work was supported by the Sigrid Juse
´
lius Founda-
tion and the Academy of Finland (Grant No. 121278).
We thank the staff at EMBL Hamburg for help with
data collection. Access to EMBL Hamburg (c ⁄ o DESY)
was provided by the European Community (Access to
Research Infrastructure Action of the Improving
Human Potential Programme to the EMBL Hamburg
Outstation, contract number HPRI-CT-1999-00017).
Funding from the Russian Fund for Basic Research
(grant 06-04-49792) is also acknowledged.
References
1 Campbell HA, Mashburn LT, Boyse EA & Old LJ
(1967) Two L-asparaginases from Escherichia coli B.
Their separation, purification, and antitumor activity.
Biochemistry 6, 721–730.
2 Duval M, Suciu S, Ferster A, Rialland X, Nelken B,
Lutz P, Benoit Y, Robert A, Manel AM, Vilmer E
et al. (2002) Comparison of Escherichia coli-asparagin-
ase with Erwinia-asparaginase in the treatment of child-
hood lymphoid malignancies: results of a randomized
European Organisation for Research and Treatment of
Cancer – Children’s Leukemia Group phase 3 trial.
Blood 99, 2734–2739.
3Go
¨
kbuget N & Hoelzer D (2006) Treatment of adult
acute lymphoblastic leukemia. Hematol Am Soc Hema-

tol Educ Program 1, 133–141.
4 Verma N, Kumar K, Kaur G & Anand S (2007) L-as-
paraginase: a promising chemotherapeutic agent. Crit
Rev Biotechnol 27, 45–62.
5 Holcenberg J (2005) New insights on asparaginase.
J Pediatr Hematol Oncol 27, 246–247.
6 Ollenschlager G, Roth E, Linkesch W, Jansen S,
Simmel A & Modder B (1988) Asparaginase-induced
derangements of glutamine metabolism: the pathoge-
netic basis for some drug-related side-effects. Eur J Clin
Invest 18, 512–516.
7 Swain AL, Jasko
´
lski M, Housset D, Rao JK & Wloda-
wer A (1993) Crystal structure of Escherichia coli L-as-
paraginase, an enzyme used in cancer therapy. Proc
Natl Acad Sci USA 90, 1474–1478.
8 Aghaiypour K, Wlodawer A & Lubkowski J (2001)
Structural basis for the activity and substrate specificity
of Erwinia chrysanthemi L-asparaginase. Biochemistry
40, 5655–5664.
9 Lubkowski J, Palm GJ, Gilliland GL, Derst C, Ro
¨
hm
KH & Wlodawer A (1996) Crystal structure and amino
acid sequence of Wolinella succinogenes L-asparaginase.
Eur J Biochem 241, 201–207.
10 Lubkowski J, Wlodawer A, Housset D, Weber IT,
Ammon HL, Murphy KC & Swain AL (1994) Refined
crystal structure of Acinetobacter glutaminasificans

glutaminase-asparaginase. Acta Crystallogr D Biol
Crystallogr 50, 826–832.
11 Lubkowski J, Wlodawer A, Ammon HL, Copeland TD
& Swain AL (1994) Structural characterization of Pseu-
domonas 7A glutaminase-asparaginase. Biochemistry 33,
10257–10265.
12 Lubkowski J, Dauter M, Aghaiypour K, Wlodawer A
& Dauter Z (2003) Atomic resolution structure of Erwi-
nia chrysanthemi L-asparaginase. Acta Crystallogr D
Biol Crystallogr 59, 84–92.
13 Ortlund E, Lacount MW, Lewinski K & Lebioda L
(2000) Reactions of Pseudomonas 7A glutaminase-aspar-
aginase with diazo analogues of glutamine and aspara-
gine result in unexpected covalent inhibitions and
suggests an unusual catalytic triad Thr-Tyr-Glu.
Biochemistry 39, 1199–1204.
14 Aung HP, Bocola M, Schleper S & Rohm KH (2000)
Dynamics of a mobile loop at the active site of Escheri-
chia coli asparaginase. Biochim Biophys Acta 1481, 349–
359.
15 Derst C, Henseling J & Ro
¨
hm KH (2000) Engineering
the substrate specificity of Escherichia coli asparaginase.
II. Selective reduction of glutaminase activity by amino
acid replacements at position 248. Protein Sci 9, 2009–
2017.
16 Avramis VI & Tiwari PN (2006) Asparaginase (native
ASNase or pegylated ASNase) in the treatment of acute
lymphoblastic leukemia. Int J Nanomedicine 1, 241–254.

17 Distasio JA, Niederman RA, Kafkewitz D & Goodman
D (1976) Purification and characterization of L-aspara-
ginase with anti-lymphoma activity from Vibrio succin-
ogenes. J Biol Chem 251, 6929–6933.
18 Narta UK, Kanwar SS & Azmi W (2007) Pharmacolog-
ical and clinical evaluation of L-asparaginase in the
treatment of leukemia. Crit Rev Oncol Hematol 61,
208–221.
19 Krasotkina J, Borisova AA, Gervaziev YV & Sokolov
NN (2004) One-step purification and kinetic properties
of the recombinant L-asparaginase from Erwinia caroto-
vora. Biotechnol Appl Biochem 39, 215–221.
20 Kotzia GA & Labrou NE (2005) Cloning, expression
and characterisation of Erwinia carotovora L-asparagin-
ase. J Biotechnol 119, 309–323.
21 Carlsson H, Stockelberg D, Tengborn L, Braide I, Carne-
skog J & Kutti J (1995) Effects of Erwinia-asparaginase
on the coagulation system. Eur J Haematol 55, 289–293.
22 Eden OB, Shaw MP, Lilleyman JS & Richards S (1990)
Non-randomised study comparing toxicity of Escheri-
chia coli and Erwinia asparaginase in children with
leukaemia. Med Pediatr Oncol 18, 497–502.
23 Miller M, Rao JK, Wlodawer A & Gribskov MR
(1993) A left-handed crossover involved in amidohydro-
lase catalysis. Crystal structure of Erwinia chrysanthemi
L-asparaginase with bound L-aspartate. FEBS Lett 328,
275–279.
A. C. Papageorgiou et al. Erwinia carotovora L-asparaginase
FEBS Journal 275 (2008) 4306–4316 ª 2008 The Authors Journal compilation ª 2008 FEBS 4315
24 Kotzia GA & Labrou NE (2007) L-Asparaginase from

Erwinia Chrysanthemi 3937: cloning, expression and
characterization. J Biotechnol 127, 657–669.
25 Shifrin S, Luborsky SW & Grochowski BJ (1971) L-As-
paraginase from Escherichia coli B. Physicochemical
studies of the dissociation process. J Biol Chem 246,
7708–7714.
26 Janin J, Rodier F, Chakrabarti P & Bahadur RP (2007)
Macromolecular recognition in the Protein Data Bank.
Acta Crystallogr D Biol Crystallogr 63, 1–8.
27 Lawrence MC & Colman PM (1993) Shape complemen-
tarity at protein ⁄ protein interfaces. J Mol Biol 234,
946–950.
28 Kirchbaum J, Wriston JC & Ratych OT (1969)
Subunit structure of asparaginase from Escherichia
coli B. Biochim Biophys Acta Protein Struct 194, 161–
169.
29 Vieira Pinheiro JP, Wenner K, Escherich G, Lanvers-
Kaminsky C, Wurthwein G, Janka-Schaub G & Boos J
(2006) Serum asparaginase activities and asparagine
concentrations in the cerebrospinal fluid after a single
infusion of 2,500 IU ⁄ m(2) PEG asparaginase in children
with ALL treated according to protocol COALL-06-97.
Pediatr Blood Cancer 46, 18–25.
30 Goldberg JM, Silverman LB, Levy DE, Dalton VK,
Gelber RD, Lehmann L, Cohen HJ, Sallan SE & Ass-
elin BL (2003) Childhood T-cell acute lymphoblastic
leukemia: the Dana-Farber Cancer Institute acute lym-
phoblastic leukemia consortium experience. J Clin
Oncol 21, 3616–3622.
31 Moghrabi A, Levy DE, Asselin B, Barr R, Clavell L,

Hurwitz C, Samson Y, Schorin M, Dalton VK,
Lipshultz SE et al. (2007) Results of the Dana-Farber
Cancer Institute ALL Consortium Protocol 95-01 for
children with acute lymphoblastic leukemia. Blood
109, 896–904.
32 Wikman LE, Krasotkina J, Kuchumova A, Sokolov
NN & Papageorgiou AC (2005) Crystallization and pre-
liminary crystallographic analysis of L-asparaginase
from Erwinia carotovora. Acta Crystallogr F Struct Biol
Cryst Commun 61, 407–409.
33 Kabsch W (1993) Automatic processing of rotation
diffraction data from crystals of initially unknown
symmetry and cell constants. J Appl Crystallogr 26,
795–800.
34 McCoy AJ, Grosse-Kunstleve RW, Storoni LC & Read
RJ (2005) Likelihood-enhanced fast translation func-
tions. Acta Crystallogr D Biol Crystallogr 61, 458–464.
35 Brunger AT, Adams PD, Clore GM, DeLano WL,
Gros P, Grosse-Kunstleve RW, Jiang JS, Kuszewski J,
Nilges M, Pannu NS et al. (1998) Crystallography &
NMR system: a new software suite for macromolecular
structure determination. Acta Crystallogr D Biol
Crystallogr 54, 905–921.
36 Murshudov GN, Vagin AA & Dodson EJ (1997)
Refinement of macromolecular structures by the maxi-
mum-likelihood method. Acta Crystallogr D Biol
Crystallogr 53, 240–255.
37 Jones AT, Zou YJ & Kjeldgaard M (1994) Improved
methods for building protein models in electron density
maps and the location of errors in these models. Acta

Crystallogr A 42
, 140–149.
38 Emsley P & Cowtan K (2004) Coot: model-building
tools for molecular graphics. Acta Crystallogr D Biol
Crystallogr 60, 2126–2132.
39 Morris RJ, Perrakis A & Lamzin VS (2003) ARP ⁄
wARP and automatic interpretation of protein electron
density maps. Methods Enzymol 374, 229–244.
40 Potterton E, Briggs P, Turkenburg M & Dodson E
(2003) A graphical user interface to the CCP4 program
suite. Acta Crystallogr D Biol Crystallogr 59, 1131–1137.
41 Laskowski RA, MacArthur MW, Moss DS & Thornton
JM (1993) PROCHECK: a program to check the
stereochemical quality of protein structures. J Appl
Crystallogr 26, 283–291.
42 Krissinel E & Henrick K (2004) Secondary-structure
matching (SSM), a new tool for fast protein structure
alignment in three dimensions. Acta Crystallogr D Biol
Crystallogr 60, 2256–2268.
43 Meister A & Fraser PE (1954) Enzymatic formation of
L-asparagine by transamination. J Biol Chem 210, 37–43.
44 Denizot F & Lang R (1986) Rapid colorimetric assay
for cell growth and survival. Modifications to the tetra-
zolium dye procedure giving improved sensitivity and
reliability. J Immunol Methods 89, 271–277.
45 Kabsch W & Sander C (1983) Dictionary of protein
secondary structure: pattern recognition of hydrogen-
bonded and geometrical features. Biopolymers 22, 2577–
2637.
46 Gouet P, Courcelle E, Stuart DI & Metoz F (1999)

ESPript: analysis of multiple sequence alignments in
PostScript. Bioinformatics 15, 305–308.
Supporting information
The following supporting information is available:
Fig. S1. Stereoview of a representative portion of the
final electron density map contoured at 1 sigma level.
The Figure was drawn with pymol.
This supporting information can be found in the
online version of this article.
Please note: Blackwell Publishing are not responsible
for the content or functionality of any supporting
information supplied by the authors. Any queries
(other than missing material) should be directed to the
corresponding author for the article.
Erwinia carotovora L-asparaginase A. C. Papageorgiou et al.
4316 FEBS Journal 275 (2008) 4306–4316 ª 2008 The Authors Journal compilation ª 2008 FEBS