Báo cáo khoa học: Cloning of type 1 cannabinoid receptor in Rana esculenta reveals differences between genomic sequence and cDNA pot

Cloning of type 1 cannabinoid receptor in Rana
esculenta reveals differences between genomic sequence
and cDNA
Rosaria Meccariello
1
, Rosanna Chianese
2
, Gilda Cobellis
2
, Riccardo Pierantoni
2
and Silvia Fasano
2
1 Dipartimento di Studi delle Istituzioni e dei Sistemi Territoriali, Universita
`
di Napoli ‘Parthenope’, Naples, Italy
2 Dipartimento di Medicina Sperimentale, Sez. ‘F. Bottazzi’, II Universita
`
di Napoli, Naples, Italy
Cannabinoid receptors (CNRs) bind D
9
-tetrahydrocan-
nabinol, the major active constituent of the marijuana
plant, Cannabis sativa, and some endogenous lipidic
mediators collectively termed ‘endocannabinoids’ [1,2].
The best known endogenous ligands for CNRs are
anandamide (arachidonoylethanolamide, AEA), 2-arach-
idonoylglycerol, the noladin ether (2-arachidonyl glyce-
rylether), virodhamine (o-arachidonoyletha lamine), and
N-arachidonoyldopamine [1,2]. Apart from CNRs and
their ligands, the endocannabinoid system comprises a

specific AEA membrane transporter, a fatty acid amide
hydrolase, responsible for AEA degradation to etha-
nolamine and arachidonic acid, and an N-acyl-phos-
phatidylethanolamines-hydrolyzing phospholipase D,
Keywords
cannabinoid receptor; frog; nonsynonymous
mutations; post-transcriptional modifications;
synonymous mutations
Correspondence
R. Pierantoni, Dipartimento di Medicina
Sperimentale, Sez. ‘F. Bottazzi’, II Universita
`
di Napoli, via Costantinopoli 16, 80138
Napoli, Italy
Fax: +39 081 5667536 00
Tel: +39 081 5667617
E-mail:
Database
The sequences reported in this paper have
been deposited in the GenBank database
under the accession numbers AM113546,
AM260468 and AM260467 for frog cnr1
brain, testis cDNA and genomic DNA,
respectively
(Received 8 January 2007, revised 3 April
2007, accepted 5 April 2007)
doi:10.1111/j.1742-4658.2007.05824.x
The endocannabinoid system is a conserved system involved in the modula-
tion of several physiologic processes, from the activity of the central ner-
vous system to reproduction. Type 1 cannabinoid receptor (CNR1) cDNA

was cloned from the brain and testis of the anuran amphibian, the frog
Rana esculenta. Nucleotide identity ranging from 62.6% to 81.9% is
observed among vertebrates. The reading frame encoded a protein of 462
amino acids (FCNR1) with all the properties of a membrane G-coupled
receptor. Alignments of FCNR1 with those of other vertebrates revealed
amino acid identity ranging from 61.9% to 88.1%; critical domains for
CNR1 functionality were conserved in the frog. As nucleotide differences
of cnr1 cDNA were observed in brain and testis, the genomic sequence of
the cnr1 gene was also determined in the same tissue preparations. Nucleo-
tide changes in codons 5, 30, 70, 186, 252 and 408 were observed when
cDNA and genomic DNA were compared; the nucleotide differences did
not affect the predicted amino acid sequences, except for changes in codons
70 and 408. Interestingly, the predicted RNA folding was strongly affected
by different nucleotide sequences. Comparison of cnr1 mRNA sequences
available in GenBank with the corresponding genomic sequences revealed
that also in human, rat, zebrafish and pufferfish, nucleotide changes
between mRNA and genomic sequences occurred. Furthermore, amino
acid sequences deduced from both mRNA and the genome were compared
among vertebrates, and also in pufferfish the nucleotide changes correspon-
ded to modifications in the amino acid sequence. The present results indi-
cate for the first time that changes in nucleotides may occur in cnr1
mRNA maturation and that this phenomenon might not be restricted to
the frog.
Abbreviations
AEA, arachidonoylethanolamide; CD, cytoplasmic domain; CNR, cannabinoid receptor; ED, extracellular domain; TM, transmembrane
domain.
FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS 2909
enzymatic machinery that is responsible for the release,
on demand, of AEA from membrane N-acyl-phospha-
tidylethanolamines [3]. Currently, two CNR subtypes

have been characterized: type 1 (CNR1) is widely
expressed in the nervous system and in several per-
ipheral tissues, including the pituitary gland and
reproductive tissues [4,5]; type 2 (CNR2) is mainly
expressed in the immune system [6,7]. Splice variants
of CNR1 (named CNR1a and CNR1b), with different
pharmacologic effects and expression rates, have been
described in humans [5,8]. Furthermore, the presence
of additional CNR subtypes (CNRx) has been postula-
ted in mice [9].
The endocannabinoid system is highly conserved in
evolution. Orthologs of the human CNR1 receptor
gene (cnr1) have been cloned and sequenced in mam-
mals [10]. Furthermore, cnr1 orthologs have been
cloned and sequenced in fish [11–13], in urodele and
anuran amphibians [14,15], and in birds [16]. Reptilian
species have not yet been investigated. As well as in
vertebrates, the cnr1 gene has been cloned in an uro-
chordate, the sea squirt Ciona intestinalis [17], and its
high expression has been described in the cerebral gan-
glion, branchial pharynx, heart and testis [18]. In inver-
tebrates, the occurrence of endocannabinoid receptor
activity has been reported in sea urchins, molluscs, anne-
lids and cnidarians [19–21]. In addition, the investiga-
tion of cnr1 orthologs in the genomes of Drosophila
melanogaster and Caenorhabditis elegans was unsuc-
cessful, and no binding sites for CNR1 synthetic lig-
ands have been found in several insect species [21]. In
this respect, the first appearance of the endocannabi-
noid system might be evolutionarily related to that in

deuterostomian organisms [10,21].
CNR1 is a membrane G-protein coupled receptor
with seven transmembrane-spanning regions [22].
The signal transduction pathway elicited by CNR1
comprises inhibition of adenylylcyclase via G
i
pro -
tein and consequent activation ⁄ inhibition of Ca
2+
and K
+
channels; activation of mitogen-activated
protein kinase has also been reported [23]. Besides
the classical CNR1 and CNR2 receptors, AEA
interacts with K
+
and Ca
2+
channels, as well as
5-hydroxytryptamine-3 receptor and the type 1 vanil-
loid receptor, a ligand-gated and nonselective cati-
onic channel [24]. Furthermore, AEA produced after
Ca
2+
mobilization has recently been proposed as an
intracellular messenger regulating ion channel activity
by binding the type 1 vanilloid receptor channels on
the cytoplasmic bilayer interface [25]. Interestingly,
CNR1 homodimerization and heterodimerization [26]
represent a further amplification of cannabinergic

signalling potency.
Therefore, due to the great complexity of the endo-
cannabinoid system, the widespread distribution outside
the nervous system and the high degree of evolutionary
conservation, detailed CNR1 molecular characterization
among species may be useful to elucidate the activity of
endocannabinoids at multiple levels. As a previous
report indicates that the endocannabinoid system oper-
ates in the brain and testis of the frog Rana esculenta
[27], we took advantage of this model to obtain know-
ledge of the molecular cloning and characterization of
CNR1.
We report for the first time the detection of nucleo-
tide differences among brain cDNA, testis cDNA and
genomic sequences, together with the corresponding
amino acid variations. We have also investigated whe-
ther or not this phenomenon is present in other verteb-
rate species studied so far.
Results
cnr1 molecular cloning and receptor
characterization from brain preparations
R. esculenta cnr1 partial cDNA was obtained by a
combination of RT-PCR and 3¢-RACE (Table 1). The
characterized R. esculenta brain cnr1 cDNA (fcnr1)is
1586 bp long, and comprises: (a) a 5¢-UTR 12 bp long;
(b) a coding region of 1389 bp encoding a protein of
462 amino acids; and (c) a complete 3¢-UTR 169 bp
long containing a canonical polyadenylation site at
1522 bp.
The fcnr1 nucleotide sequence was compared with

those of other vertebrates [mammals (cat, rat, mouse,
chimp, monkey and human), amphibians (the anuran
Xenopus laevis and the urodele Taricha granulosa),
birds (the zebrafinch Taeniopygia guttata) and teleost
fish (Fugu rubripes, whose genome contains a cnr1 gene
named cnr1a and a paralogous gene named cnr1b, and
Danio rerio)] as well as invertebrates (the urochordate
sea squirt C. intestinalis). cnr1 sequences from other
vertebrates and invertebrates containing only a partial
coding sequence were not considered in this study.
Alignments, conducted by lalign and clustalw
multiple alignments, revealed a nucleotide identity ran-
ging from 62.6% to 81.9% among vertebrates, and
46.5% against C. intestinalis (Table 2). A protein of
462 amino acid residues with a predicted molecular
mass of 51.89 kDa was deduced from the nucleotide
sequence. Also, the deduced CNR1 amino acid
sequence of R. esculenta (FCNR1) was compared with
those of known CNR1s, revealing an amino acid iden-
tity ranging from 61.9% to 88.1% among vertebrates
and of 21.5% in C. intestinalis (Table 2). A complete
Cloning of cnr1 in frog R. Meccariello et al.
2910 FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS
alignment of known CNR1 proteins is reported in
Fig. 1; interestingly, the lowest amino acid identity is
in the N-terminal region of the receptor (amino acids
1–72) (Fig. 1).
A rooted phylogenetic tree was constructed using
the phylip drawgram method and exported by
clustalw (Fig. 2). On the basis of the estimated phy-

logenetic relationship among the CNR1s in verte-
brates, we confirm a relative divergence between
CNR1 sequences of the anuran and the urodele
amphibians [15].
bioinformatic was then used for further characteri-
zation of FCNR1. Seven hydrophobic domains, typical
of the G-coupled transmembrane receptor, were pre-
dicted by tmap and tmhmm software (Fig. 3). The
four extracellular domains (ED1–4) comprise amino
acid residues 1–109 (ED1), 168–181 (ED2), 248–266
(ED3), and 360–368 (ED4); transmembrane domains
(TM1–7) comprise amino acid residues 110–132
(TM1), 145–167 (TM2), 182–204 (TM3), 225–247
(TM4), 267–289 (TM5), 337–359 (TM6), and 369–391
(TM7); the four cytoplasmic domains (CD1–4) com-
prise amino acid residues 133–144 (CD1), 205–224
(CD2), 290–336 (CD3), and 392–462 (CD4).
Although the highest nucleotide and amino acid
identity was observed among amphibians, a lower
degree of conservation was detected in ED1; in partic-
ular, in R. esculenta, seven consecutive amino acid resi-
dues were completely missing as compared with other
amphibian species (Fig. 1).
Several putative high-confidence phosphorylation
residues (serine, threonine and thyrosine) were predic-
ted by netphos 2.0 software (Fig. 3).
Critical domains for CNR1 functionality in the
other vertebrates were conserved in the frog (Fig. 3).
Among them were: (a) dual sites for N-linked
Table 1. Primer sequences and PCR programs used for genomic and cDNA fcnr1 amplification.

Primer Source Primer sequence (5¢–to3¢) PCR program Size (bp)
P1
P2
X. laevis
X. laevis
CAGTTCTTCCTCTGTTTGGGTGGAAC
CCATAAGAGGGCCCCAACAAATG
95 °C, 5 min;
94 °C for 30 s,
58 °C for 45 s,
72 °C for 1 min, 35 cycles;
72 °C for 7 min
339
P3
P2
Degenerate
R. esculenta
GCTTCATGATTCT(GT)A(AC)(CT)CC(AC)AG
CCATAAGAGGGCCCCAACAAATG
95 °C for 5 min;
94 °C for 45 s,
50 °C for 45 s,
72 °C for 45 s, 5 cycles;
94 °C for 45 s,
45 °C for 45 s,
72 °C for 45 s, 30 cycles;
72 °C for 7 s
780
P5
P6

X. laevis
R. esculenta
AAAACTGGGGTAATGAAGTC
AGTAAATGTACCCAGGGTTA
95 °C for 5 min;
94 °C for 30 s,
50 °C for 30 s,
72 °C for 45 s, 5 cycles;
94 °C for 30 s,
54 °C for 30 s,
72 °C for 45 s, 35 cycles;
72 °C for 7 min
378
P7
P8
R. esculenta
Degenerate
ATTGGGGTAACCAGTGTTCT
T(GC)GC(AG)ATCTTAAC(AG)GTGCT
95 °
C for 5 min;
94 °C for 30 s,
52 °C for 30 s,
72 °C for 1 min, 5 cycles;
94 °C for 30 s,
48 °C for 30 s,
72 °C for 1 min, 25 cycles;
72 °C for 7 min
528
P9

AP
R. esculenta ACGGTCAGAACAGACATGCG
GGCCACGCGTCGACTAGTAC(T)
17
95 °C for 5 min;
94 °C for 30 s,
62 °C for 1 s,
72 °C for 1 min 30 s, 35 cycles;
72 °C for 7 min
R. Meccariello et al. Cloning of cnr1 in frog
FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS 2911
glycosylation in the N-terminal extracellular domain;
(b) potential sites for protein kinase C phosphorylation
in the first and the third intracellular regions; (c) a
conserved lysine in the third transmembrane domain
(TMD3) whose importance for receptor interaction
with bicyclic but not aminoalkylindole classes of cann-
abinoid agonists has been reported [28,29]; (d) a TQK
motif in the third cytoplasmic loop that is critical in
rat for CNR1 receptor activation of K
+
and Ca
2+
channels [30]; (e) a leucine and alanine pair in the
C-terminus of the third cytoplasmic loop implicated in
the interaction with G
s
in rat [31]; (f) two serine resi-
due within the intracellular tail, corresponding to rat
amino acid residues 426 and 430 involved in receptor

desensitization [32]; (g) a TVK sequence corresponding
to a potential protein kinase C phosphorylation site
within the intracellular tail region; and (h) a TMS
motive in the intracellular tail, corresponding to rat
amino acid residues 460–463, required for WIN55212-
2-mediated receptor internalization in AtT20-trans-
fected cells [33].
fcnr1 molecular cloning from testis preparations
A fragment of 1384 bp (codons 1–447) was cloned by
RT-PCR from frog testis. Alignment between R. escu-
lenta brain and testis cDNA revealed two nucleotide
differences in codons 186 (GGG in testis and GGA in
brain) and 252 (CTC in testis and CTA in brain). Such
modifications were constantly observed from the
sequences of three different clones isolated from differ-
ent cDNA preparations and did not correspond to
amino acid differences.
fcnr1 genomic DNA sequence analysis
To assess the possibility of post-transcriptional modi-
fications, we cloned the whole R. esculenta coding
region of cnr1 from genomic DNA preparations
obtained from the same homogenates used to pre-
pare cDNA. Similar results were obtained from
genomic DNA sequences from testis, brain and
muscle. clustalw alignments of brain cDNA, testis
Table 2. Nucleotide and amino acid identity (%) between the frog Rana esculenta CNR1 receptor and other CNR1 and CNR2 receptors. Nuc-
leotide identity is referred to the coding sequences. Accession numbers in the NCBI GenBank for cnr1 nucleotide sequences: Ciona intesti-
nalis, AB087259; Fugu rubripes cnr1a, X94401; Fugu rubripes cnr1b, X94402; Danio rerio, AY148349; Taricha granulosa, AF181894; Xenopus
laevis, AY098532; Taeniopygia guttata, AF255388; Mus musculus, AF153345; Rattus norvegicus, U40395; Felis catus, U94342; Macaca
mulatta, AF286025; Pan troglodytes, NM_001013017; Homo sapiens, NM_016083; Homo sapiens cnr1a, NM_033181; Homo sapiens cnr1b,

AY766182. Accession numbers in the NCBI GenBank for cnr2 nucleotide sequences: Danio rerio, NM_212964; Mus musculus, NM_009924;
Rattus norvegicus, NM_020543; Homo sapiens, NM_001841.
CNRs
% Nucleotide
identity
Coding
length
(nucleotides)
% Amino acid
identity
Amino acid
residues
Cnr1
Ciona intestinalis 46.5 1272 21.5 423
Danio rerio 64.9 1428 70.7 475
Fugu rubripes cnr1a 68.2 1407 73.9 467
Fugu rubripes cnr1b 62.6 1413 61.9 470
Taricha granulosa 76.6 1422 82.9 473
Xenopus laevis 81.9 1413 88.1 470
Taenyopigia guttata 74.2 1422 84.4 473
Felis catus 73 1419 82.2 472
Mus musculus 73.4 1422 83.3 473
Rattis norvegicus 73.2 1422 83.3 473
Pan troglodytes 72.2 1419 82.4 472
Macaca mulatta 72.6 1419 82.4 472
Homo sapiens 72.5 1418 82.4 472
Homo sapiens cnr1a 66.6 1236 74.4 411
Homo sapiens cnr1b 70.8 1320 80.2 439
Cnr2
Danio rerio 48.9 1038 44.0 345

Mus musculus 45.7 1044 35.6 347
Rattus norvegicus 44.4 1033 36.3 360
Homo sapiens 48.4 1082 35.6 360
Cloning of cnr1 in frog R. Meccariello et al.
2912 FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS
cDNA and genomic sequence revealed several nuc-
leotide differences (Fig. 4). Brain cDNA differed
from the genomic cnr1 sequence in codons 5, 30, 70,
186, 252, and 408. Testis cDNA differed from the
genomic cnr1 coding sequence in codons 5, 30, 70,
and 408. Owing to genomic code degeneration, these
nucleotide differences did not change the amino acid
sequence except for those concerning codon 70 and
codon 408. In fact, at the genomic level, TCA70 and
AAA408 encoded serine (S70) and lysine (K408),
respectively; in the cDNA, GCA70 and GAA408
encoded alanine (A70) and glutamic acid (E408),
respectively. A70 is located in the first extracellular
loop, just in the conserved N-linked glycosylation
domain; E408 is located in the cytoplasmic tail, in a
region suggested to be sensitive for G
i
coupling in
rat [23]. To assess whether or not similar nucleotide
differences among cnr1 cDNA and the corresponding
genomic sequences exist in vertebrates, we blasted
the mRNA sequences deposited in GenBank against
the corresponding genome database. Amino acid
sequences deduced from mRNA sequences were then
compared to those deduced from the corresponding

genomic sequences. The results of our search are
summarized in Table 3. For rat, human, zebrafish
and pufferfish cnr1b, differences between mRNA and
genomic sequences are reported. In particular, in
F. rubripes cnr1b, such nucleotide differences also
corresponded to amino acid differences.
Northern and Southern blot analysis
Northern blot analysis of R. esculenta brain and testis
mRNA was carried out using an antisense RNA probe
of 780 bp.
A signal of 2.2 kb was observed in brain and testis
(Fig. 5A). Southern blot analysis revealed a single sig-
nal of 3 kb in frog genomic DNA, previously digested
by EcoRI, indicating that fcnr1 is a single-copy gene
(Fig. 5B).
Fig. 1. Alignments of complete CNR1 amino
acid sequences. Completely conserved
amino acid residues are in black boxes;
identical amino acid residues are in light
gray boxes; similar amino acid residues are
in medium gray boxes; different amino acid
residues are in white boxes. Similarity ⁄ dif-
ferences have been highlighted with the
BOX-SHADE alignments graphic program.
R. Meccariello et al. Cloning of cnr1 in frog
FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS 2913
RNA folding analysis
A difference between brain and testis mRNA secon-
dary structure emerged (Fig. 6A,B, asterisks); several
differences in the secondary structure predicted from

brain ⁄ testis mRNA and the mRNA sequence deduced
from genomic DNA were also observed (Fig. 6C,
arrows).
Discussion
In this article, we report the molecular cloning of cnr1
from R. esculenta brain and testis. fcnr1 and FCNR1
have high nucleotide and amino acid identity (ranging
from 62.6% to 81.9% and from 61.9% to 88.1%,
respectively) as compared to those of other vertebrates.
Several critical domains for CNR1 functionality are
present in frog, suggesting an evolutionarily conserved
activity. Furthermore, analysis of cnr1 gene organiza-
tion suggests that the cnr1 coding region is contiguous
and not interrupted by intronic sequences as reported
for other vertebrates [5,8,34]. In fact, splice donor–
acceptor sites detected in mouse, rat and human,
responsible for cnr1a and cnr1b splice forms, are not
conserved in frog. Interestingly, comparison between
genomic DNA and cDNA, both obtained from frog
Fig. 1. (Continued).
Cloning of cnr1 in frog R. Meccariello et al.
2914 FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS
brain and testis, suggests the existence of nucleotide
changes in cDNA sequences. Four single-nucleotide
polymorphisms responsible for the modulation of stria-
tal response to happy faces have been reported in the
human cnr1 gene [35,36]. In the present study, we
think that the possibility of polymorphic sites may be
excluded, in that DNA and RNA preparations were
derived from the same tissue preparations collected

from five animals per month at least, and we always
confirmed our results. Furthermore, sequences
obtained from brain and testis genomic DNA were
identical. In addition, to avoid any sequence deduction
from 3¢-overlapping ends, sequencing was conducted
on both strands from three separate clones no more
than 800 bp long. Interestingly, only alterations in
codons 70 and 408 are effective in changing amino
acid residues. A70 and E408 are located in the first
extracellular domain, just in the conserved N-linked
glycosylation domain, and in the cytoplasmic tail, a
region suggested to be sensitive for G
i
coupling in rat
Fig. 3. Frog CNR1 receptor characterization. Extracellular domains are in Courier New; transmembrane domains are in bold characters; intra-
cellular domains are in italics. *Putative high-confidence phosphorylation sites; dual sites for N-linked glycosylation in the N-terminal extra-
cellular domain are underlined. ^The conserved lysine in the third transmembrane domain (TMD3). °°Leucine and alanine pair in the
C-terminus of the third cytoplasmic loop implicated in the interaction with G
s
in rat; the light gray box indicates the TQK motif in the third
cytoplasmic loop that is critical in rat for CB1 receptor activation of K
+
and Ca
2+
channels; the medium gray box indicates two serine resi-
dues within the intracellular tail that in rat are phosphorylated and involved in receptor desensitization; the dark gray box indicates a TVK
sequence corresponding to a potential protein kinase C phosphorylation site within the intracellular tail region; the black box indicates a
TMS motive in the intracellular tail that is required in rat for WIN55212-2-mediated receptor internalization in AtT20-transfected cells; the
white boxes indicate possible editing sites, and different amino acid residues predicted from brain cDNA and genomic DNA are in bold italic
characters.

Fig. 2. Phylogenetic analysis of the known vertebrate CNR1 recep-
tor. A rooted phylogenetic tree was constructed using the
PHYLIP’S
DRAWGRAM
method and exported by CLUSTALW. Branch lengths are
proportional to the estimated evolutionary distance among the
receptors.
R. Meccariello et al. Cloning of cnr1 in frog
FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS 2915
[23]; in this respect, a role in the modulation of CNR1
activity is not excluded. Finally, Southern and
northern blot analysis demonstrate that cnr1 is a
single-copy gene, and therefore the corresponding mes-
senger is detected in both brain and testis.
To verify whether or not cnr1 differences between ge-
nomic and cDNA sequences occur in other vertebrates,
we blasted all the nucleotide sequences deposited in
NCBI GenBank with the corresponding genomic avail-
able sequences; in addition, we compared all the amino
acid sequences deduced from both genomic DNA and
mRNA. It is worth noting that similar nucleotide chan-
ges occur in other species and are quite scattered among
vertebrates. However, as in the frog, most changes do
not influence the amino acid composition. Only in the
F. rubripes cnr1b gene do nucleotide changes, in codons
241 and 463, change the amino acid composition pre-
dicted by the analysis of different genomic DNA
sequences.
In both mammals and invertebrates, RNA editing
is an elaborate and precise form of post-transcrip-

tional RNA processing, powering genetic diversi-
fication [37]. In mammals, there are two main classes
of editing enzymes able to deaminate encoded
nucleotides: the former generates I (inosine) from A
(adenosine), and the latter generates U (uridine) from
C (cytidine) [38,39]. In the first case, genomically
encoded A is read as G in RNA-cDNA sequences.
Currently, the literature concerning mRNA editing is
limited to a relatively few examples. In particular, all
currently known A-to-I edited transcripts of both
mammals and invertebrates encode membrane pro-
teins in nervous tissue. These proteins function as
voltage-gated or ligand-gated ion channels or as
G protein-coupled receptors [e.g. serotonin (5-hy-
droxytryptamine 2c) receptor, non-N-methyl-d-aspar-
tate glutamate receptor channels in mammals, and
squid K
+
channels in invertebrates] [40]. Interestingly,
if the editing process occurs in frog, a GAA408
codon corresponds to the genomic AAA408 in the
cDNA, and this might be considered as an A-to-I
editing example. With respect to the significance of
nucleotide changes in cDNA that do not change the
amino acid composition predicted by the genomic
sequence, we have no explanation at present. Synony-
mous mutations in the human dopamine receptor D2
Fig. 4. Differences among fcnr1 sequences obtained from genomic DNA and cDNA isolated from brain and testis. Alignment of frog cnr1
nucleotide sequences from frog brain genome and brain and testis cDNA. Deduced amino acid sequences are in italics. Codons with nucleo-
tide differences are underlined; bold characters indicate nucleotide and amino acid differences.

Table 3. cnr1 mRNA versus cnr1 genomic DNA in vertebrates: nuc-
leotide (nt) and deduced amino acid sequence difference compar-
ison. Accession numbers in the NCBI GeneBank for cnr1 mRNA
sequences are the same as in Table 2; putative Fugu rubripes
cnr1a and cnr1b mRNA sequences were deduced from the cloned
gene sequences [11]. Accession numbers in the NCBI Gene-
Bank for cnr1 genomic sequences: Fugu rubripes cnr1a,
CAAB01001440.1; Fugu rubripes cnr1b, CAAB01001484.1; Danio
rerio, NW_634056.1; Mus musculus, NT_109315.2; Rattus norvegi-
cus, NW_047711.2; Felis catus, NM_001009331.1; Pan troglodytes,
NW_107960.1; Homo sapiens, NT_086697.1.
Species
Genome mRNA
(nucleotides)
Genome cDNA
(amino acids)
Homo sapiens CNR1A ––
Homo sapiens CNR1B nt606 (G–A) –
Pan troglodytes ––
Rattus norvegicus nt915 (T–C) –
Mus musculus ––
Felis catus ––
Danio rerio nt462 (G–T) –
nt510 (T–A) –
nt681 (T–C) –
nt777 (G–T) –
nt798 (G–A) –
Fugu rubripes CNR1A ––
Fugu rubripes CNR1B nt728 (C–A) A241–E241
nt1388 (A–C) D463–A463

brain
testis
AB
2.2 -
KB
-3.0
KB
18S -
Fig. 5. Northern blot and Southern blot analysis. (A) A band of
2200 bp is observed in both brain (1) and testis (2) mRNA by nor-
thern blot experiments. (B) A single band of 3000 bp is observed
from high-mass genomic DNA previously digested with EcoRI, indi-
cating that fcnr1 is a single-copy gene.
Cloning of cnr1 in frog R. Meccariello et al.
2916 FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS
affect mRNA stability and synthesis of the receptor
[41]. Accordingly, in the present study, synonymous
and nonsynonymous mutations weakly alter the puta-
tive mRNA folding between brain and testis mRNA;
by contrast, the secondary structure of the mRNA
predicted from the genomic sequence is substantially
different from the secondary structure of brain and
testis mRNA. In this respect, we speculate that the
nucleotide changes observed in this study may affect
RNA folding and therefore its stability and turnover.
In conclusion, apart from molecular cloning of cnr1
in R. esculenta, this is the first report showing that
changes in nucleotides occur during mRNA matur-
ation. Furthermore, we find that this phenomenon is
not restricted to the frog. Whether or not editing pro-

cesses may generate different cnr1 mRNA molecules
(with different activity ⁄ stability) in different tissues,
leading to pharmacologic applications, should be fur-
ther investigated.
Experimental procedures
Animals and tissue collection
Five male frogs of R. esculenta were collected monthly
from September until July in the neighborhood of
Naples (Italy). The animals were killed under anesthesia
with MS222 (Sigma-Aldrich Corp., St Louis, MO).
Brain, testis (for genomic and cDNA studies) and mus-
cle were removed and stored appropriately at ) 80 °C
until used. This research was approved by the Italian
Ministry of University and Scientific and Technological
Research.
Total RNA preparation
A pool of total RNA was extracted from R. esculenta tis-
sues (n ¼ 5 per month) using TRIZOL Reagent (Invitrogen
Life Technologies, Paisley, UK), following the manufac-
turer’s instructions. Total RNA was treated for 30 min
at 37 ° C with DNaseI (10 U per sample) (Amersham
Pharmacia Biotech, Chalfont St Giles, UK) to avoid any
contamination of genomic DNA; total RNA purity and
integrity were determined by spectrophotometer analyses at
260 ⁄ 280 nm and by electrophoresis.
Isolation of R. esculenta complete cnr1 coding
sequence
Pools of total RNA were reverse transcribed to prepare
cDNA. The reverse transcription was carried out using
5 lg of total RNA, 0.5 lg of anchor oligonucleotide (AP),

10 mm dNTP, 0.01 m dithiothreitol, 1 · first-strand buffer
(Invitrogen Life Technologies), 40 U of RNase Out (Invi-
trogen Life Technologies), and 200 U of SuperScript-III
RNaseH
–
reverse transcriptase (Invitrogen Life Techno-
logies), in a final volume of 20 lL, following the manufac-
turer’s instructions. As negative control, total RNA not
treated with reverse transcriptase was used.
Complementary DNA was used for PCR analysis. A
frog cDNA fragment of 339 bp corresponding to trans-
membrane segments 4 and 7 was obtained using primers
designed from X. laevis cnr1 cDNA (P1 and P2, Table 1
for details). Afterwards, rat, mouse, African clawed frog
and zebrafish cnr1 complete nucleotide sequences were
aligned by clustalw, and degenerate upper and reverse
primers were selected in highly conserved regions. To
extend the 5¢⁄3¢ sequence, combinations of degener-
Fig. 6. mRNA folding analysis. Secondary
structure of the overlapping fragments of
1354 bp from brain mRNA (A), testis mRNA
(B) and the mRNA sequence deduced from
genomic DNA (C). Hatched circles mark the
regions with the main differences between
the cloned mRNA and the mRNA sequence
deduced from genomic DNA. Asterisks indi-
cate the difference between brain and testis
mRNA; arrows indicate the main differences
in mRNA deduced from genomic DNA. Bold
circles mark the magnification of the secon-

dary structure of brain and testis mRNA.
Structures have been selected on the basis
of minimal dG (free energy) values.
R. Meccariello et al. Cloning of cnr1 in frog
FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS 2917
ate ⁄ specific primers were used. Primer sequences and
PCR program details are summarized in Table 1. All
PCR analyses were conducted in an Applied Biosystem
Thermocycler apparatus using 1 lL of diluted cDNA or
100 ng of genomic DNA and the high-fidelity TaKaRa
Ex Taq (Cambrex Bio Science, Milan, Italy). Amplification
products were subcloned in pGEM-T Easy Vector (Promega
Corporation, Madison, WI). DH5 a high-efficiency compet-
ent cells were transformed, and recombinant colonies were
identified by blue ⁄ white color screening. Plasmidic DNA
was extracted by NucleoBond Plasmid extraction kit
(Macherey-Nagel, Du
¨
ren, Germany), and insert size was
controlled by restriction analysis with EcoRI (Fermentas
GmbH, St Leon-Rot, Germany). DNA was then se-
quenced on both strands by Primm Sequence Service
(Primm srl, Naples, Italy). Finally, frog cnr1 mRNA and
genomic nucleotide sequences were obtained by compar-
ing overlapping fragments, and amino acid sequences
were deduced.
Sequence analysis
Nested amplification products, obtained independently
from separate amplification reactions, were sequenced in
both forward and reverse strands, and the cnr1 mRNA

sequence was deduced by comparing overlapping fragments
of the two complementary strands.
On the basis of the nucleotide sequence, the R. esculenta
CNR1 amino acid sequence was deduced. In order to esta-
blish the degree of CNR1 identity among vertebrates, both
the nucleotide coding sequence and the amino acid
sequence of R. esculenta CNR1 were aligned with other
known CNR1 ⁄ CNR2 complete coding sequences and
amino acid sequences available in the NCBI GenBank by
align and clustalw multiple alignments.
After alignments of vertebrate CNR1 amino acid
sequences, a phylogenetic tree was constructed using phylip’s
drawgram and exported from clustalw.
Finally, putative transmembrane domains, N-linked gly-
cosylation sites and phosphorylation sites were predicted by
using, respectively, tmap, tmhmm, netnglyc 1.0 Server,
and netphos 2.0 Server, available at SDSC Biology Work-
bench ( and at ExPASy Proteo-
mics Server ( />cnr1 ORF prediction from genomic sequences
of several vertebrate
To assess the presence of nucleotide differences between
cDNA and t he corresponding genomic sequen ces in
vertebrates, cnr1 cDNA sequences deposited in NCBI
GenBank were blasted against the corresponding geno-
mic data base (see Table 3 for details). Amino acid
sequences were deduced from the corresponding genomic
cnr1 sequences and compared to those predicted from
cDNA.
Northern blot
Ten micrograms per lane of total brain and testis RNA pre-

viously denatured with glyoxal and dimethylsulfoxide was
electrophoresed on 1.4% agarose gel and blotted on nylon
membranes (Nytran; Amersham Pharmacia Biotech). An
antisense RNA probe complementary to the cloned 780 bp
fragment of fcnr1 mRNA was produced using the nonradio-
active, digoxigenin (DIG)-based system DIG RNA Label-
ling Kit (SP6 ⁄ T7) (Roche, Mannhein, Germany), following
the manufacturer’s instruction. In brief, 6 lg of pGEM-T-
fcb1 recombinant plasmid was linearized by digestion with
Pst1 (Fermentas GmbH), and transcription was carried out
in vitro using T7 RNA polymerase and a mixture of dNTP
and DIG-11-UTP.
Blots were prehybridized and probed at 65 °C in Church’s
buffer (0.5 m NaCl ⁄ P
i
, pH 7.4, 7% SDS, 0.5 mm EDTA,
and 100 mgÆmL
)1
sonicated salmon sperm); 100 ngÆmL
)1
labeled probe was then added in hybridization buffer. The
membrane was washed twice at room temperature for 5 min
in low-stringency buffer (2 · NaCl ⁄ Cit, 0.1% SDS), and
then twice at 65 °C in high-stringency buffer (0.2 · NaCl ⁄
Cit, 0.1% SDS). The chemiluminescent protocol for the
detection of DIG-labeled probes suggested by Roche was
then used. After incubation with the chemiluminescent alka-
line phosphatase substrate CSPD (Roche), the filter was
exposed for a suitable time to Hyperfilm Kodak (Rochester,
NY) autoradiographic film.

Genomic DNA extraction and Southern blot
analysis
High molecular mass DNA was extracted and purified by
standard techniques [42] from frog tissues (n ¼ 5 per
month). Genomic DNA extracted from muscle (10 lg)
was digested with EcoRI, BamHI or HindIII (Fermentas
GmbH) and analyzed by electrophoresis and Southern blot
using a 780 bp frog fcnr1 DIG-labeled probe. The probe
was labeled by random priming, and hybridization was
conducted at 50 °C using the DIG-High Prime DNA
Labelling and Detection Starter Kit II (Roche), following
the manufacturer’s instruction.
mRNA folding analysis
Prediction of the secondary structure of RNA and DNA
was conducted by using mfold software, available at
/>[43,44]. This analysis was restricted to the overlapping frag-
ments of 1354 bp from testis mRNA, brain mRNA and
genomic DNA.
Cloning of cnr1 in frog R. Meccariello et al.
2918 FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS
Acknowledgements
This work was supported by grants from PRIN-Pier-
antoni 2002 and 2005, Regione Campania L.5.
References
1 Mechoulam R (2002) Discovery of endocannabinoids
and some random thoughts on their roles in neuro-
protection and aggression. Prostaglandins Leukot Essent
Fatty Acids 66, 93–99.
2 De Petrocellis L, Cascio MG & Di Marzo V (2004) The
endocannabinoid system: a general view and latest addi-

tions. Br J Pharmacol 141, 765–774.
3 Okamoto Y, Morishita J, Tsuboi K, Tonai T & Ueda
N (2004) Molecular characterization of a phospholipase
D generating anandamide and its congeners. J Biol
Chem 279, 5298–5305.
4 Galiegue S, Mary S, Marchand J, Dussossoy D,
Carriere D, Carayon P, Bouaboula M, Shire D, Le Fur
G & Casellas P (1995) Expression of central and periph-
eral cannabinoid receptors in human immune tissues
and leukocyte subpopulations. Eur J Biochem 232,
54–61.
5 Shire D, Carillon C, Kaghad M, Calandra B,
Rinaldi-Carmona M, Le Fur G, Caput D & Ferrara P
(1995) An amino-terminal variant of the central canna-
binoid receptor resulting from alternative splicing. J Biol
Chem 270, 3726–3731.
6 Shire D, Calandra B, Rinaldi-Carmona M, Oustric D,
Passegue B, Bonnin-Cabanne O, Le Fur G, Caput D &
Ferrara P (1996) Molecular cloning, expression and
function of the murine CB2 peripheral cannabinoid
receptor. Biochim Biophys Acta 1307, 132–136.
7 Brown SM, Wager-Miller J & Mackie K (2002)
Cloning and molecular characterization of the rat CB2
cannabinoid receptor. Biochim Biophys Acta 1576,
255–264.
8 Ryberg E, Vu HK, Larsson N, Groblewski T, Hjorth S,
Elebring T, Sjogren S & Greasley PJ (2005) Identifica-
tion and characterization of a novel splice variant of the
human CB1 receptor. FEBS Lett 57, 259–264.
9 Wiley JL & Martin BR (2002) Cannabinoid pharma-

cology: implications for additional cannabinoid receptor
subtypes. Chem Phys Lipids 121, 57–63.
10 Elphick MR & Egertova
`
M (2001) The neurobiology
and evolution of cannabinoid signalling. Philos Trans R
Soc Lond B Biol Sci 356, 381–408.
11 Yamaguchi F, Macrae AD & Brenner S (1996) Molecu-
lar cloning of two cannabinoid type 1-like receptor
genes from the puffer fish Fugu rubripes. Genomics 35,
603–605.
12 Cottone E, Forno S, Campantico E, Guastalla A,
Viltono L, Mackie K & Franzoni MF (2005) Expression
and distribution of CB1 cannabinoid receptors in the
central nervous system of the African cichlid fish Pelvi-
cachromis pulcher. J Comp Neurol 485, 293–303.
13 Valenti M, Cottone E, Martinez R, De Pedro N,
Rubio M, Viveros MP, Franzoni MF, Delgrado MJ
& Di Marzo V (2005) The endocannabinoid system
in the brain of Carassius auratus and its possible role
in the control of food intake. J Neurochem 95, 662–
672.
14 Soderstrom K, Leid M, Moore FL & Murray TF
(2000) Behavioural, pharmacological, and molecular
characterization of an amphibian cannabinoid receptor.
J Neurochem 75, 413–423.
15 Cottone E, Salio C, Conrath M & Franzoni MF (2003)
Xenopus laevis CB1 cannabinoid receptor: molecular
cloning and mRNA distribution in the central nervous
system. J Comp Neurol 464, 487–496.

16 Soderstrom K & Johnson F (2001) Zebra finch CB
1
cannabinoid receptor pharmacology and in vivo and
in vitro effects of activation. J Pharmacol Exp Ther 297,
189–197.
17 Elphick MR, Satou Y & Satoh N (2003) The inverte-
brate ancestry of endocannabinoid signalling: an ortho-
logue of the vertebrate cannabinoid receptors in the
urochordate Ciona intestinalis . Gene 302, 95–101.
18 Matias I, McPartland JM & Di Marzo V (2005) Occur-
rence and possible biological role of the endocann-
abinoid system in the sea squirt Ciona intestinalis.
J Neurochem 93, 1141–1156.
19 Chang MK, Berkery D, Schuel R, Laychock SG,
Zimmerman AM, Zimmerman S & Schuel H (1993)
Evidence for a cannabinoid receptor in sea urchin sperm
and its role in blockade of the acrosome reaction. Mol
Reprod Dev 36, 507–516.
20 De Petrocellis L, Melck D, Bisogno T, Milone A &
Di Marzo V (1999) Finding of the endocannabinoid
signalling system in Hydra, a very primitive organism:
possible role in the feeding response. Neuroscience 92,
377–387.
21 Salzet M & Stefano GB (2002) The endocannabinoid
system in invertebrates. Prostaglandins Leukot Essent
Fatty Acids 66, 353–361.
22 Matsuda LA, Lolait SJ, Brownstain MJ, Young AC &
Bonner TI (1990) Localization of cannabinoid receptor
mRNA in rat brain. J Comp Neurol 346, 561–564.
23 Mukhopadhyay S, Shim JY, Assi AA, Norford D &

Howlett AC (2002) CB(1) cannabinoid receptor–G
protein association: a possible mechanism for differen-
tial signalling. Chem Phys Lipids 121, 91–109.
24 Di Marzo V, De Petrocellis L, Fezza F, Ligresti A &
Bisogno T (2002) Anandamide receptors. Prostaglandins
Leukot Essent Fatty Acids 66, 377–391.
25 van der Stelt M, Trevisani M, Vellani V, De Petrocellis
L, Schiano Morello A, Campi B, McNaughton P,
Geppetti P & Di Marzo V (2005) Anandamide acts as
R. Meccariello et al. Cloning of cnr1 in frog
FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS 2919
an intracellular messenger amplifying Ca(2+) influx via
TRPV1 channels. EMBO J 24, 3517–3528.
26 Mackie K (2005) Cannabinoid receptor homo- and
heterodimerization. Life Sci 77, 1667–1673.
27 Meccariello R, Chianese R, Cacciola G, Cobellis G,
Pierantoni R & Fasano S (2006) Type-1 cannabinoid
receptor expression in the frog, Rana esculenta, tissues:
a possible involvement in the regulation of testicular
activity. Mol Reprod Dev 73, 551–558.
28 Song ZH & Bonner TI (1996) A lysine residue of the
cannabinoid receptor is critical for receptor recognition
by several agonists but not WIN55212-2. Mol Pharma-
col 49, 891–896.
29 Chin CN, Lucas-Lenard J, Abadji V & Kendall DA
(1998) Ligand binding and modulation of cyclic AMP
levels depend on the chemical nature of residue 192 of
the human cannabinoid receptor 1. J Neurochem 70,
366–373.
30 Garcia DE, Brown S, Hille B & Mackie K (1998) Pro-

tein kinase C disrupt cannabinoid action by phosphory-
lation of the CB1 cannabinoid receptor. J Neurosci 18,
2834–2841.
31 Abadji V, Lucas-Lenard JM, Chin C & Kendall DA
(1999) Involvement of the carboxyl terminus of the
third intracellular loop of the cannabinoid CB1 receptor
in constitutive activation of Gs. J Neurochem 72,
2032–2038.
32 Jin W, Brown S, Roche JP, Hsieh C, Celver JP, Kovoor
A, Chavkin C & Mackie K (1999) Distinct domains of
the CB1 cannabinoid receptor mediate desensitization
and internalization. J Neurosci 19, 3773–3780.
33 Hsieh C, Brown S, Derleth C & Mackie K (1999) Inter-
nalization and recycling of the CB1 cannabinoid recep-
tor. J Neurochem 73, 493–501.
34 Abood ME, Ditto KE, Noel MA, Showalter VM &
Tao Q (1997) Isolation and expression of a mouse CB1
cannabinoid receptor gene. Biochem Pharmacol 53,
207–214.
35 Zhang PW, Ishiguro H, Ohtsuki T, Hess J, Carillo F,
Walther D, Onaivi ES, Arinami T & Uhl GR (2004)
Human cannabinoid receptor 1: 5¢exons, candidate reg-
ulatory regions, polymorphisms, haplotypes and associ-
ation with poly-substance abuse. Mol Psychiatry 9,
916–931.
36 Chakrabarti B, Kent L, Suckling J, Bullmore E &
Baron-Cohen S (2006) Variations in the human canna-
binoid receptor (CNR1) gene modulate striatal
responses to happy faces. Eur J Neurosci 23, 1944–1948.
37 Wedekind JE, Dance GSC, Sowden MP & Smith HC

(2003) Messenger RNA editing in mammals: new mem-
bers of the APOBEC family seeking roles in the family
business. Trends Genet 19, 207–216.
38 Seeburg PH (2002) A-to-I editing: new and old sites,
functions and speculations. Neuron 35, 17–20.
39 Blanc V & Davidson NO (2003) C-to-U RNA editing:
mechanisms leading to genetic diversity. J Biol Chem
278, 1395–1398.
40 Seeburg PH & Hartner J (2003) Regulation of ion
channel ⁄ neurotransmitter receptor function by RNA
editing. Curr Opin Neurobiol 13, 279–283.
41 Duan J, Wainwright MS, Comeron JM, Saitou N,
Sanders AR, Gelernter J & Gejman PV (2003) Synon-
ymous mutations in the human dopamine receptor D2
(DRD2) affect mRNA stability and synthesis of the
receptor.
Hum Mol Genet 12, 205–216.
42 Sambrook J, Fritsch EF & Maniatis T (1989) Molecular
Cloning: a Laboratory Manual, 2nd edn, pp. 280–281.
Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY.
43 Zuker M (2003) Mfold web server for nucleic acid fold-
ing and hybridization prediction. Nucleic Acids Res 31,
3406–3415.
44 Mathews DH, Sabina J, Zuker M & Turner DH (1999)
Expanded sequence dependence of thermodynamic para-
meters improves prediction of RNA secondary struc-
ture. J Mol Biol 288, 911–940.
Cloning of cnr1 in frog R. Meccariello et al.
2920 FEBS Journal 274 (2007) 2909–2920 ª 2007 The Authors Journal compilation ª 2007 FEBS