Báo cáo khoa học: The subcellular localization of vaccinia-related kinase-2 (VRK2) isoforms determines their different effect on p53 stability in tumour cell lines pdf

The subcellular localization of vaccinia-related kinase-2
(VRK2) isoforms determines their different effect on p53
stability in tumour cell lines
Sandra Blanco, Lucia Klimcakova, Francisco M. Vega and Pedro A. Lazo
Instituto de Biologı
´
a Molecular y Celular del Ca
´
ncer, Consejo Superior de Investigaciones Cientı
´
ficas (CSIC), Universidad de Salamanca,
Spain
In the human kinome the vaccinia-related kinase
(VRK) protein family has been identified as a distinct
subfamily that diverged early in evolution from the
branch leading to the casein kinase I (CKI) group [1].
This branch has 13 different proteins grouped into
three subfamilies, VRK, TTBK and CKI [1]. Neverthe-
less, in lower eukaryotes there is only one homologue
gene; thus in Caenorhabditis elegans, the homologue
gene is 2D213 [2] and it is CG6386 in Drosophila [3].
The unique family homologues in Schizosaccharomyces
pombe and Saccharomyces cerevisiae are the Hhp1 and
Hrr25 genes, respectively [4], and both implicated in
the response to genotoxic damage [5,6].
The catalytic domain of VRK proteins shares
homology with the vaccinia virus early gene, B1R [7],
which is required for viral DNA replication [8–10]. In
Keywords
p53; phosphorylation; Ser-Thr kinase; VRK2
Correspondence

P. A. Lazo, IBMCC-Centro de Investigacio
´
n
del Ca
´
ncer, CSIC-Universidad de Salamanca,
Campus Miguel de Unamuno, E-37007
Salamanca, Spain
Fax: +34 923 294 795
Tel: +34 923 294 804
E-mail:
Database
Sequence VRK2B has been submitted to
the GenBank database under the accession
number AJ512204.
(Received 30 January 2006, revised 29
March 2006, accepted 31 March 2006)
doi:10.1111/j.1742-4658.2006.05256.x
VRK is a new kinase family of unknown function. Endogenous human
vacinia-related kinase 2 (VRK2) protein is present in both the nucleus and
the cytosol, which is a consequence of alternative splicing of two VRK2
messages coding for proteins of 508 and 397 amino acids, respectively.
VRK2A has a C-terminal hydrophobic region that anchors the protein to
membranes in the endoplasmic reticulum (ER) and mitochondria, and it
colocalizes with calreticulin, calnexin and mitotracker; whereas VRK2B is
detected in both the cytoplasm and the nucleus. VRK2A is expressed in all
cell types, whereas VRK2B is expressed in cell lines in which VRK1 is
cytoplasmic. Both VRK2 isoforms have an identical catalytic N-terminal
domain and phosphorylate p53 in vitro uniquely in Thr18. Phosphorylation
of the p53 protein in response to cellular stresses results in its stabilization

by modulating its binding to other proteins. However, p53 phosphorylation
also occurs in the absence of stress. Only overexpression of the nuclear
VRK2B isoform induces p53 stabilization by post-translational modifica-
tion, largely due to Thr18 phosphorylation. VRK2B may play a role in
controlling the binding specificity of the N-terminal transactivation domain
of p53. Indeed, the p53 phosphorylated by VRK2B shows a reduction in
ubiquitination by Mdm2 and an increase in acetylation by p300. Endo-
genous p53 is also phosphorylated in Thr18 by VRK2B, promoting its
stabilization and transcriptional activation in A549 cells. The relative phos-
phorylation of Thr18 by VRK2B is similar in magnitude to that induced
by taxol, which might use a different signalling pathway. In this context,
VRK2B kinase might functionally replace nuclear VRK1. Therefore, these
kinases might be components of a new signalling pathway that is likely to
play a role in normal cell proliferation.
Abbreviations
ER, endoplasmic reticulum; VRK2, vaccinia-related kinase 2.
FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2487
mammals, the VRK family has three members. The
kinase domain of the VRK proteins shows relatively
weak conservation [1], but is catalytically active for
VRK1 [11–14] and VRK2, although not for VRK3
[13]. VRK1 has a nuclear localization signal and is
detected in the nucleus in some cell lines and in trans-
fected cells [11,13], but it is also present in the cytosol
in other cell lines [15], particularly in some types of
adenocarcinoma (unpublished results); however, the
regulation and coordination of the subcellular localiza-
tion of different VRK proteins are unknown. The
VRK1 protein is able to phosphorylate several tran-
scription factors such as p53 [11,15], c-Jun16, and

ATF2 [17]. VRK1 and VRK2 share 61% identity in
their catalytic domains, with no conservation in other
parts of the protein, suggesting functional differences
between the two kinases that have yet to be character-
ized. It has been postulated that this protein family
might play a role in proliferation because they are
highly expressed in early haematopoietic development
in murine embryos [18], in tissues containing prolifera-
tive cells and in tumour cells [7]. VRK1 is expressed at
very high levels in retinal neurons and its expression
decreases dramatically the first day after birth [19], it
also correlates with proliferation markers in head and
neck squamous carcinomas [20]. In chronic myelogen-
ous leukaemia, expression of VRK1 can differentiate
those who will respond to imatinib treatment from
those who will not [21]. In B cells, analysis by quanti-
tative MS indicates that it is downregulated when Myc
expression is induced [22]. VRK1 is also regulated in
response to peroxixome proliferators in murine hepato-
cytes [23]. VRK1 expression is activated in E2F and
inhibited by p16 and in nonphosphorylated retinoblas-
tomas [24]. The data available on VRK2 are much
more limited. VRK2 is downregulated in human
mononuclear B cells during the innate immune
response to bacteria [25], and upregulated in T cells by
CD3 ligation and if costimulated by CD28 [26].
VRK1 contributes to p53 stability via two mecha-
nisms, one of which is dependent on Thr18 phosphory-
lation. It also appears to be implicated in the control
of normal proliferation in the absence of cellular stress,

and its inactivation by specific RNA interference
blocks cell division [15], consistent with observations
in C. elegans, where it is embryonic lethal. In adult
C. elegans there is a slowdown in growth suggesting
problems in cell-cycle progression [2]. The p53 protein
plays a major role in controlling the cell response to
many types of cellular stress [27,28], and its intracellu-
lar levels appear to determine the susceptibility of a
cell to tumour development [29,30]. Regulation of p53
protein levels and transcriptional activity are therefore
critical to allow for both normal cell division and
tumour suppression, while retaining the capacity for
rapid induction in response to genotoxic stress [31,32].
Thus, its levels are tightly regulated, mainly by phos-
phorylation [33].
Several kinases are implicated in the stability of p53
by targeting at least seven different residues in its
N-terminal transactivation domain [34,35], each
modulated by different types of stimulation [36–41].
Therefore, there are functional differences regarding
p53 stability or transcriptional activity depending on
the residue phosphorylated [42,43]. Phosphorylation of
human p53 at Ser15 or Ser20 (equivalent to murine
Ser18 and Ser23) promotes p300 recruitment and
therefore its acetylation by p300 [43–45], but p53 can
also be stabilized in the absence of phosphorylation of
these two residues [46]. Moreover, phosphorylation of
murine Ser18 (human Ser15) is not necessary for p53
tumour suppression [47]. Cells also need to have a
basic mechanism that maintains a basal level of p53

in a state of readiness and able to respond to any
stress that may arise in normal life, when most cells
are in interphase [15]. More recently, phosphorylation
of p53 in Thr18 (Thr21 in murine p53) has acquired
more relevance [48], because it is implicated in both
the p53–Mdm2 interaction and p300 recruitment. This
residue is phosphorylated by casein kinase I delta only
when it has previously been phosphorylated at Ser15
[49,50], but this kinase is cytosolic in interphase [51];
Thr18 is uniquely phosphorylated by the nuclear
VRK1 protein [11,15]. Phosphorylation at Thr18 redu-
ces binding to the p53-negative regulator Mdm2, and
promotes its interaction with the cofactor p300.
Mdm2 catalyses the ubiquitination of p53 and its
subsequent proteolytic degradation [52–54]. p300
acetylates p53 at its C-terminus, promoting its
transcriptional activation [55–58]. The functional con-
sequences of Thr18 phosphorylation are p53 stabil-
ization and the activation of p53-dependent gene
transcription [15]. Phosphorylation of Thr18 has been
detected in cells treated with taxol and some other
drugs [33,59], as well as in cellular senescence [60],
suggesting that several signalling pathways are
involved.
We identified that VRK2 has different subcellular
localizations corresponding to expression of two iso-
forms by the human VRK2 gene. Their expression var-
ies depending on the cell type. Both isoforms have
similar properties regarding their phosphorylation sub-
strates and the specific phosphorylation of p53 in vitro.

The nuclear VRK2B isoform might be functionally
redundant with VRK1, and seems to be expressed in
cells in which VRK1 is localized in the cytoplasm. In
Differential stabilization of p53 by VRK2 isoforms S. Blanco et al.
2488 FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS
cells lacking nuclear VRK1 this nuclear isoform might
regulate p53 mainly by phosphorylation.
Results
Localization of the endogenous human
VRK2 protein
First we determined the subcellular localization of the
endogenous VRK2 protein. For this, we used a specific
rabbit polyclonal antibody against full-length VRK2
protein. We analysed the localization of VRK2 in two
cell lines, WSI, derived from normal skin fibroblasts,
and MCF7 cells from a breast carcinoma. In both cell
lines there was strong staining in both the cytosol and
nucleus, and there was a particulate aspect, suggesting
that VRK2 might be associated with some organelle
(Fig. 1A,B). To further refine the subcellular distribu-
tion, three additional markers were included; the endo-
plasmic reticulum (ER) was identified by detecting
calnexin (Fig. 1A), mitochondria were detected with
mitotracker (Fig. 1B), and nuclei were detected with
DAPI staining (Fig. 1A,B). Confocal microscopy ana-
lysis showed that a significant fraction of the endog-
enous protein was membrane bound both to the ER
and, to a lesser extent, to mitochondria, as detected by
the overlapping signals. The data suggested that
endogenous VRK2 protein could exist in two forms,

membrane bound, as detected in the ER and mito-
chondria, or free as detected in both cytosol and
nuclei.
The VRK2 gene generates by alternative splicing
two different isoforms that differ in their
C-terminus
The detection of two subcellular locations for the
known VRK2 protein suggested that these might be
due to differences in the expression of the unique
human VRK2 gene. To test this possibility, VRK2
cDNA from HeLa cells was cloned by RT-PCR. Two
cDNA sequences of 1833 and 1877 nucleotides were
isolated. Comparison of these sequences with the
human VRK2 gene shows that they were generated by
alternative splicing. Isoform B had an additional exon
of 44 nucleotides, designated new exon 13 that changed
the reading frame and included an early termination
codon. Exon 13 is located 8280 base pairs downstream
of exon 12 and 4542 base pairs upstream of exon 14,
former exon 13, in the genomic sequence of the VRK2
gene (Fig. 2A). The resulting VRK2 proteins, A and B,
have 508 and 397 amino acids, respectively. They differ
in the C-terminus. In isoform A, this region (residues
395–508) contains a hydrophobic sequence (residues
Fig. 1. Subcellular localization of the endo-
genous human VRK2 protein in MCF7 and
WSI cell lines. VRK2-specific detection was
determined with a rabbit polyclonal anti-
body. DAPI staining, used to identify the
nuclei, is also shown. The ER was identified

with a monoclonal antibody specific for caln-
exin (A). Mitochondria were detected using
the MitoTracker Red CMXRos reagent (B).
Bars ¼ 50 lm.
S. Blanco et al. Differential stabilization of p53 by VRK2 isoforms
FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2489
487–506). In isoform B, this region is replaced by three
amino acids (VEA), however, the catalytic domain at
the N-terminus is identical (Fig. 2B).
Differential expression of VRK2A and VRK2B
proteins in tumour cell lines
To demonstrate that the two messages identified code
for real proteins, we determined their presence in a
panel of tumour cell lines using western blot analysis,
with a polyclonal antibody raised against full-length
VRK2 protein (isoform A), but that recognizes the
N-terminal region common to both isoforms (not
shown). The VRK2A protein was detected in all cell
lines, but VRK2B protein was more abundant in some
cell lines, such as C4-I, HeLa, MCF7 or the colon
carcinoma WiDr, and detected in smaller amounts in
the remaining carcinoma cell lines (Fig. 3A). In lym-
phoma cell lines, only isoform A was detected. To
identify the mobility of each protein, protein extract
of MCF7 cells was run in parallel with the purified
VRK2A and VRK2B proteins expressed as glutathi-
one S-transferase (GST)–fusion proteins and digested
with thrombin. We observed identical mobility in the
endogenous proteins with the cloned and purified iso-
forms (Fig. 3B).

The relative concentration of mRNA was also deter-
mined by real-time quantitative PCR in the H1299 and
Fig. 2. Generation of two VRK2 messages
by alternative splicing. (A) Detection of
the new exon identified in the message
coding for the VRK2B isoform. The DNA
sequences correspond to the genomic
sequence (Ensembl genomic location:
AC068193.7.1.170059), and the cDNA for
VRK2A (AB000450) and VRK2B (AJ512204).
(B) Alignment of the VRK2A and VRK2B
protein sequence to show the divergent
C-terminus, the location of catalytic region
and other specific features. The arrow
indicates where the reading frame changed
as a consequence of alternative splicing.
Differential stabilization of p53 by VRK2 isoforms S. Blanco et al.
2490 FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS
MCF7 cell lines. In this experiment, total and specific
VRK2B messages were detected. In both cases there
was always more VRK2A than VRK2B mRNA, and
the two cell lines appeared to have similar levels of
each message (Fig. 3C).
The nuclear localization of VRK2 suggests that it
might be redundant, with VRK1 reported to be exclu-
sively nuclear in transfection experiments [11,13,15].
However, the nuclear localization of VRK1 is depend-
ent on the cell type, in lymphomas, sarcomas and
squamous carcinomas it is nuclear, but in some adeno-
carcinomas it is cytosolic (manuscript in preparation).

Therefore, the localization of endogenous VRK1 and
VRK2 proteins was simultaneously determined by con-
focal microscopy in MCF7 cells from a breast adeno-
carcinoma, A549 cells from lung adenocarcinoma and
HeLa cells from a cervical adenocarcinoma. Immuno-
fluorescence showed that VRK1 is cytosolic with a
particulate aspect in these three cell lines, whereas
VRK2 is located in both the cytoplasm and is clearly
detected in the nucleus (Fig. 3D). In MCF7 and HeLa
cells the strong staining in the nucleus coincides with
the more abundant expression of VRK2B detected by
western blot.
Fig. 3. Expression of two VRK2 isoforms. (A) Detection of VRK2 proteins in several cell lines that were determined by immunoblotting of
whole-cell extracts. Whole extract from each cell line was fractionated in an SDS-polyacrylamide gel and transferred to a poly(vinylidene
difluoride) membrane. The blot was developed with a specific polyclonal antibody that detects both VRK2 isoforms. The cell lines proceed
from different types of tumours as indicated in the figure and include carcinomas of different types (squamous and adenocarcinomas), sarco-
mas and T and B lymphomas. (B) The mobility of endogenous VRK2A and VRK2B proteins from MCF7 cell extracts was compared with bac-
terially expressed and purified GST–VRK2A and GST–VRK2B proteins that were digested with thrombin. The VRK2 isoforms were detected
in the western blot with a rabbit VRK2-specific polyclonal antibody. (C) Quantitative detection by real time RT-PCR of total VRK2 (isoform A
plus B) messages (solid lines) or specific VRK2B message (dotted lines) in the H1299 (blue) and MCF7 (pink) cell lines. (D) Localization of
endogenous VRK1 and VRK2 proteins in three adenocarcinoma cell lines. VRK1 was detected with a mouse monoclonal antibody specific for
human VRK1. Human VRK2 was detected with a rabbit polyclonal antibody. Bar ¼ 50 lm.
S. Blanco et al. Differential stabilization of p53 by VRK2 isoforms
FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2491
The two VRK2 isoforms have a different
subcellular localization
To identify and confirm the subcellular localization of
both VRK2 isoforms the cDNA of each isoform was
cloned in pCEFL–HA vector that contains an HA epi-
tope tag (because there is no monoclonal antibody spe-

cific for each isoform), resulting in clones pCEFL–
HA–VRK2A and pCEFL–HA–VRK2B. The presence
of a hydrophobic tail in VRK2A suggests that this iso-
form might be associated with membranes. Cos1 cells
were transfected with each of the constructs and the
location of the transfected protein was determined with
an anti-HA serum. Isoform VRK2A was localized to
the membrane of the ER and nuclear envelope, as
shown by its colocalization with calreticulin (Fig. 4A).
Isoform VRK2B, lacking the transmembrane
domain, presented a diffuse pattern throughout the
cytoplasm and some was even detected in the nucleus
and outside the nucleolus. Because of this nuclear pres-
ence we tested whether VRK2B shares a subcellular
location with a known target of the related VRK1 pro-
tein, such as the p53 tumour-suppressor protein [11,12].
For this, H1299 (p53
– ⁄ –
) cells were cotransfected with
either of the VRK2 isoforms and pCB6 + p53.
VRK2B, but not VRK2A, and p53 proteins were detec-
ted in the nucleus, with some overlap in their fluores-
cence, and outside the nucleolus (Fig. 4B).
Substrate specificity of VRK2 isoforms and p53
phosphorylation
Despite the C-terminal domain differences, the cata-
lytic domains are identical in both VRK2 isoforms. To
determine if there was any difference in substrate spe-
cificity between the two isoforms, a panel of substrates
commonly used to characterize Ser-Thr kinases related

to casein kinase I were used [1,11]. Both isoforms
phosphorylated casein, histone 2B and myelin basic
protein in a similar manner, but did not phosphorylate
histone 3 (not shown). Furthermore, the two VRK2
isoforms had a strong autophosphorylation activity
in vitro when tested as GST–VRK2 fusion proteins
(Fig. 5A).
To identify substrates of the VRK2 kinase that are
of biological relevance we analysed the effect on the
phosphorylation of p53 in its N-terminus, transactiva-
tion domain, because it is a known substrate of its
related kinase VRK1 [11]. For this we used several
GST–p53 (murine) fusion proteins containing individ-
ual or combined substitutions of Ser or Thr residues
[61,62]. There was a loss of radioactive signal whenever
the Thr18Ala substitution was introduced by itself or
in combination with Ser15Ile or Ser20Ala. VRK2A
and VRK2B have an identical in vitro phosphorylation
pattern (Fig. 5A), and Thr18 appears to be the
main residue phosphorylated, as detected by a loss of
Fig. 4. Subcellular localization of VRK2A and
VRK2B proteins. Cos1 or H1299 cell lines
were transfected with either constructs of
VRK2A or -B tagged with the HA epitope
and expressed in a pCEFL vector. Expres-
sion of VRK2 isoforms was detected with a
monoclonal antibody specific for the HA epi-
tope. (A) Colocalization of HA–VRK2A with
calreticulin, a marker for the ER, was detec-
ted with an anti-calreticulin serum in Cos1

cells. Nuclei were identified with DAPI. (B)
Colocalization in the nucleus of H1299 cells
of transfected HA–VRK2B and p53. The
HA–VRK2B protein was detected with an
antibody against the HA epitope tag. The
p53 protein was detected with a mix of
DO1 and Pab1801 monoclonal antibodies.
Bar ¼ 50 lm.
Differential stabilization of p53 by VRK2 isoforms S. Blanco et al.
2492 FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS
Fig. 5. Phosphorylation of p53 in vitro by VRK2A and VRK2B. (A) Phosphorylation of GST–p53 (murine) fusion proteins with different individ-
ual amino acid substitutions by the VRK2A (upper) and VRK2B (lower) isoforms. The GST–p53 substrates used were FP221, residues 1–85;
FP279, residues 11–65; FP267, residues 1–64. Fusion proteins were made with the murine p53, but the numbering is that of the human
p53 protein in this conserved region. Individual Ser or Thr substitutions are indicated. (B) Phosphoamino acid analysis of phosphorylated
GST–p53, the staining with ninhydrin and the radioactivity incorporation are shown. (C) Phosphorylation of human p53 by VRK2B. Four
human GST–p53 constructs spanning different regions of p53 were used as substrates of VRK2B. On the left is shown the detection of the
proteins with Coomassie Brilliant Blue staining and to the right is shown the incorporation of radioactivity. (D) Interaction between VRK2B
and p53. H1299 cells were transfected with plasmids pGST–VRK2B or kinase-dead pGST–VRK2B(K169E) and pCB6 + p53 or
pCB6 + p53T18A in the combinations indicated in the figure and their correct expression was checked in the cell lysate prepared 48 h after
transfection (upper). The lysate was mixed with glutathione–Sepharose beads for 4–12 h at 4 °C with and the beads were pulled-down by
centrifugation. The proteins brought down with the beads were analysed in an immunoblot with specific antibodies (lower). (E) Lack of
Hdm2 phosphorylation by the VRK2B isoform. As substrates VRK2B kinase two different Hdm2 proteins were used; a full-length protein
with a His tag and a GST fusion protein of the Hdm2 amino terminus (residues 1–188). In the left panel is shown the Coomassie Brilliant
Blue staining and in the right-hand panel is shown the incorporation of radioactivity.
S. Blanco et al. Differential stabilization of p53 by VRK2 isoforms
FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2493
phosphate incorporation. Similar results were obtained
using a construct spanning p53 residues 1–85, 1–64 or
11–63. Phosphorylated GST–p53 was used to deter-
mine the incorporation of radioactivity in a phospho-

amino acid analysis. Incorporation was seen only in
threonine residues, which is unique in the common
region (Fig. 5B).
Next, the phosphorylation of human p53 was stud-
ied using either a full-length protein or partial
constructs. Phosphorylation was detected only in con-
structs within the N-terminal p53 region, as expected
(Fig. 5C), and no incorporation was detected associ-
ated with constructs spanning residues 90–390.
In kinase reactions the interaction between the kin-
ase and substrate is very short. However, it is some-
times possible to detect stable intermediate complexes
between a kinase and its substrate if the reaction can-
not be performed. Therefore, to address the possibility
that VRK2B might form a complex with p53 an
experiment using different proteins, either wild-type or
mutated, was designed. H1299 cells were transfected
with pGST–VRK2B mammalian expression constructs,
both the wild-type and the inactive kinase (pGST–
VRK2B–K169E), which express a catalytically inactive
form of VRK2B because it lacks the lysine essential
for kinase activity. As a substrate we used p53 or its
nonphosphorylatable p53T18A variant. Expression of
the different proteins was confirmed in whole-cell
lysates (Fig. 5D, upper), and these lysates were used
for a pull-down of GST–VRK2B-associated proteins
identified by immunoblot analysis. Formation of a sta-
ble complex was detected when an inactive kinase
VRK2B(K169E) was used, independent of the p53 sta-
tus, either wild-type or mutated p53T18A. No stable

complex could be formed between an active VRK2B
and a nonphosphorylatable p53. The inability of an
inactive kinase to transfer the phosphate resulted in
the formation and detection of a stable intermediate
VRK2B(K169E)–p53 complex (Fig. 5D, lower).
Because the N-terminus of p53 interacts with
Mdm2, the potential phosphorylation of Hdm2
(human Mdm2) was studied using either full-length
protein or its N-terminus (residues 1–188), which is the
region of interaction with p53, but we did not detect
any phosphorylation by VRK2A or VRK2B isoforms
(Fig. 5E; VRK2A not shown).
VRK2B but not VRK2A induces the accumulation
of p53
The p53–Mdm2 interaction promotes p53 ubiquitina-
tion and degradation via the proteasome pathway.
Phosphorylation of p53 at its N-terminus frequently
results in disruption of this interaction and conse-
quently in its stabilization [63]. Therefore, we deter-
mined using western blot analysis whether the
phosphorylation of p53 by VRK2B or VRK2A also
resulted in its stabilization. H1299 (p53
– ⁄ –
) cells were
transfected with pCB6 + p53 and increasing amounts
of pCEFL–HA–VRK2A or pCEFL–HA–VRK2B.
VRK2B, but not VRK2A, induced an accumulation of
p53, which was higher as the amount of transfected
VRK2B was increased (Fig. 6). To confirm that both
Fig. 6. Stabilization of transfected p53 induced by VRK2B. H1299

(p53
– ⁄ –
) lung carcinoma cells were transfected with 25 ng of
pCB6 + p53, and varying amounts (0, 2, 3 and 4 lg) of plasmids
expressing pCEF–-HA–VRK2A, pCEF–-HA–VRK2B or the kinase
dead pCEF–-HA–VRK2B(K169E). Detection of total p53 from in
whole-cell lysate extracts was carried out with a mix of DO1 and
Pab1801 antibodies. At the bottom is shown the quantification of
p53 normalized with b-actin depending on the kinase isoform used
in the assay as the mean of two independent experiments. West-
ern blots were performed using the specific antibodies indicated in
Experimental procedures.
Differential stabilization of p53 by VRK2 isoforms S. Blanco et al.
2494 FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS
HA-tagged VRK2 isoforms expressed in culture were
active, an in vitro kinase assay with the immunoprecip-
itated protein was performed (data not shown). There-
fore, p53 in vivo is one target of VRK2B, probably
because they colocalize in the same compartment.
However, VRK2A, which is in the cytosol in a mem-
brane-bound form, is not able to induce p53 accumula-
tion. To confirm that this was dependent on the
activity of VRK2B, we used a construct pCEFL–HA–
VRK2B(K169E) that expresses a catalytically kinase
dead form of VRK2B because it lacks the lysine essen-
tial for kinase activity. Indeed, this inactive mutant of
VRK2B did not induce accumulation of p53 (Fig. 6).
The stabilization of p53 by VRK2B is a
post-translational effect
To determine whether the effect induced by VRK2B

on the p53 levels is a consequence of post-translational
modification, an experiment was performed in the
presence of the protein synthesis inhibitor cyclohexi-
mide. H1299 cells were transfected with pCB6 + p53
or a combination of pCB6 + p53 and pCEFL–HA–
VRK2A or pCEFL–HA–VRK2B, 36 h later cyclohexi-
mide was added and the levels of p53 were determined
by immunoblots at different time points. The amount
of protein was normalized to the level of b-actin. In
the absence of VRK2B, p53 was degraded almost
immediately, as expected, whereas its levels were stable
for more than 8 h in the presence of VRK2B (Fig. 7).
A similar experiment was performed with VRK2A;
this isoform did not protect p53 from degradation.
VRK2B stabilizes endogenous p53 and activates
its transcriptional activity
Next we determined whether VRK2B could also stabil-
ize the endogenous p53 protein. For this assay the
A549 cell line (p53
+ ⁄ +
) was used. After transfection
with VRK2B, cells were treated with cycloheximide,
and the level of endogenous p53 protein was deter-
mined at different times. The stability of endogenous
p53 (half-life) was less than 20 minutes in the absence
of VRK2B, but in its presence, the stability of p53 was
significantly increased (Fig. 8A). A consequence of this
stabilization by VRK2B is that p53 might be transcrip-
tionally active. To determine whether the VRK2 pro-
teins affected transcription, A549 cells were transfected

with a p53 synthetic reporter, plasmid p53–Luc, which
contains several p53-response elements. VRK2B, but
not VRK2A, activated this promoter (Fig. 8B). In
order to verify whether VRK2B affected the transcrip-
tion of a p53 target gene we used the pMdm2–Luc
reporter containing the Mdm2 promoter. VRK2B also
activated the transcription of Mdm2 (Fig. 8B). Next,
A549 cells were transfected with increasing amounts of
pCEFL–HA–VRK2B, and the luciferase activity of
the p53–Luc reporter was determined. As VRK2B
increased, so did endogenous p53-dependent transcrip-
tion (Fig. 8C).
p53 phosphorylation by VRK2B differs from that
induced by adriamycin or taxol
We showed that VRK2B phosphorylates p53 in vivo at
Thr18. First it was confirmed that transfected p53 was
phosphorylated at Thr18 by VRK2B in H1299 cells
(p53
– ⁄ –
). When the cells were transfected with VRK2B,
there was an increase in p53 phosphorylation as shown
by western blot analysis (Fig. 9A, upper). However,
because only a fraction of the cells were transfected
and the p53-Thr18 phospho-specific antibody is not
very sensitive, the specific signal is difficult to detect
in whole-cell extracts. To improve detection, p53 was
Fig. 7. Stability of p53 by VRK2B is a post-translational effect.
H1299 cells (p53
– ⁄ –
) were transfected with 50 ng of pCB6 + p53,

without (upper) or with (middle) 4 lg of pCEF–-HA–VRK2B, 36 h
after transfection cycloheximide (CHX) was added to the culture at
a final concentration of 60 lgÆmL
)1
and the levels of p53 were
determined at different time points by immunoblot analysis. Cell
lysates were analysed by western blot. The p53 protein was detec-
ted with a mix of DO1 and Pab1801 antibodies, and HA–VRK2B
was detected with anti-HA serum. At the bottom it is also shown
the relative level of p53 normalized with the b-actin level at each
time point. C represents a control for transfection with an empty
vector without p53.
S. Blanco et al. Differential stabilization of p53 by VRK2 isoforms
FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2495
concentrated by immunoprecipitation, and phosphory-
lation at Thr18 was determined using a phosphor-
specific antibody. Inclusion of VRK2B increased the
phosphorylation of transfected p53 in Thr18 by
approximately fourfold, as shown in Fig. 9A (lower).
The next step was to determine the phosphorylation
of endogenous p53 protein in A549 cells (p53
+ ⁄ +
)in
the presence of overexpressed VRK2B; as a positive
control for phosphorylation, cells were treated with
either adriamycin or taxol. All, overexpression of
VRK2B or drugs induced Thr18 phosphorylation as
detected using a phosphor-specific antibody (Fig. 9B).
Thr18 phosphorylation was dependent on the dose of
VRK2B. In the same experiment the phosphorylation

of Ser15 was also determined. However, the relative
phosphorylation of Thr18 was higher in the presence
of VRK2B than in the presence of adriamycin, and
was similar to that induced by taxol (Fig. 9B, middle).
VRK2B induced relatively higher phosphorylation of
Thr18 with respect to Ser15 phosphorylation, while in
the presence of taxol or adriamycin, both residues were
phosphorylated equally (Fig. 9B, lower), suggesting
that VRK2B did not require previous phosphorylation
on Ser15. The higher absolute signal in drug-treated
cells is due to the fact that all cells responded, whereas
only a fraction were transfected with the VRK
construct.
VRK2B reduces p53 ubiquitination and promotes
its acetylation by p300
Phosphorylation of p53 at its N-terminal region modu-
lates its affinity for different binding proteins. There-
fore, a consequence of p53 phosphorylation at Thr18
might be to change its binding characteristics to
Mdm2 [58,64,65]. Based on the phosphorylated residue
by VRK2B, the expected effect would be a reduction
in the p53–Mdm2 interaction [54], and consequently a
decrease in its ubiquitination. In H1299 cells, transfec-
tion of VRK2B clearly reduces the ubiquitination of
p53 by exogenous Mdm2 (Fig. 10A), indicating that
the phosphorylation induced by VRK2B might alter
Fig. 8. Stabilization of endogenous p53 and activation of p53-
dependent transcription. (A) Stabilization of endogenous p53 by the
VRK2B isoform in A549 (p53
+ ⁄ +

) lung carcinoma cell line. A549
cells were transfected with 4 lg of pCEF–-HA–VRK2B and 36 h
after transfection cycloheximide was added to the culture. The
amount of endogenous p53 protein at different time points was
determined with a mix of DO1 and Pab1801 antibodies and
HA–VRK2B was determined with anti-HA serum. (Upper) Levels of
p53 in the absence of VRK2B, (lower) levels of p53 in the presence
of VRK2B. (B) Activation of endogenous p53-dependent transcrip-
tional activity by VRK2B. A549 cells were cotransfected with or
without VRK2 isoforms and a p53 synthetic reporter plasmid (p53–
Luc, containing p53 response elements) or a specific gene promo-
ter (Mdm2–Luc,containing Mdm2 promoter). pBASIC and pSV40-
Control reporters were used, respectively, as negative and positive
controls of the luciferase assay. Reporter luciferase activity was
normalized for transfection levels with Renilla luciferasa (pRL-tk).
(C) Dependence of transcriptional activation on the dose of trans-
fected VRK2B. A549 cells were transfected with increasing
amounts of pCEF–-HA–VRK2B and 0.5 lg of p53–Luc reporter con-
struct, and 0.3 lg of pRL-tk Luc. Luciferase activity was deter-
mined 48 h after transfection and normalized with Renilla luciferase
activity. Data from at least three independent experiments were
analysed with Student’s t-test. *P < 0.05; **P<0.005.
Differential stabilization of p53 by VRK2 isoforms S. Blanco et al.
2496 FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS
the interaction of p53 and Mdm2, therefore causing
p53 accumulation.
The coactivator p300 also interacts with the p53
transactivation domain and contributes to p53 stabil-
ization and activation. To test the possibility that
phosphorylated p53 might bind to this transcriptional

coactivator, H1299 cells were transfected with different
combinations of VRK2B (pCEFL–HA–VRK2B), p53
(pCB6 + p53) and p300 (pHA-p300) expression con-
structs. The effect on p53 protein levels and degree of
acetylation was determined by immunoblot analysis,
with an antibody specific for acetylation in Lys373 and
Lys382 of whole-cell extracts. Indeed, it was observed
that VRK2B facilitates p53 acetylation (Fig. 10B). The
p53 protein was also concentrated by immunoprecipi-
tation to improve detection of its acetylation. In the
absence of p300, the acetylation of p53 was enhanced
slightly by VRK2B, and was particularly noticeable
when cotransfected with pCMV-p300-HA (Fig. 10C),
indicating that p53 stabilized by VRK2B was acetylated
de novo.
Discussion
Alternative splicing of the human VRK2 gene gener-
ates two isoforms with a common kinase domain and
a different C-terminus, which determines their subcel-
lular location. VRK2A localizes to the ER, whereas
VRK2B variant, in contrast to those previously detec-
ted by RT-PCR [13], is detected in both the cytoplasm
and nucleus, outside the nucleolus, despite lacking a
known NLS. VRK2A is highly expressed in different
cell lines, whereas VRK2B expression is more restric-
ted and appears to be coordinated by an unknown
mechanism. Because different cell types present differ-
ent proportions of both isoforms, and the substrate
specificities of both VRK2 isoforms and their relative
VRK1 [11,16,17] are similar in vitro, we postulate that

the biological effects mediated by these kinases might
be determined by their subcellular localization and the
proteins present in the corresponding compartment,
and by their C-terminal domain, which mediates inter-
actions with different proteins. Their regulation is
likely to be controlled by the different C-terminus,
which determines their interaction with other regula-
tory proteins not yet identified, but whose future iden-
tification will contribute to the unravelling of the
signalling pathway to which these kinases belong. For
instance, VRK2B and VRK1 are localized in the
nucleus but differ in their last 90 amino acids in the
C-terminus.
Stabilization of p53 is part of the response to cellu-
lar stress, and is usually mediated by phosphorylations
carried out by a large number of kinases that target
Fig. 9. In vivo phosphorylation of p53 Thr18
by VRK2B. (A) Phosphorylation of transfect-
ed p53 in H1299 cells (p53
– ⁄ –
) by VRK2B.
H1299 cells were transfected with 0.1 lgof
pCB6 + p53 and 6 lg of pCEF–-HA–VRK2B.
Thirty-six hours after transfection the cells
were lysed for western blot analysis (upper)
or immunoprecipitation of p53 followed by
western blot (lower). The quantification of
the relative phosphorylation of p53 is
shown. (B) Phosphorylation of endogenous
p53 in Thr18 by VRK2B in A549 cells

(p53
+ ⁄ +
). As positive control treatment with
adriamycin (0.5 lgÆmL
)1
for 8 h) or taxol
(100 n
M for 12 h) are included. VRK2B phos-
phorylates p53 in Thr18 in a dose-dependent
manner. Adryamicin and taxol treatments
also increase Thr18 phosphorylation. The
middle graph shows relative Thr18 phos-
phorylation, and the lower graph shows
Thr18 phosphorylation with respect to Ser15
phosphorylation.
S. Blanco et al. Differential stabilization of p53 by VRK2 isoforms
FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2497
several different residues, mainly located in the p53
N-terminus, and generates a complex pattern of phos-
phorylation [33]. Furthermore, the p53 N-terminus
mediates the interaction using many regulatory mole-
cules such as acetyl transferases [58] and ubiquitin
ligases, for example, its downregulator Mdm2 [66].
The specificity of the interactions can be modulated by
phosphorylation at different residues, of which Ser15
and Ser20 are the best characterized, and result in p53
stabilization [41]. However, stabilization can also occur
in the absence of Ser15 or Ser20 phosphorylation [46],
in this case, Thr18 phosphorylation is the other likely
mechanism for p53 stabilization. Thr18 phosphoryla-

tion is mediated by some kinases, of these casein kin-
ase 1 delta requires the previous phosphorylation of
Ser15 [50] and is cytosolic in interphase [51], whereas
VRK1 or VRK2B phosphorylate Thr18 directly and
are nuclear proteins [11]. Thr18 phosphorylation con-
tributes to p53 stabilization. The other VRK2A, which
has a different subcellular location and does not colo-
calize with p53, is not able to induce stabilization.
Cytosolic VRK2A is therefore more like casein kin-
ase 1 delta as both phosphorylate Thr18 in vitro [50].
Therefore, a different subcellular location and different
modulation of a common kinase domain may deter-
mine different biological activities. Phosphorylation of
Fig. 10. Effect of VRK2B on ubiquitination and acetylation of p53. (A) Reduced ubiquitination of p53 by Mdm2 in the presence of VRK2B.
H1299 cells (p53
– ⁄ –
) were cotransfected with 0.5 lg of pCB6 + p53, 0.5 lg of BRR12-His-ubiquitin, 1.5 lg of pCOC-Mdm2-X2 and 2.5 lgof
pCEF–-HA–VRK2B. Transfections were performed with the JetPEI reagent. 36 h after transfection 5 l
M lactacystin (a proteasome inhibitor)
was added to the culture and 12 h later the cells were lysed with RIPA buffer for analysis by western blot. Single p53 and ubiquitinated p53
were detected with a mix of DO1 and Pab1801 antibodies, HA–VRK2B was detected with anti-HA monoclonal serum and for Mdm2 detec-
tion we used anti-SMP14 monoclonal serum. The bar graph represents the mean of three independent experiments with its SD. *P < 0.02.
(B) Increased acetylation of p53 by p300 in the presence of VRK2B. H1299 cells were transfected with the indicated constructs and whole
cell extracts were immunoblotted with specific antibodies as indicated. (C) Identification of p53 acetylation promoted by VRK2B. H1299 cells
were transfected with the plasmids indicated and p53 was immunoprecipitated with a mix of DO1 and Pab240 antibodies. The cells were
treated with 5 l
M of Trichostatin A from Streptomyces sp. (TSA), a deacetylase inhibitor. Cells were lysed in the acetylation-precipitation buf-
fer with TSA, and p53 was immunoprecipitated with a mix of DO1 and Pab240 antibodies. The acetylation of p53 in residues Lys373 and
Lys382 was determined with a specific antibody as indicated in Experimental procedures. The constructs used in transfections were
pCB6 + p53, p-CEFL-HA–VRK2B and pCMV-p300-HA. The bar graph represents the mean of two independent experiments with its SD and

*P < 0.05. (D) H1299 cells were transfected with plasmid encoding wild-type p53 or different substitution as indicated, with or without
pCEF–-HA–VRK2B. Detection of total p53 from in whole-cell lysate extracts was carried out with a mix of DO1 and Pab1801 antibodies.
Differential stabilization of p53 by VRK2 isoforms S. Blanco et al.
2498 FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS
Thr18 has been observed in vivo in cells treated with
taxol [59,67] and in senescent fibroblast [60]. However,
the phosphorylation at Thr18 induced by taxol or
adriamycin is also accompanied by the phosphoryla-
tion of Ser15, probably via activation of stress-
response pathways; this is not the case for VRK2B,
which is probably mediated via a different signalling
pathway or cooperates with some of these stress-
response pathways. It has also been postulated that
Thr18 phosphorylation might play a role in normal
growth [15], and this may be the reason for its detec-
tion in cellular senescence [60].
Phosphorylation of the N-terminus might be a regu-
latory mechanism for a docking site in p53, partic-
ularly in Thr18, which affects the interaction with
either Mdm2 [54] or p300 [58,64,68]. The consequence
of p53T18 phosphorylation is a disruption of p53
interaction with Mdm2, because this residue is essential
for maintaining the structure of the p53-binding region
[53,54,69], by reducing p53 ubiquitination it contri-
butes to its stabilization and promotes other protein
interactions [15]. The coactivator p300 binds to p53 in
the same region as Mdm2, and promotes its stabiliza-
tion and transactivation by acetylation [70]. In the case
of Thr18 phosphorylation by VRK2B, there is an
increase in p53 stability and transactivation, as expec-

ted, if improved binding to p300 and disruption of the
Mdm2 interaction were promoted by this phosphoryla-
tion [55,58]. The effects observed regarding phosphory-
lation of human p53 in Thr18 are consistent with
similar findings reported for the role of the equivalent
residue in murine p53, Thr21 [48], and it has also been
reported that Thr18 phosphorylation by VRK1 stabil-
izes p53 and promotes its binding to Mdm4 and p300
[15]. Although p53 can be phosphorylated at several
residues by many kinases, the precise functional conse-
quences resulting from different combinations of phos-
phorylated residues are not well known.
It has been proposed that the nuclear kinase VRK1
has a role in the regulation of p53 in the cellular
response to suboptimal stress during interphase [15],
which is the normal physiological situation. Phos-
phorylation of Thr18 is likely to be a component of a
p53 cycle that is necessary to maintain basal levels of
p53, these levels are needed if normal proliferation is
to be able to respond to severe stress signals [15].
However, in adenocarcinoma tumour cell lines, VRK1
is localized in the cytoplasm, therefore it may not regu-
late p53. In this situation, the VRK2B isoform is
expressed and is located in the nucleus where it might
functionally replace VRK1 in this suboptimal protect-
ive role, given the similarity of their effect on p53.
This indicates two novel levels of regulation of VRK
proteins, one is the coordination of their expression,
VRK2B is formed when VRK1 is cytosolic, but not
when is nuclear; and the other is how VRK2B is trans-

ported to the nucleus because it lacks a nuclear local-
ization signal, that is present in the C-terminus of
VRK1 [11]. The effect of VRK2B on p53 Thr18 phos-
phorylation is functionally redundant with the effect of
VRK1 [15] regarding p53. VRK2B can therefore func-
tionally replace VRK1 in those cells where the latter is
cytosolic, although they are likely to be regulated dif-
ferently, because they differ in their C-terminus. This
function would suggest that there should be some
redundancy in these genes, and this would explain why
the murine knockout of VRK2 is viable [71,72]. The
VRK family of Ser-Thr kinases represents the begin-
ning of novel signalling pathways that operate in many
cell types and that are beginning to be unravelled.
Experimental procedures
RNA extraction, RT-PCR, cloning and
mutagenesis
Total RNA from H1299, HeLa and MCF7 was isolated
using RNAeasy Mini Kit (Qiagen, Hilden, Germany).
RNA was analysed and quantified using a Bioanalyser 2100
nano-lab chip from Agilent Technologies (Waldbronn,
Germany). cDNA was synthesized as previously reported
[11]. Different primers were designed to generate full-length
VRK2 (nucleotides 130–1657; GenBank accession number
AB000450) based on human VRK2 [7]. VRK2A: 5¢-
CCC
GGATCCATGCCACCAAAAAGAAATGAAAAAT
ACAAACTTCC-3¢ (nucleotides 130–165), this primer has
the initiation codon and a BamH1 cloning site. VRK2X: 5¢-
GGG

TCTAGAGGAATTTTGGTATCATCTTCAGAG-3¢
(nucleotides 1652–1675 antisense strand), with an XbaI clo-
ning site and the termination codon. VRK2S: 5¢-GGG
GTC
GACGGAATTTTGGTATCATCTTCAGAG-3¢ (nucleo-
tides 1652–1675 antisense strand), with a SalI cloning site
and the termination codon. Human full-length VRK2 was
made with primers VRK2A and VRK2X or VRK2S from
HeLa RNA for cloning in pGEX4T-1 (Amersham Bio-
sciences, Little Chalfont, UK). For expression in eukaryotic
cells, the VRK2A and VRK2B full-length cDNA were sub-
cloned in vector pCEFL–HA or pCEFL–GST with restric-
tion sites BamHI–NotI, using primers VRK2A,
VRK2Not1.A: 5¢-GGGCGGCCGCGGAATTTTGGTATC
ATCTTCAGAG-3¢ and VRK2TN.1: 5¢-GCGGCCGCCTA
AGCTTCTACCTGAGCTGCTTC-3¢. To detect the new
exon in VRK2 transcripts two pairs of flanking primers
were designed. Forward primer VRK2TA: 5¢-AGTGAGG
AAGCGCTGAGTCCT-3¢, and reverse primer: VRK2TB:
5¢-CAAGAGTCTCAAGAACCTTTG-3¢ which amplify
fragments of nucleotides 135–179 specific for isoform A
S. Blanco et al. Differential stabilization of p53 by VRK2 isoforms
FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2499
and B messages, respectively, and forward primer
VRK2TC: 5¢-GCAGCTCAGGTAGAAGCTTAGG-3¢, and
reverse primer: VRK2TD: 5¢-CGTGCTGACTGTGGAAG
TGT-3¢ specific for isoform B. One hundred nanograms of
total RNA was used in a one-step RT real-time PCR
amplification reaction using the ‘Quantitec SYBR Green
RT-PCR kit’ from Quiagen in an iCycler (Bio-Rad, Hercu-

les, CA). The reaction was analysed using icycler software
(Bio-Rad). The VRK2B cDNA sequence has GenBank
accession number AJ512204. An inactive or kinase-dead
(KD) VRK2 mutation was made by site-specific mutagen-
esis introducing the K169E substitution in mammalian
expression constructs and in GST fusion proteins. Site-
directed mutagenesis was performed with the Quick-Change
Mutagenesis kit from Stratagene (San Diego, CA).
Plasmids and fusion proteins
The GST–p53 constructs containing the N-terminus of
murine p53 and its mutants were a gift of D. Meek (Dundee
University, UK) [61,62]. The human GST–p53 fusion pro-
teins, 1–390 (full-length), 90–290 and 290–390 were from T.
Kouzaridis (Cancer Research UK, Cambridge, UK). Full-
length human pHdm2-his and N-terminus of pGST–Hdm2
(residues 1–188) were from A. Levine (Rockfeller University,
New York). GST-fusion proteins were expressed in
BL21DE3 cells and purified using glutathione–Sepharose
(Amersham) as previously reported [11]. His-tagged proteins
were expressed in, purified with TALON Metal Affinity
Resin (BD Biosciences, Erembodegem, Belgium) and eluted
with 100 nm imidazol (Merck, Darmstadt, Germany). Mam-
malian expression plasmids containing human p53 wild-type
cDNA, pCB6 + p53, and pCOC-Mdm2-X2 were from K.
Vousden (Beatson Institute, UK) and plasmid pCMVb-p300-
HA was from R. Eckner (University of Zurich). The ubiqu-
itin tagged with a His epitope for mammalian expression
(clone BRR12-His-ubiquitin) was from S. Lain and D. Lane
(Dundee University, UK). Plasmid pMdm2–Luc was a gift
from B. Vogelstein. The p53-cis reporter plasmid (p53–Luc)

with the luciferase gene was from Stratagene (La Jolla, CA).
Ser-Thr kinase activity assay
Kinase activity was determined by assaying protein phos-
phorylation in a mixture containing 20 mm Tris ⁄ HCl,
pH 7.5, 5 mm MgCl
2
, 0.5 mm dithiothreitol, 150 mm KCl
and 5 lm (5 lCi) [
32
P]ATP[cP] (Amersham) with 2 lgof
GST–VRK2 protein and 10 lg of another protein as sub-
strate when indicated. The reaction was routinely per-
formed for 30 min at 30 °C [11]. The phosphorylated
products were analysed in an SDS-polyacrylamide gel and
the incorporation of radioactivity was determined either by
autoradiography or in a Molecular Imager FX (Bio-Rad).
Phosphoamino acid analysis was performed as previously
described [16,17].
Acid hydrolysis and phosphoamino acid analysis
An in vitro kinase assay was performed with GST–VRK2B
and GST–p53 (FP267) as substrates. The phosphorylated
proteins were fractionated by SDS ⁄ PAGE and transferred
onto an Immobilon-P filter (Millipore, Bedford, MA),
radioactive bands corresponding to GST–p53 were excised
and the protein was eluted. The eluted protein was hydro-
lysed with 200 lLof6n HCl at 110 °C for 1 h. The sam-
ple was freeze-dried and resuspended in a mixture
containing 2 lL of a stock solution at 1 mgÆmL
)1
of P-Ser,

P-Thr and P-Tyr as reference markers, 1 lL of 1% bromo-
phenol blue and 2 lL of formic acid ⁄ acetic acid ⁄ water
(1:3.1:35 v ⁄ v ⁄ v) pH 1.9. The mixture was applied to a cellu-
lose chromatoplaque (Merck) and subjected to flat-bed
electrophoresis in a Multiphor II system (Amersham Bio-
sciences) at 1.5 kV for 90 min. After air drying, the radio-
activity on the chromatoplaque was exposed to X-ray film.
Phosphoamino acid markers were detected by staining with
a 0.25% ninhydrin solution in acetone.
Cell lines, transfections and luciferase reporter
assay
Cell lines 293T, C4-I, HeLa, Siha, SW756, Cal51, H9528,
A498, HepG2, Cos1, Colo 320, HCT116, OSA, RMS13,
NIH 3T3 and WiDr were grown in DMEM; and cell lines
Jukat, JY, HPBALL, Jijoye, HL60, H1299, A549 and
MCF7 were grown in RPMI both supplemented with 10%
fetal bovine serum, glutamine, penicillin, and streptomycin
in a humidified 5% CO2 atmosphere. For H1299 and A549
cells, 0.5 · 106 cells were plated in 60 mm dishes, or
1 · 10
6
in 100 mm diameter dishes. After 24 h the cells
were transfected with the indicated amounts of plasmids
and JetPEI reagent (PolyTransfection, Illkirch, France)
according to the manufacturer’s recommendations. Empty
vector pGEX4T1 was used as carrier. In the experiments
determining p53 accumulation were used 25 ng of
pCB6 + p53 and increasing amounts of pCEF–-HA–
VRK2A or pCEF–-HA–VRK2B. Cycloheximide
(60 lgmL

)1
) was added 36 h after transfection. Adriamy-
cin (Sigma, St. Luis, MO) was added to a final concentra-
tion of 0.5 lgmL
)1
and Taxol was used at 100 nm. For the
ubiquitination assay 0.5 · 106 H1299 cells were seeded in
60 mm dishes and transfected with 0,5 lg of pCB6 + p53,
0,5 lg of BRR12-His-ubiquitin, 1,5 lg of pCOC-Mdm2-X2
and 2,5 lg de pCEF–-HA–VRK2B with 10 lL of JetPEI
reagent and 36 h after transfection, the proteasome inhib-
itor lactacystin (Sigma) was used at 5 lm. For the acetyla-
tion assay 1 · 10
6
H1299 cells were plated in 100 mm
diameter dishes and were transfected with 0,1 lgof
pCB6 + p53, 5 lg of pCMV-p300-HA and 5 lgde
pCEF–-HA–VRK2B with 20 lL of JetPEI reagent; 5 lm
Trichostatin A was added to the culture 6 h before
harvesting cells. For transcription assay experiments,
Differential stabilization of p53 by VRK2 isoforms S. Blanco et al.
2500 FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS
0.5 · 106 A549 cells were seeded in 60 mm dishes and 24 h
later were transfected in triplicate with JetPEI reagent and
0.5 lg of p53–Luc as luciferase reporter, and increasing
amounts of pCEF–-HA–VRK2A or pCEF–-HA–VRK2B
and as internal control for transfection we used 0.3 lgof
pRenilla-tk (pRL-tk) reporter plasmid from Promega
(Madison, WI). Cells were lysed 48 h after transfection and
luciferase activity was determined with Dual-luciferase

Reporter Assay System (Promega) in a luminometer
Minilumat LB9506 (Berthold, Bad Wildbad, Germany).
Immunofluorescence
Cells were seeded in 60 mm dishes, grown on a coverslip
and transfected as indicated in specific experiments with
pCEF–-HA–VRK2A and -B and also pCB6 + p53 in the
H1299 cell line using the calcium phosphate precipitation
method; 48 h post transfection the slides were collected and
fixed with 3% paraformaldehyde for 30 min at room tem-
perature, treated with 10 mm glycine for 10 min at room
temperature and then permeabilized with 0.2% Triton X-
100 for 30 min at room temperature. The cells were blocked
with 1% bovine serum albumin (BSA) in NaCl ⁄ P
i
for
30 min at room temperature followed by double immuno-
staining with the corresponding antibodies. Finally, cells
were stained with DAPI (Sigma) 1:1000 in NaCl ⁄ P
i
for
10 min at room temperature, washed with NaCl ⁄ P
i
, and
slides were mounted with Gelvatol (Monsanto). The anal-
ysis was performed with a Zeiss LSM510 confocal micro-
scope.
Western blot analysis, immunoprecipitation,
pull-down assays and antibodies
Cells were harvested 48 h post transfection and lysed with
RIPA buffer (150 mm NaCl, 1,5 mm Mg Cl

2
,10mm NaF,
100% glycerol, 4 mm EDTA, 1% Triton X-100, 0,1% SDS,
50 mm Hepes pH 7,4, protease and phosphatase inhibitors)
or in acetylation immunoprecipitation buffer (50 mm
Hepes, pH 7.8, 200 mm NaCl, 1% Triton X-100, 10 mm
EDTA, 5 mm dithiothreitol, 5 lm trichostatin A and prote-
ase and phosphatase inhibitors). Fifty micrograms of total
protein lysate were analysed in a 10% SDS-polyacrylamide
gel. Cell lysates were subjected to p53 immunoprecipitation
with monoclonal antibodies DO1 and pab240 (Santa Cruz
Biotchnology, Santa Cruz, CA) at 4 °C overnight, followed
by adsorption to c-Bind (Amersham Biosciences) and ana-
lysed in a 7.5% SDS-polyacrylamide gel. For GST pull-
down assays cells were lysed with a buffer containing buffer
20 mm Tris ⁄ HCl pH 7.4, 137 mm NaCl, 2 mm EDTA,
25 mm b-glycerophosphate, 2 mm pyrophosphate, 10%
(v ⁄ v) glycerol and 1% Triton X-100 plus protease inhibi-
tors. GST pull-downs were performed by incubating 1 mg
of total cell extract with glutathione–Sepharose 4B beads
(Amersham Pharmacia Biotech) for 12 h at 4 ° C. Sepharose
beads were washed three times with lysis buffer and ana-
lysed by SDS ⁄ PAGE. To detect endogenous VRK2 a rab-
bit polyclonal antibody which recognized both isoforms
was prepared by immunizing rabbit with human VRK2A
GST-fusion protein. VRK1 was detected with a mouse
monoclonal antibody, clone 1F6, prepared against the
human VRK1 protein. The monoclonal antibody specific
for the HA epitope was from Covance (San Francisco,
CA). The polyclonal antibody specific for calreticulin was

from Calbiochem (La Jolla, CA) and monoclonal anti-
(calnexin AF18) was from Santa Cruz. p53 protein was
detected with a mix of DO1 antibody (Santa Cruz) and
Pab1801 (Santa Cruz) used at 1:500 and 1:1000, respect-
ively. To detect the phosphorylation of p53 in Thr18 and in
Ser15 rabbit polyclonal antibody, P-p53 (Thr18)-R, and a
monoclonal P-p53 (Ser15)-R from Santa Cruz were used. A
rabbit antiserum from Upstate Biotechnology (Lake Placid,
NY) detecting specifically acetylated p53 in Lys373 and 382
was used. SMP14 monoclonal antibody (Santa Cruz) was
used to detect the Mdm2 protein. The monoclonal anti-(b-
actin) was from Sigma. Mitochondria were detected using
the MitoTracker Red CMXRos reagent (Molecular Probes,
Eugene, OR). The secondary antibodies used from Amer-
sham were an anti-(mouse-Cy2) (Fluorolink Cy2), anti-
(rabbit-Cy3) (Fluorolink Cy3) and anti-(rabbit-Cy2)
(Fluorolink Cy2) for immunofluorescence, or an anti-
(mouse-HRP) or anti-(rabbit-HRP) for western blots.
Luminescence in western blot was developed with an ECL
kit (Amersham Biosciences).
Acknowledgements
The technical assistance by Virginia Gasco
´
n is greatly
appreciated. SB, LK and FMV were supported by fel-
lowships from Ministerio de Educacio
´
n y Ciencia, EU
Marie Curie Training Center, and Fundacio
´

n Ramo
´
n
Areces and Fundacio
´
n Cientı
´
fica AECC, respectively.
This work was supported by grants from Ministerio
de Educacio
´
n y Ciencia (SAF2004-02900), Fondo de
Investigacio
´
n Sanitaria (FIS-PI02-0585), Fundacio
´
nde
Investigacio
´
nMe
´
dica MM, Junta de Castilla y Leo
´
n
(SAN ⁄ SA04 ⁄ 05 and CSI05A05), and Fundacio
´
n Mem-
oria Samuel Solo
´
rzano Barruso.

References
1 Manning G, Whyte DB, Martinez R, Hunter T &
Sudarsanam S (2002) The protein kinase complement of
the human genome. Science 298, 1912–1934.
2 Kamath RS, Fraser AG, Dong Y, Poulin G, Durbin R,
Gotta M, Kanapin A, Le Bot N, Moreno S, Sohrmann
M et al. (2003) Systematic functional analysis of the
Caenorhabditis elegans genome using RNAi. Nature 421,
231–237.
S. Blanco et al. Differential stabilization of p53 by VRK2 isoforms
FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2501
3 Morrison DK, Murakami MS & Cleghon V (2000) Pro-
tein kinases and phosphatases in the Drosophila genome.
J Cell Biol 150, F57–F62.
4 Dhillon N & Hoekstra MF (1994) Characterization of
two protein kinases from Schizosaccharomyces pombe
involved in the regulation of DNA repair. EMBO J 13,
2777–2788.
5 Hoekstra MF, Liskay RM, Ou AC, DeMaggio AJ, Bur-
bee DG & Heffron F (1991) HRR25, a putative protein
kinase from budding yeast: association with repair of
damaged DNA. Science 253, 1031–1034.
6 Ho Y, Mason S, Kobayashi R, Hoekstra M & Andrews
B (1997) Role of the casein kinase I isoform, Hrr25,
and the cell cycle-regulatory transcription factor, SBF,
in the transcriptional response to DNA damage in
Saccharomyces cerevisiae. Proc Natl Acad Sci USA 94,
581–586.
7 Nezu J, Oku A, Jones MH & Shimane M (1997) Identi-
fication of two novel human putative serine ⁄ threonine

kinases, VRK1 and VRK2, with structural similarity to
vaccinia virus B1R kinase. Genomics 45, 327–331.
8 Lin S, Chen W & Broyles SS (1992) The vaccinia virus
B1R gene product is a serine ⁄ threonine protein kinase.
J Virol 66 , 2717–2723.
9 Banham AH & Smith GL (1992) Vaccinia virus B1R
encodes a 34-kDa serine ⁄ threonine protein kinase that
localizes in cytoplasmic factories and is packaged into
virions. Virology 191, 803–812.
10 Rempel RE & Traktman P (1992) Vaccinia virus B1
kinase: phenotypic analysis of temperature-sensitive
mutants and enzymatic characterization of recombinant
proteins. J Virol 66, 4413–4426.
11 Lopez-Borges S & Lazo PA (2000) The human vaccinia-
related kinase 1 (VRK1) phosphorylates threonine-18
within the mdm-2 binding site of the p53 tumour sup-
pressor protein. Oncogene 19, 3656–3664.
12 Barcia R, Lopez-Borges S, Vega FM & Lazo PA (2002)
Kinetic properties of p53 phosphorylation by the human
vaccinia-related kinase 1. Arch Biochem Biophys 399, 1–5.
13 Nichols RJ & Traktman P (2004) Characterization of
three paralogous members of the mammalian vaccinia
related kinase family. J Biol Chem 279, 7934–7946.
14 Lazo PA, Vega FM & Sevilla A (2005) Vaccinia-related
kinase-1. AfCS-Nature Molecule Pages 10.1038/
mp.a003025.003001.
15 Vega FM, Sevilla A & Lazo PA (2004) p53 stabilization
and accumulation induced by human vaccinia-related
kinase 1. Mol Cell Biol 24, 10366–10380.
16 Sevilla A, Santos CR, Barcia R, Vega FM & Lazo PA

(2004) c-Jun phosphorylation by the human vaccinia-
related kinase 1 (VRK1) and its cooperation with the
N-terminal kinase of c-Jun (JNK). Oncogene 23, 8950–
8958.
17 Sevilla A, Santos CR, Vega FM & Lazo PA (2004)
Human vaccinia-related kinase 1 (VRK1) activates the
ATF2 transcriptional activity by novel phosphorylation
on Thr-73 and Ser-62 and cooperates with JNK. J Biol
Chem 279, 27458–27465.
18 Vega FM, Gonzalo P, Gaspar ML & Lazo PA (2003)
Expression of the VRK (vaccinia-related kinase) gene
family of p53 regulators in murine hematopoietic devel-
opment. FEBS Lett 544, 176–180.
19 Dorrell MI, Aguilar E, Weber C & Friedlander M
(2004) Global gene expression analysis of the developing
postnatal mouse retina. Invest Ophthalmol Vis Sci 45,
1009–1019.
20 Santos CR, Rodriguez-Pinilla M, Vega FM, Rodriguez-
Peralto JL, Blanco S, Sevilla A, Valbuena A, Hernandez
T, van Wijnen AJ, Li F et al. (2006) VRK1 signaling
pathway in the context of the proliferation phenotype in
head and neck squamous cell carcinoma. Mol Cancer
Res 4, 177–185.
21 McLean LA, Gathmann I, Capdeville R, Polymeropou-
los MH & Dressman M (2004) Pharmacogenomic ana-
lysis of cytogenetic response in chronic myeloid
leukemia patients treated with imatinib. Clin Cancer Res
10, 155–165.
22 Shiio Y, Eisenman RN, Yi EC, Donohoe S, Goodlett
DR & Aebersold R (2003) Quantitative proteomic ana-

lysis of chromatin-associated factors. J Am Soc Mass
Spectrom 14, 696–703.
23 Tien ES, Gray JP, Peters JM & Vanden Heuvel JP
(2003) Comprehensive gene expression analysis of per-
oxisome proliferator-treated immortalized hepatocytes:
identification of peroxisome proliferator-activated recep-
tor {alpha}-dependent growth regulatory genes. Cancer
Res 63, 5767–5780.
24 Vernell R, Helin K & Muller H (2003) Identification
of target genes of the p16INK4A-pRB-E2F pathway.
J Biol Chem 278, 46124–46137.
25 Boldrick JC, Alizadeh AA, Diehn M, Dudoit S, Liu
CL, Belcher CE, Botstein D, Staudt LM, Brown PO
& Relman DA (2002) Stereotyped and specific gene
expression programs in human innate immune
responses to bacteria. Proc Natl Acad Sci USA 99,
972–977.
26 Diehn M, Alizadeh AA, Rando OJ, Liu CL, Stankunas
K, Botstein D, Crabtree GR & Brown PO (2002) Geno-
mic expression programs and the integration of the
CD28 costimulatory signal in T cell activation. Proc
Natl Acad Sci USA 99, 11796–11801.
27 Prives C & Hall PA (1999) The p53 pathway. J Pathol
187, 112–126.
28 Vousden KH & Lu X (2002) Live or let die: the cell’s
response to p53. Nat Rev Cancer 2, 594–604.
29 Garcia-Cao I, Garcia-Cao M, Martin-Caballero J, Cri-
ado LM, Klatt P, Flores JM, Weill JC, Blasco MA &
Serrano M (2002) ‘Super p53’ mice exhibit enhanced
DNA damage response, are tumor resistant and age

normally. EMBO J 21, 6225–6235.
Differential stabilization of p53 by VRK2 isoforms S. Blanco et al.
2502 FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS
30 Hemann MT, Fridman JS, Zilfou JT, Hernando E,
Paddison PJ, Cordon-Cardo C, Hannon GJ & Lowe
SW (2003) An epi-allelic series of p53 hypomorphs cre-
ated by stable RNAi produces distinct tumor pheno-
types in vivo. Nat Genet 33, 396–400.
31 Alarcon-Vargas D & Ronai Z (2002) p53-Mdm2 – the
affair that never ends. Carcinogenesis 23, 541–547.
32 Woods DB & Vousden KH (2001) Regulation of p53
function. Exp Cell Res 264, 56–66.
33 Saito S, Yamaguchi H, Higashimoto Y, Chao C, Xu Y,
Fornace AJ Jr, Appella E & Anderson CW (2003) Phos-
phorylation site interdependence of human p53 post-
translational modifications in response to stress. J Biol
Chem 278, 37536–37544.
34 Meek DW (1998) Multisite phosphorylation and the
integration of stress signals at p53. Cell Signal 10, 159–
166.
35 Bode AM & Dong Z (2004) Post-translational modifica-
tion of p53 in tumorigenesis. Nat Rev Cancer 4, 793–
805.
36 Siliciano JD, Canman CE, Taya Y, Sakaguchi K,
Appella E & Kastan MB (1997) DNA damage induces
phosphorylation of the amino terminus of p53. Genes
Dev 11, 3471–3481.
37 de Rozieres S, Maya R, Oren M & Lozano G (2000)
The loss of mdm2 induces p53-mediated apoptosis.
Oncogene 19, 1691–1697.

38 Ljungman M (2000) Dial 9-1-1 for p53: mechanisms of
p53 activation by cellular stress. Neoplasia 2, 208–225.
39 Appella E & Anderson CW (2001) Post-translational
modifications and activation of p53 by genotoxic stres-
ses. Eur J Biochem 268, 2764–2772.
40 Brooks CL & Gu W (2003) Ubiquitination, phosphory-
lation and acetylation: the molecular basis for p53 regu-
lation. Curr Opin Cell Biol 15, 164–171.
41 Ashcroft M, Taya Y & Vousden KH (2000) Stress sig-
nals utilize multiple pathways to stabilize p53. Mol Cell
Biol 20, 3224–3233.
42 Dumaz N, Milne DM, Jardine LJ & Meek DW
(2001) Critical roles for the serine 20, but not the ser-
ine 15, phosphorylation site and for the polyproline
domain in regulating p53 turnover. Biochem J 359,
459–464.
43 Dumaz N & Meek DW (1999) Serine 15 phosphoryla-
tion stimulates p53 transactivation but does not directly
influence interaction with HDM2. EMBO J 18, 7002–
7010.
44 Lambert PF, Kashanchi F, Radonovich MF, Shiekhat-
tar R & Brady JN (1998) Phosphorylation of p53 serine
15 increases interaction with CBP. J Biol Chem 273,
33048–33053.
45 Shieh SY, Ahn J, Tamai K, Taya Y & Prives C (2000)
The human homologs of checkpoint kinases Chk1 and
Cds1 (Chk2) phosphorylate p53 at multiple DNA
damage-inducible sites. Genes Dev 14, 289–300.
46 Jackson MW, Agarwal MK, Agarwal ML, Agarwal A,
Stanhope-Baker P, Williams BR & Stark GR (2004)

Limited role of N-terminal phosphoserine residues in
the activation of transcription by p53. Oncogene 23,
4477–4487.
47 Sluss HK, Armata H, Gallant J & Jones SN (2004)
Phosphorylation of serine 18 regulates distinct p53 func-
tions in mice. Mol Cell Biol 24, 976–984.
48 Knights CD, Liu Y, Appella E & Kulesz-Martin M
(2003) Defective p53 post-translational modification
required for wild type p53 inactivation in malignant
epithelial cells with mdm2 gene amplification. J Biol
Chem 278, 52890–52900.
49 Sakaguchi K, Saito S, Higashimoto Y, Roy S, Ander-
son CW & Appella E (2000) Damage-mediated phos-
phorylation of human p53 threonine 18 through a
cascade mediated by a casein 1-like kinase. Effect on
mdm2 binding. J Biol Chem 275, 9278–9283.
50 Dumaz N, Milne DM & Meek DW (1999) Protein
kinase CK1 is a p53-threonine 18 kinase which requires
prior phosphorylation of serine 15. FEBS Lett 463,
312–316.
51 Stoter M, Bamberger AM, Aslan B, Kurth M, Speidel
D, Loning T, Frank HG, Kaufmann P, Lohler J,
Henne-Bruns D et al. (2005) Inhibition of casein kin-
ase I delta alters mitotic spindle formation and indu-
ces apoptosis in trophoblast cells. Oncogene 24, 7964–
7975.
52 Chen J, Marechal V & Levine AJ (1993) Mapping of
the p53 and mdm-2 interaction domains. Mol Cell Biol
13, 4107–4114.
53 Schon O, Friedler A, Bycroft M, Freund S & Fersht A

(2002) Molecular mechanism of the interaction between
MDM2 and p53. J Mol Biol 323, 491–501.
54 Jabbur JR, Tabor AD, Cheng X, Wang H, Uesugi M,
Lozano G & Zhang W (2002) Mdm-2 binding and TAF
(II) 31 recruitment is regulated by hydrogen bond dis-
ruption between the p53 residues Thr18 and Asp21.
Oncogene 21, 7100–7113.
55 Yuan ZM, Huang Y, Ishiko T, Nakada S, Utsugisawa
T, Shioya H, Utsugisawa Y, Yokoyama K, Weichsel-
baum R, Shi Y et al. (1999) Role for p300 in stabiliza-
tion of p53 in the response to DNA damage. J Biol
Chem 274, 1883–1886.
56 Grossman SR (2001) p300 ⁄ CBP ⁄ p53 interaction and
regulation of the p53 response. Eur J Biochem 268,
2773–2778.
57 Ito A, Lai CH, Zhao X, Saito S, Hamilton MH,
Appella E & Yao TP (2001) p300 ⁄ CBP-mediated p53
acetylation is commonly induced by p53-activating
agents and inhibited by MDM2. EMBO J 20, 1331–
1340.
58 Dornan D, Shimizu H, Perkins ND & Hupp TR (2003)
DNA-dependent acetylation of p53 by the transcription
coactivator p300. J Biol Chem 278, 13431–13441.
S. Blanco et al. Differential stabilization of p53 by VRK2 isoforms
FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS 2503
59 Damia G, Filiberti L, Vikhanskaya F, Carrassa L, Taya
Y, D’Incalci M & Broggini M (2001) Cisplatinum and
taxol induce different patterns of p53 phosphorylation.
Neoplasia 3, 10–16.
60 Webley K, Bond JA, Jones CJ, Blaydes JP, Craig A,

Hupp T & Wynford-Thomas D (2000) Posttranslational
modifications of p53 in replicative senescence overlap-
ping but distinct from those induced by dna damage.
Mol Cell Biol 20, 2803–2808.
61 Milne DM, Palmer RH, Campbell DG & Meek DW
(1992) Phosphorylation of the p53 tumour-suppressor
protein at the three N-terminal sites by a novel casein
kinase I-like enzyme. Oncogene 7, 1361–1369.
62 Milne DM, Campbell DG, Caudwell FB & Meek DW
(1994) Phosphorylation of tumor suppressor protein p53
by mitogen-activated protein kinase. J Biol Chem 269,
9253–9260.
63 Ashcroft M, Kubbutat MH & Vousden KH (1999) Reg-
ulation of p53 function and stability by phosphoryla-
tion. Mol Cell Biol 19, 1751–1758.
64 Dornan D & Hupp TR (2001) Inhibition of p53-depen-
dent transcription by BOX-I phospho-peptide mimetics
that bind to p300. EMBO Report 2 , 139–144.
65 Ferguson M, Luciani MG, Finlan L, Rankin EM,
Ibbotson S, Fersht A & Hupp TR (2004) The develop-
ment of a CDK2-docking site peptide that inhibits p53
and sensitizes cells to death. Cell Cycle 3, 80–89.
66 Kubbutat MHG, Jones SN & Vousden KH (1997) Reg-
ulation of p53 stability by mdm2. Nature 387, 299–303.
67 Stewart ZA, Tang LJ & Pietenpol JA (2001) Increased
p53 phosphorylation after microtubule disruption is
mediated in a microtubule inhibitor- and cell-specific
manner. Oncogene 20, 113–124.
68 Pospisilova S, Brazda V, Kucharikova K, Luciani MG,
Hupp TR, Skladal P, Palecek E & Vojtesek B (2004)

Activation of the DNA-binding ability of latent p53
protein by protein kinase C is abolished by protein
kinase CK2. Biochem J 378, 939–947.
69 Kussie PH, Gorina S, Marechal V, Elenbaas B, Moreau
J, Levine AJ & Pavletich NP (1996) Structure of the
MDM2 oncoprotein bound to the p53 tumor suppressor
transactivation domain. Science 274, 948–953.
70 Li M, Luo J, Brooks CL & Gu W (2002) Acetylation of
p53 inhibits its ubiquitination by Mdm2. J Biol Chem
277, 50607–50611.
71 Agoulnik AI, Lu B, Zhu Q, Truong C, Ty MT, Arango
N, Chada KK & Bishop CE (2002) A novel gene, Pog,
is necessary for primordial germ cell proliferation in the
mouse and underlies the germ cell deficient mutation,
gcd. Hum Mol Genet 11, 3047–3053.
72 Lu B & Bishop CE (2003) Late onset of spermatogen-
esis and gain of fertility in POG-deficient mice indicate
that POG is not necessary for the proliferation of sper-
matogonia. Biol Reprod 69, 161–168.
Differential stabilization of p53 by VRK2 isoforms S. Blanco et al.
2504 FEBS Journal 273 (2006) 2487–2504 ª 2006 The Authors Journal compilation ª 2006 FEBS