Báo cáo khóa học: NF-jB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene ppt

NF-jB- and c-Jun-dependent regulation of human cytomegalovirus
immediate-early gene enhancer/promoter in response to
lipopolysaccharide and bacterial CpG-oligodeoxynucleotides
in macrophage cell line RAW 264.7
Younghee Lee
1
, Wern-Joo Sohn
3
, Doo-Sik Kim
2,3
and Hyung-Joo Kwon
3
1
Cell Biology Laboratory, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Yusong, Daejon, Korea;
2
Department of Biochemistry and
3
Institute of Life Science and Biotechnology, College of Science, Yonsei University, Seoul, Korea
The cytomegalovirus immediate-early (CMV IE) gene
enhancer/promoter regulates the expression of immediate-
early gene products and initiation of CMV replication.
TNF-a and lipopolysaccharide (LPS) strongly activate the
promoter, possibly involving NF-jB. CpG-oligodeoxy-
nucleotides (CpG-ODNs), which contain unmethylated
CpG dinucleotides in the context of particular base
sequences, have gained attention because of their stimulating
effects, via NF-jB, which have a strong innate immune
response. To study the effects of LPS and CpG-ODNs, as
well as the mechanisms of their actions regarding CMV IE
enhancer/promoter activation, we used a macrophage cell
line, RAW 264.7. Stimulation of the cells with LPS or CpG-

ODNs resulted in the activation of the CMV IE enhancer/
promoter. We examined the involvement of NF-jBand
c-Jun transcription factors by promoter deletion/site-specific
mutation analysis and ectopic expression, and found them to
have additive effects. Involvement of myeloid differentiation
protein, an upstream regulator of NF-jB and c-Jun,
was also investigated. Experimental results indicate that
both LPS-induced and CpG-ODN-induced activations of
CMV IE enhancer/promoter are mediated by Toll-like
receptor signaling molecules. Several lines of evidence sug-
gest the potential contribution of bacterial infection in CMV
reactivation along with the potential application of CpG-
ODNs in gene therapy as a stimulator for the optimal
expression of target genes under the control of the CMV IE
enhancer/promoter.
Keywords: CMV IE gene enhancer/promoter; CpG-ODN;
lipopolysaccharide; macrophage; NF-jB.
Human cytomegalovirus (CMV) is a ubiquitous b-herpes-
virus that causes severe disease in immunocompromised
patients who have had this virus reactivated from latency
[1]. Previous studies suggest that macrophage-lineage cells
may provide a long-lived site for CMV latency [2–4]. The
CMV immediate-early (IE) enhancer/promoter regulates
the expression of immediate-early gene products and the
initiation of CMV replication [5,6]. The enhancer/promoter
region of the CMV IE gene contains a complex array of
potential regulatory elements: four types of repetitive
sequence elements of 16, 18, 19 and 21 bp repeats, which
occur three to five times within the enhancer region. These
elements contain consensus binding sites for transcription

factors such as NF-jB/Rel, ATF/CREB, YY1 and NF1
[7–13]. Furthermore, binding sites for multiple transcription
factors, including Sp1 (a serum response element), ELK-1,
CCAAT/enhancer binding protein, retinoic acid receptor
RAR-RXR family members and AP-1 have been identified
[7,12–16].
TNF-a has been identified as a powerful mediator of
CMV stimulation and reactivation in human and murine
monocyte/macrophage progenitors [3]. TNF-a and lipo-
polysaccharide (LPS) strongly activate the CMV IE
enhancer/promoter, which is mediated by nuclear factor
jB(NF-jB) that binds to the jB sites in the IE enhancer/
promoter [17,18]. However, detailed studies are required to
understand the mechanisms involved in this action.
The immediate recognition of bacteria and their pro-
ducts in the early line of host defense is mediated by an
ancient immune response that uses conserved pattern
recognition receptors to distinguish the pathogen-associ-
ated molecular pattern signatures of bacterial components
[19]. A wide variety of bacterial components including
LPS, bacterial DNA, peptidoglycan and lipoteichoic acid
are capable of stimulating the innate immune responses
[20]. LPS is the major component of the outer surface of
Gram-negative bacteria; it is a typical example of potent
activators. LPS-induced activation of the innate immune
system is mediated through Toll-like receptor (TLR) 4,
which is a transmembrane receptor that shares a high
degree of homology with TLR9 [21,22]. The innate
Correspondence to H J.Kwon,InstituteofLifeScienceand
Biotechnology, College of Science, Yonsei University,

Seoul 120-749, Korea.
Fax: + 82 2 312 6027, Tel.: + 82 2 2123 6521,
E-mail:
Abbreviations: CMV IE, cytomegalovirus immediate-early;
CpG-ODNs, oligodeoxynucleotides; IjBaSR, IjBa super repressor;
IL-1R, IL-1 receptor; MyD88, myeloid differentiation protein;
TLR, Toll-like receptor.
(Received 22 November 2003, revised 15 January 2004,
accepted 26 January 2004)
Eur. J. Biochem. 271, 1094–1105 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04011.x
immune system recognizes synthetic oligodeoxynucleotides
(CpG-ODNs) and bacterial DNA containing unmethyl-
ated CpG dinucleotides in the context of particular base
sequences (CpG motifs) [23–25]. Immune activation by
CpG-ODNs depends on TLR9, which determines the
specificity of CpG motifs [26–28].
Through TLR-dependent signaling pathways in macro-
phages, LPS and CpG-ODNs induce the activation of
several transcription factors including NF-jB [25,29,30].
NF-jB activation requires signal transduction molecules
such as myeloid differentiation protein (MyD88), IL-1
receptor (IL-1R)-associated kinase, tumor necrosis factor
receptor-associated kinase 6 and IjB kinase [30–34]. Sti-
mulation of this pathway by LPS and CpG-ODNs results
in the activation of IjB kinase [31,35]; subsequently, IjB
kinase phosphorylates IjBa at serines 32 and 36, leading to
its degradation and the subsequent release and translocation
of NF-jB to the nucleus, where NF-jB facilitates the
transcriptional upregulation of genes downstream from the
jB motif. The exposure of macrophages to LPS and CpG-

ODNs also results in the activation of the mitogen-activated
protein kinase pathways, including the extracellular signal-
related kinase, c-Jun NH
2
-terminal kinase and p38 cascades
[36,37]. AP-1 activity is regulated in part by the activation
of c-Jun NH
2
-terminal kinase which phosphorylates and
subsequently increases the transcriptional activity of c-Jun
in LPS- and CpG-ODN-treated macrophages [37,38]. These
common features of the signaling of LPS and CpG-ODNs
suggest that the two stimulators use similar intracellular
pathways to display their shared actions. LPS and CpG-
ODNs modulate the expression of many genes that encode
cytokines, cell surface receptors, transcription factors and
proteins related to the proliferation/differentiation of cells
[39,40].
To examine the effects of LPS and CpG-ODNs in cells
that harbor a CMV promoter and to understand the
mechanisms of CMV IE enhancer/promoter activation,
we used a line of RAW 264.7 cells that exhibit NF-jB-
dependent activation of the CMV IE enhancer/promoter
upon LPS or CpG-ODNs stimulation. We examined
involvement of NF-jB, c-Jun transcription factors and
MyD88. Our results indicate that LPS-induced and CpG-
ODN-induced signals use TLR/IL-1R signaling molecules
for CMV IE enhancer/promoter activation.
Materials and methods
Cell culture and reagents

The RAW 264.7 cell line was obtained from the American
Type Culture Collection (ATCC, Manassas, VA, USA).
Cells were maintained in Dulbecco’s modified Eagle’s
medium (DMEM) with 10% (v/v) fetal bovine serum,
100 UÆmL
)1
penicillin and 100 lgÆmL
)1
streptomycin. Viab-
ility, which was assayed using trypan blue dye exclusion, was
typically greater than 95%. Cultures were maintained until
passage 20 and then discarded. Escherischia coli LPS (Sigma,
St. Louis, MO, USA) was suspended in sterile water and
added to the cell culture to obtain the desired concentrations.
The NF-jB p65 monoclonal antibody was purchased
from Santa Cruz Biotechnology (Santa Cruz, CA, USA).
The rabbit polyclonal antibodies to IjBa and c-Jun were
purchased from Cell Signaling Technology (Beverly, MA,
USA). Expression vectors encoding NF-jB p65 (pTL-1
vector), IjBaSR (LxSN vector) and c-Jun (pTL-1 vector)
were kindly provided by H. Nakshatri (Indiana University,
School of Medicine, Indianapolis, IN, USA). An expression
vector encoding a dominant negative version of MyD88
(DMyD88) was kindly provided by J. Tschopp (University
of Lausanne, Epalinges, Switzerland).
Oligodeoxynucleotides
Phosphorothioate backbone oligodeoxynucleotides were
purchased from GenoTech (Daejeon, Korea). The CpG-
ODN 1826 that we used consisted of 20 bases that con-
tained two CpG motifs (underlined): TCCA

TGCGTT
CCT
GACGTT. Derivatives of the CpG-ODN 1826 se-
quence with one or two of the CG sequences reversed to GC
(indicated by bold lettering) are as follows: CpG-ODN
1826(S-1, TCCAT
GAGCTTCCTGACGTT); 1826(S-2,
TCCAT
GACGTTCCTGAGCTT) and 1826(S-3, TCC
AT
GAGCTTCCTGAGCTT). The non-CpG-ODN 2041
(CTGGTCTTTCTGGTTTTTTTCTGG) served as a neg-
ative control. The LPS content of ODNs was <1 ng
LPSÆmg
)1
DNA as measured by a Limulus amebocyte assay
(Whittaker Bioproducts, Walkersville, MD, USA).
Construction of luciferase reporter plasmids
The CMV IE enhancer/promoter fragments )740 to +65,
)507 to +65, )300 to +65, )185 to +65 and )130 to +65
relative to the IE transcription start were amplified by
polymerase chain reactions using the entire native CMV
enhancer/promoter sequences as a template with the fol-
lowing primer sets: 5¢-primers, CMV IE ()740) 5¢-AGGT
ACCCAATATTGGCCATTAGCC-3¢;CMVIE()507)
5¢-CGGTACCTGGCCCGCCTGGCTGAC-3¢;CMVIE
()300) 5¢-TGGTACCATGCCCAGTACATGACCTTA-3¢;
CMV IE ()185) 5¢-TGGTACCCGGTTTGACTCACG
GGGATT-3¢;CMVIE()130) 5¢-TGGTACCTTGTTT
TGGCACCAAAATCA-3¢ and 3¢ primer, CMV IE (+65)

5¢-AAGATCTGACTGCGTTAGCAATTTAAC-3¢.The
CMV IE enhancer/promoter fragments were ligated into
KpnIandBglII sites of the luciferase reporter plasmid
pGL3-basic vector (Promega, Madison, WI, USA) yielding
the reporter constructs pCMV-Luc,pCMV()507)-Luc,
pCMV()300)-Luc,pCMV()185)-Luc and pCMV()130)-
Luc. To introduce site-specific mutations in NF-jBand
AP-1 binding sites, the transcription factor recognition
sites were abrogated and changed to ClaIsitesbyatwo
step PCR mutagenesis method [41] using 5¢-primer
CMV IE ()740) and 3¢-primer CMV IE (+65) along with
the primers encoding the following sequences in sense or
antisense orientation: mNF-jB1, 5¢-GTAACGCCAAT
AtcGAtTTTCCATTG-3¢; mNF-jB2, 5¢-ACATGACCT
TAatcGAtTTTCCTACT-3¢; mNF-jB3, 5¢-GTTTGACT
CAatcGatTTTCCAAGTC-3¢;mNF-jB4, 5¢-CCAAAAT
CAAatcGatTTTCCAAAATG-3¢;mAP-1,5¢-TAGCGG
TTTatCgatCGGGGATTTCC-3¢. Mutated sites are indi-
cated with lower case letters. The full-length CMV IE
enhancer/promoter sequences ()740 to +65) including
the mutations were ligated into the KpnIandBglII sites
of pGL3-basic vector yielding the reporter constructs
Ó FEBS 2004 CMV IE enhancer/promoter regulation by LPS and CpG-ODNs (Eur. J. Biochem. 271) 1095
pCMVmNF-jB1-Luc,pCMVmNF-jB2-Luc,pCMVmN
F-jB3-Luc, pCMVmNF-jB4-Luc,pCMVmAP-1-Luc.
Transfection and luciferase assay
One day before the transfection, RAW 264.7 cells were
placed into six-well plates at a concentration of 5 · 10
5
cells

per well. Cells were transfected using FuGene 6 Transfec-
tion Reagent (Roche, Indianapolis, IN, USA) following the
manufacturer’s instructions, in DMEM with 10% (v/v)
FBS. For each comparison between constructs, we con-
firmed equivalent transfection efficiency by cotransfecting
the promoterless Renilla luciferase vector pRL-null (Pro-
mega, Madison, WI, USA) as an internal control [42]. After
the transfection, the cells were placed in a complete medium
for 24 h prior to LPS (100 ngÆmL
)1
or as indicated in the
individual experiments) or CpG-ODNs (3 l
M
or as indica-
ted in the individual experiments) treatment for 6 h or as
indicated in the individual experiments. The cells were
harvested, washed and lysed by freeze-thawing three times,
and the luciferase activities were determined using the Dual-
Luciferase Reporter Assay System (Promega, Madison,
WI, USA) with a TD-20/20 luminometer (Turner Designs,
Sunnyvale, CA, USA) according to the manufacturer’s
specifications. Individual assays were normalized for Renilla
luciferase activity and the data are presented as the fold
increase in activity relative to empty vector control. The
data are from two or three independent experiments
performed in duplicate or triplicate with similar results.
Standard errors are indicated.
Indirect immunofluorescence assays and confocal
microscopy
We detected NF-jB p65 nuclear localization by indirect

immunofluorescence assays using confocal microscopy as
described previously [43]. RAW 264.7 cells (5 · 10
4
)were
cultured directly on glass coverslips in 24-well plates. After
24 h, the cells were transfected with the IjBa super
repressor (IjBaSR) construct. After an additional 24 h,
the cells were fixed with 4% (v/v) paraformaldehyde in
NaCl/P
i
for 10 min at room temperature; they were then
permeabilized with 0.2% (v/v) Triton X-100 in NaCl/P
i
for
10 min and blocked with a solution of NaCl/P
i
, 15% (v/v)
normal donkey serum (Sigma, St. Louis, MO, USA) and
0.2% (v/v) Tween-20. Monoclonal antibodies to NF-
jB p65 were applied for 1 h followed by 1 h incubation
with Texas Red-conjugated donkey anti-mouse IgG (Jack-
son ImmunoResearch Laboratories, Inc., West Grove, PA,
USA). For double immunofluorescence staining of NF-
jBp65and IjBa, a primary rabbit polyclonal antibody
that recognizes IjBa was used and detected with a goat anti-
rabbit IgG linked to fluorescein isothiocyanate (Jackson
ImmunoResearch Laboratories, Inc., West Grove, PA,
USA). To identify cell nuclei, we used DNA staining
(0.5 lgÆmL
)1

of Hoechst no. 33258; Sigma, St. Louis, MO,
USA). Coverslips were mounted in Fluoromount-G (South-
ern Biotechnology Associates, Inc., Birmingham, AL,
USA). Samples were scanned with a Zeiss LSM 510 laser
scanning confocal device attached to an Axiovert 100
microscope using a Plan-Apochromat 100X/Oil DIC
objective (Carl Zeiss, Germany).
Western blotting
Equal amounts of protein were resolved in 10% (v/v) SDS/
PAGE and electrotransferred to poly(vinylidene difluoride)
membranes (Millipore, Bedford, MA, USA). Membranes
were blocked in NaCl/Tris containing 0.05% (v/v) Tween-
20 and 2% (v/v) BSA for 1 h at room temperature and
incubated with appropriate primary antibody for 2 h.
Immunoreactive proteins were detected by horseradish
peroxidase-conjugated secondary antibody (Jackson Immu-
noResearch Laborities, Inc.) and an enhanced chemilu-
minescence reagent (Amersham Pharmacia Biotech,
Piscataway, NJ, USA).
Results
Activation of the CMV IE enhancer/promoter
in LPS-treated RAW 264.7 cells
To examine LPS-stimulated CMV promoter activation in
RAW 264.7 cells, we used a 740 bp CMV IE enhancer/
promoter-luciferase reporter construct (pCMV-Luc). In the
CMV IE enhancer/promoter gene located between the
)425 to )80 bp 5¢-region of the transcription start site,
Fig. 1. LPS stimulates CMV IE enhancer/promoter in RAW 264.7
cells. (A) Structure of the CMV IE enhancer/promoter. (B and C)
RAW 264.7 cells were transiently transfected with pCMV-Luc for

24 h. The cells were then stimulated with increasing amounts of LPS
for 6 h (B) or 100 ngÆmL
)1
LPS for different time periods (C). Cells
were harvested and cell lysates were obtained by freeze-thaw. The
luciferase activity, which was normalized to Renilla activity, was
measured as relative light units (RLU). The results are represented as
fold activation compared with control vector alone.
1096 Y. Lee et al.(Eur. J. Biochem. 271) Ó FEBS 2004
there are four copies of the NF-jB and one copy of the
AP-1 binding sites (Fig. 1A). LPS activates the Toll-like
receptor-dependent signaling pathway in macrophages,
including the transcription factors NF-jBandc-Jun
[32,38]. As expected, LPS activated the promoter in a time-
and dose-dependent manner (Fig. 1B,C). When the cells
were stimulated with 100 ngÆmL
)1
of LPS for 6 h, the
activation of the promoter reached its maximum level
(Fig. 1B,C). The following experiments were carried out
under these conditions to estimate the CMV IE enhancer/
promoter activity.
The NF-jB p65 and c-Jun activity required for LPS-
induced CMV IE enhancer/promoter activation
To examine the relative contribution of NF-jBandc-Junto
CMV IE enhancer/promoter activation, we cotransfected
expression plasmids encoding NF-jB p65, c-Jun or both
into RAW 264.7 cells with a promoter-reporter construct,
and the luciferase activity was estimated. First, when the
ability of NF-jB p65 to transactivate the reporter was

tested, the expressed NF-jB p65 significantly activated the
CMV IE enhancer/promoter in a dose-dependent manner
(Fig. 2A). Cotransfection of an NF-jB p65 expression
vector at a concentration of 200 ngÆmL
)1
conferred about
a five-fold increase in the activation over the empty
expression vector control. To determine the contribution
of c-Jun to CMV IE enhancer/promoter activation, we
introduced the ectopic expression of c-Jun, which also
activated the promoter in a dose-dependent manner
(Fig. 2B). The expression of both NF-jBp65 andc-Jun
resulted in an approximately two-fold increase in the
stimulation of the transcription compared with the expres-
sion of NF-jB p65 or c-Jun alone (Fig. 2C). These
Fig. 2. Ectopic expression of NF-jB p65 and c-Jun enhances LPS-induced CMV IE enhancer/promoter activation. (A and B) RAW cells were
transfected with pCMV-Luc and indicated amounts of plasmids expressing NF-jB p65 (A) or c-Jun (B). (C) RAW 264.7 cells were cotransfected
with pCMV-Luc, Renilla internal control plasmid and 50 ng of the expression vector encoding either NF-jB p65 or c-Jun or both. (D) RAW 264.7
cells were cotransfected with pCMV-Luc and 50 ng of the indicated plasmid constructs. Six hours before harvest, cultures were treated with LPS
(100 ngÆmL
)1
). Luciferase assays were performed as described. Experiments represent one of three independent experiments with similar qualitative
results. (E) Ectopic expression of NF-jB p65 and c-Jun RAW 264.7 cells were transfected with 0.2 lgofNF-jB p65 or c-Jun expression vector.
After 24 h, cells were stimulated with 100 ngÆmL
)1
of LPS for 6 h. Cell lysates were analyzed by Western blotting with a polyclonal antibody
specific for c-Jun and monoclonal antibodies to NF-jB p65 and a-actin.
Ó FEBS 2004 CMV IE enhancer/promoter regulation by LPS and CpG-ODNs (Eur. J. Biochem. 271) 1097
observations indicate that each of the transcription factors
contributes to CMV IE enhancer/promoter activation in

RAW 264.7 cells.
Further investigation was performed to examine the
contribution of NF-jB and c-Jun to LPS-dependent activa-
tion of the CMV IE enhancer/promoter. Treatment of
RAW 264.7 cells with LPSresulted in an approximately two-
fold increase in the promoter activity. The expression of NF-
jB p65 dramatically increased LPS-induced transactivation
of the promoter (Fig. 2D). As expected, ectopic expression
of c-Jun also greatly increased the promoter activity in
RAW 264.7 cells treated with LPS (Fig. 2D). Taken
together, these data demonstrate that NF-jBp65 and
c-Jun are components of the LPS signaling pathway, provi-
ding further evidence that NF-jB p65 and c-Jun are essent-
ial components of CMV IE enhancer/promoter activation.
To exclude the possibility of LPS stimulation affects on
the ectopic expression of NF-jB p65 or c-Jun (pTL-1
vector), we analyzed the lysates from each set of expression
vector-transfected cells following stimulation with LPS for
6 h (Fig. 2E). LPS did not change total NF-jBp65orc-Jun
protein levels. We could not detect any dramatic increase in
expression of NF-jB p65 or c-Jun in transfected cells using
Western blotting, probably because of the transfection
efficiency in RAW cells and high expression of endogenous
proteins (Fig. 2E). However, we did detect higher expres-
sion of NF-jB p65 or c-Jun in a subpopulation of cells
transfected with NF-jB p65 or c-Jun expression vector
using immunostaining and confocal microscopy images
(data not shown). In order to further confirm that pTL-1
vectors do not respond to LPS, we constructed a pTL-1-
luciferase reporter (pTL-1-Luc) and examined its regulation

in RAW 264.7 cells after stimulation with LPS. LPS did not
change the luciferase activity in pTL-1-Luc transfected cells
(data not shown).
Inhibition of NF-jB p65 nuclear localization suppresses
LPS-induced CMV IE enhancer/promoter activation
To verify whether the CMV IE enhancer/promoter is
modulated by LPS dependent nuclear localization of
NF-jB p65, it was attempted to analyze the location of
NF-jB p65 by immunostaining and confocal microscopy.
In RAW 264.7 cells transfected with an empty expression
vector and in the absence of exogenous LPS, NF-jBp65is
primarily cytoplasmic as associated with IjBa (Fig. 3, first
row). The degradation of IjBa and nuclear accumulation
of NF-jB p65 were strongly induced after stimulation
with LPS in RAW 264.7 cells transfected with an empty
expression vector (Fig. 3, second row). In contrast, the
Fig. 3. Inhibition of NF-jB p65 nuclear loca-
lization by IjBaSR in LPS stimulated
RAW 264.7 cells. Inhibition of NF-jBp65
nuclear localization by IjBaSR. Cells were
transfected with the IjBaSR expression vector
(0.2 lgÆmL
)1
)for24handtreatedwithLPS.
Degradation of IjBa and localization of NF-
jB p65 were visualized by confocal micros-
copy after immunofluorescence staining with
antibodies to NF-jBp65(red)andIjBa
(green). Cells were stained with Hoechst
no. 33258 to visualize the nuclei (blue).

1098 Y. Lee et al.(Eur. J. Biochem. 271) Ó FEBS 2004
expression of a mutant IjBa protein (IjBa super repressor,
IjBaSR) that cannot be phosphorylated on serines 32 and
36 blocked the degradation of IjBa and nuclear accumu-
lation of NF-jB p65 induced by LPS (Fig. 3, third row).
To examine the contribution of NF-jB p65 nuclear
localization to LPS-induced CMV promoter activation, an
IjBaSR expressing vector was employed in a dose-depend-
ent manner. As expected, the expression of IjBaSR inhibited
activation of the promoter in an IjBaSR dose-dependent
manner (Fig. 4A). To confirm the effect of ectopically
expressed IjBaSR on LPS-induced IjBa degradation, the
protein level of IjBa was estimated after the stimulation.
Empty expression vector or IjBaSR expression vector-
transfected cell was exposed to LPS for 30 min and then
IjBa was analyzed by Western blot using an antibody
against IjBa.AsshowninFig.4B,IjBa degradation after
LPS treatment was not detected in IjBaSR transfected cells.
These experimental results indicate that LPS-dependent NF-
jB p65 nuclear localization is critical for activation of the
CMV IE enhancer/promoter in RAW 264.7 cells. To deter-
mine whether LPS stimulation alters ectopic expression of
the IjBaSR, Western blottingwas performed with the lysates
from IjBaSR expression vector-transfected cells after sti-
mulation withLPS for 6 h. There wasno significant variation
in the expression of IjBa in LPS-stimulated cells (Fig. 4C).
Deletion analysis of the CMV IE enhancer/promoter
To analyze the 5¢-region of the CMV IE enhancer/promo-
ter, RAW 264.7 cells were transiently transfected with a
series of plasmids containing progressive truncations of

the 5¢-promoter sequence between )740 and )130 bp, and
luciferase activities were analyzed 6 h later (Fig. 5A). The
full-length promoter pCMV-Luc had strong luciferase
activity, but deletion of 232 bp [)740 to )508 bp,
pCMV()507)-Luc] resulted in higher activity than that of
pCMV-Luc. This finding suggests that negative regulatory
elements are located in a region between )740 and )507 bp.
Deletion up to the )301 bp position did not significantly
affect the luciferase activity, whereas progressive deletion
in the region )300 to )130 bp dramatically decreased the
activity. Therefore, the two NF-jB sites and one AP-1 site
located in the region appear to be critical for basal
activation of the promoter.
To define the LPS-responsive elements of the CMV IE
enhancer/promoter, deletion constructs were transiently
transfected into RAW 264.7 cells, which were treated with
100 ngÆmL
)1
LPS (Fig. 5B). Deletion of the upstream
sequence of )507 bp resulted in higher LPS-induced
promoter activation than that of pCMV-Luc. Removal of
aregionfrom)507 to )301 bp [pCMV()300)-Luc], which
contains an NF-jB site, reduced LPS-induced promoter
activation by  35%. In addition, deletion to )185 bp,
which lacks another NF-jB site, further reduced the LPS-
induced response. Furthermore, deletion to )130 bp
removed a region that contained the AP-1 and NF-jBsites
and abolished the LPS-induced promoter activity. These
results imply that NF-jB and AP-1 sites are required for
the LPS-induced CMV IE enhancer/promoter activity in

the macrophage.
The contribution of NF-jB and AP-1 binding sites
to the CMV IE enhancer/promoter
To better evaluate the individual contribution of NF-jBand
AP-1 to the activity of the CMV promoter, the constructs of
the deletion mutant promoter were transiently cotransfected
with expression plasmids encoding NF-jB p65 or c-Jun into
RAW 264.7 cells (Fig. 6). Cotransfection of an NF-jBp65
expression vector at a concentration of 50 ngÆmL
)1
with a
full-length promoter (pCMV-Luc) conferred about three-
fold increase in activation over basal transcriptional levels.
Deletion of the upstream sequence of )507bpcausedthe
activity of the promoter to be higher than the activity of
pCMV-Luc. However, progressive deletion of the NF-jB
binding sites from the CMV IE enhancer/promoter
Fig. 4. Degradation of IjBa required for CMV IE enhancer/promoter
activation in LPS stimulated RAW 264.7 cells. (A) Inhibition of
LPS-induced CMV IE enhancer/promoter activation by IjBaSR.
RAW 264.7 cells were cotransfected with pCMV-Luc and indicated
amounts of plasmid expressing IjBaSR. The cells were treated with
LPS (100 ngÆmL
)1
) for 6 h and assayed for luciferase activity. (B)
Inhibition of LPS-induced IjBa degradation by IjBaSR. Equivalent
amounts of cell extracts from RAW cells transfected with pCMV-Luc
(0.2 lgÆmL
)1
) and increasing amounts of IjBaSR expression con-

structs were analyzed by Western blotting. IjBa and IjBaSR were
detected with the antibody against IjBa. (C) Ectopic expression of
IjBaSR in the presence or absence of LPS. RAW 264.7 cells were
transfected with 0.2 lgofIjBaSR expression vector. After 24 h, cells
were stimulated with 100 ngÆmL
)1
of LPS for 6 h. Cell lysates were
analyzed by Western blotting with polyclonal antibodies specific for
IjBa and a-actin.
Ó FEBS 2004 CMV IE enhancer/promoter regulation by LPS and CpG-ODNs (Eur. J. Biochem. 271) 1099
[pCMV()300)-Luc,pCMV()185)-Luc and pCMV()130)-
Luc)] reduced enhancement of the promoter activity by
NF-jB p65 (Fig. 6A). In conclusion, NF-jB and its recog-
nition sites are clearly involved in the CMV IE enhancer/
promoter activation.
When the AP-1 site-deleted CMV IE enhancer/promoter
[pCMV()130)-Luc] was cotransfected with a c-Jun expres-
sion vector, the luciferase activities decreased in comparison
with the cells cotransfected with pCMV-Luc (Fig. 6B). In
contrast, the deletion of the upstream sequences of )185 bp
[pCMV()507)-Luc,pCMV()300)-Luc and pCMV()185)-
Luc] had no significant effect in c-Jun-induced promoter
activation. Cotransfection of both NF-jB p65 and c-Jun
enhanced the activation of the promoters compared with
theactivationobservedupontransfectionofNF-jBp65
or c-Jun alone, in an additive manner (Fig. 6C). The
observations indicate that each of the transcription factors
could activate the CMV IE enhancer/promoter in the
mouse macrophage cell line RAW 264.7.
We next investigated functional significance of the tran-

scription factors after stimulation with LPS. Ectopic expres-
sion of NF-jB p65 or c-Jun significantly increased CMV IE
enhancer/promoter activity in RAW 264.7 cells treated with
LPS (Fig. 6D,E). To define the LPS-responsive elements of
the CMV IE enhancer/promoter, the 5¢-deletion series of
constructs were transiently cotransfected with expression
plasmids encoding NF-jB p65 or c-Jun into RAW 264.7
cells, which were then treated with 100 ngÆmL
)1
LPS. The
expression of NF-jB p65 or c-Jun dramatically increased the
LPS-induced transactivation in the two promoter-reporter
constructs pCMV-Luc and pCMV()507)-Luc (Fig. 6D,E).
However, this phenomenon was greatly reduced when the
promoter sequence upstream of )300 bp was deleted
[pCMV()300)-Luc]. Progressive deletion of the region
including NF-jB and AP-1 binding sites [pCMV()300)-
Luc,pCMV()185)-Luc and pCMV()130)-Luc] reduced the
promoter activity stimulated by LPS in the presence of
ectopically expressed NF-jB p65 or c-Jun (Fig. 6D,E). This
result indicates that the region, between )507 and )130 bp of
the CMV IE enhancer/promoter including NF-jBandAP-1
binding sites, is required for NF-jB p65 or c-Jun to enhance
the LPS-induced transcriptional activation.
Effects of site-specific mutations in the NF-jB or AP-1
binding sites on the CMV IE enhancer/promoter activity
To further clarify the individual roles of NF-jBandAP-1
sites on activation of the CMV IE enhancer/promoter, we
Fig. 5. Effects of the 5¢-promoter sequence deletion mutations on the activity of the CMV IE enhancer/promoter. (A) Relative activities of the
CMV IE enhancer/promoter constructs. RAW cells were transfected with each reporter construct and cultured for 24 h before assaying for

luciferase activity. The results are presented as relative activation compared with the pCMV-Luc construct. (B) LPS induction of the promoter
constructs. RAW cells were transfected with each reporter construct and cultured in the presence or absence of LPS (100 ngÆmL
)1
)for6 h.Thefold
activation represents the ratio of luciferase activity in LPS stimulated cells versus unstimulated cells. Essential regions for basal promoter activity
(A) and LPS-responsiveness (B) were indicated.
1100 Y. Lee et al.(Eur. J. Biochem. 271) Ó FEBS 2004
performed mutational analysis of these sites in the context
of the full-length promoter (Fig. 7). The full-length promo-
ter pCMV-Luc had strong luciferase activity and mutation
of the NF-jB1 site had minimal effect on the promoter
activity. Mutation in the NF-jB2, NF-jB3 and NF-jB4
sites reduced the promoter activity by 62, 72 and 51%,
respectively (Fig. 7B). Mutation in the AP-1 binding site
also reduced promoter activity by 27% (Fig. 7B). There-
fore, the three NF-jB sites and one AP-1 site appear to be
critical for basal activation of the promoter.
To determine which transcription factor binding sites are
required for maximal induction of the CMV IE enhancer/
promoter by LPS, mutant constructs were transiently
transfected into RAW 264.7 cells, which were treated with
100 ngÆmL
)1
LPS. Mutation in the NF-jB1 site had
minimal effect on the LPS-induced promoter activity. The
NF-jB1 site is located in the region between )507 and
)300 bp of the CMV IE enhancer/promoter which, based
on promoter deletion analysis, is required for the LPS-
induced transcriptional activation (Figs 5B and 6D,E).
Therefore, it is likely that factor(s) other than NF-jBand

AP-1 may be also involved in LPS-induced promoter
activation. Significant reduction of the promoter activity
was observed by mutation of NF-jB2, NF-jB3, NF-jB4
and AP-1 sites in LPS-stimulated cells (Fig. 7C). We
conclude that LPS activation of CMV IE enhancer/promo-
ter is mediated by a concerted action of transcription factor
binding sites and each of the NF-jB and AP-1 sites is
important for maximal activation.
We investigated involvement of NF-jBp65andc-Junin
transcriptional activation of the CMV IE enhancer/promo-
ter using the site-specific mutant constructs (Fig. 7A) and
ectopic expression of NF-jB p65 or c-Jun (Fig. 7D,E).
Mutations in the NF-kB binding sites from the CMV IE
enhancer/promoter (pCMVmNF-jB2-Luc, pCMVmNF-
jB3-Luc and pCMVmNF-jB4-Luc) reduced promoter
activation after ectopic expression of NF-jBp65(Fig.7D).
Among the four NF-jB binding sites, NF-jB3 appears
to have the most significant effect on the transcriptional
activation. When AP-1 site was mutated, promoter activity
after ectopic expression of c-Jun was decreased compared to
wild type promoter. Taken together, these results confirm
that the NF-jB and AP-1 sites both contribute to CMV IE
enhancer/promoter activity.
Activation of the CMV IE enhancer/promoter
by CpG-ODN
To evaluate the effects of CpG-ODNs on CMV IE
enhancer/promoter activation, we used a CMV IE enhan-
cer/promoter-luciferase reporter (pCMV-Luc)andexam-
ined its regulation in RAW 264.7 cells after stimulation with
CpG-ODN 1826, which consists of 20 bases containing two

CpG motifs. The CpG-ODN 1826 activated the CMV IE
Fig. 6. Activation of the CMV IE enhancer/promoter constructs in
response to ectopic expression of NF-jB p65 and c-Jun. (A, B and C)
RAW cells were transfected with each reporter construct (0.2 lgeach)
and the indicated expression vectors (50 ng each) encoding NF-jBp65
(A), c-Jun (B) or both (C) and cells were cultured for 24 h before
assaying for luciferase activity. (D and E) RAW 264.7 cells were
cotransfected with each reporter construct and 50 ng of the indicated
expression vectors. Six hours before harvest, cultures were treated with
LPS. The results are presented as fold activation compared with the
control expression vector.
Ó FEBS 2004 CMV IE enhancer/promoter regulation by LPS and CpG-ODNs (Eur. J. Biochem. 271) 1101
enhancer/promoter in a time- and dose-dependent manner
(Fig. 8A,B). Activation of the promoter reached its maxi-
mum level when stimulated with 3 l
M
of the CpG-ODN for
6 h (Fig. 8A,B). Because CpG-ODN 1826 has two CpG
motifs, we decided to identify the contribution of the
individual CpG dinucleotide sequence to the promoter
activation. We synthesized the phosphorothioate backbone
oligonucleotides of CpG-ODN 1826(S-1), 1826(S-2) and
1826(S-3), which differ only in the reversal of the CpG
dinucleotides to the GpC dinucleotides compared to the
CpG-ODN 1826(S) sequence. As shown in Fig. 8C, luci-
ferase activity decreased by  15% when the cells were
treated with CpG-ODN 1826(S-2) compared to the activity
in CpG-ODN 1826(S)-treated cells. Compared with CpG-
ODN 1826(S), a much lower level of luciferase activity (up
to 40% reduction) was induced by CpG-ODN 1826(S-1).

With the reversal of the two CpG dinucleotides to GpC
dinucleotides, CpG-ODN 1826(S-3) lost its capacity for
CMV promoter activation. Basal luciferase activity was
detected in the control cells stimulated with non-CpG-
ODN 2041. These results clearly indicate that the CpG-
ODN 1826 sequence induced CMV IE enhancer/promoter
activation in a CpG sequence-dependent manner.
Regulation of CMV IE enhancer/promoter activity
by CpG-ODN and LPS via MyD88-dependent modulation
of NF-jB activation
The signaling by CpG-DNA and LPS through their
respective TLRs requires the participation of the adaptor
protein MyD88 and results in activation of the common
transcription factors NF-jB and AP-1 [32,34]. To determine
if MyD88 is involved in the CMV IE enhancer/promoter
activation, we cotransfected an expression plasmid encoding
a mutant MyD88 (DMyD88) into RAW 264.7 cells, along
with the promoter. Acting as a dominant negative molecule
in TLR/IL-1R-dependent signaling, the mutant inhibited
LPS-mediated and CpG-ODN1826-mediated CMV IE
enhancer/promoter activation (Fig. 9A,B). We then exam-
ined whether the promoter activation is modulated by CpG-
ODN signaling-dependent IjBa degradation. When RAW
264.7 cells were transfected with a mutant IjBa protein
(IjBaSR), activation of the promoter by CpG-ODN 1826
stimulation was inhibited, further confirming that the
degradation of IjBa is necessary for CMV IE enhancer/
promoter activation that is induced by CpG-ODN 1826
(Fig. 9B).
Fig. 7. Effects of site-specific mutations in transcription factor recognition site on the activity of the CMV IE enhancer/promoter. (A) Positions and

sequences of the NF-jB and AP-1 sites are indicated. Mutated sites are indicated with lower case letters. (B) Relative activities of the mutated
CMV IE enhancer/promoter construct. RAW cells were transfected with each mutated reporter construct and cultured for 24 h before assaying for
luciferase activity. The results are presented as relative activation compared with the pCMV-Luc construct. (C) LPS induction of the promoter
constructs. RAW cells were transfected with each mutated reporter construct and cultured in the presence or absence of LPS (100 ngÆmL
)1
)for6 h,
(D and E) RAW cells were transfected with each mutated reporter construct (0.2 lg each) and the indicated expression vectors (0.2 lgeach)
encoding NF-jB p65 (D), c-Jun (E) and cultured for 24 h before luciferase activity assay. The results are presented as relative activation compared
with the pCMV-Luc construct.
1102 Y. Lee et al.(Eur. J. Biochem. 271) Ó FEBS 2004
Discussion
Although many investigators use vectors such as pRC/CMV
and pcDNA to introduce target genes under the control of a
CMV promoter, only a few studies have revealed regulation
of the promoter in detail. Reportedly, interferon-a inhibits
murine CMV immediate-early gene expression by downreg-
ulating NF-jB activity [44]. In contrast, TNF-a and LPS
have been shown to stimulate CMV IE enhancer/promoter
activity by upregulating NF-jB activity [17,18]. In this study,
we demonstrate that LPS and CpG-ODNs activate the
CMV IE enhancer/promoter and that both NF-jBand
c-Jun contribute to this phenomenon in the mouse macro-
phage cell line RAW 264.7.
LPS stimulation drastically induced activation of
the CMV IE enhancer/promoter (Fig. 1). In other studies,
the NF-jB and c-Jun binding sites were identified in the
CMV IE enhancer/promoter [7,10,12]. Our study extends
this observation by identifying the dominant role of
ectopically expressed NF-jB p65. The expression of
NF-jB p65 in RAW 264.7 cells led to an increase of the

CMV IE enhancer/promoter basal activity in a dose-
dependent fashion (Fig. 2A), while NF-jB p65 enhanced
the capacity of LPS to dramatically induce the promoter
activation (Fig. 2D). Using reporter gene assays, we directly
demonstrated the major role of NF-jB; preventing nuclear
localization of NF-jB by ectopic expression of its specific
inhibitor IjBaSR blocked activation of the CMV IE
enhancer/promoter in an IjBaSR dose-dependent manner
(Figs 3 and 4A). These results suggest that NF-jB activa-
tion is required for CMV IE enhancer/promoter activation
in the LPS-signaling pathways. Additionally, we confirmed
the involvement of NF-jB by using the deletions and site-
specific mutations of the promoter region to interfere with
NF-jB-mediated activation at the level of DNA binding
(Figs 5–7), which suggests that NF-jB and its binding sites
are essential for NF-jB-dependent CMV IE enhancer/
promoter activation.
The potential function of c-Jun in regulating the CMV IE
enhancer/promoter is not fully characterized. Accordingly,
Fig. 8. CpG-ODN 1826 stimulates activation of the CMV IE enhancer/
promoter in RAW 264.7 cells. RAW 264.7 cells were transiently trans-
fected with CMV IE enhancer/promoter-luciferase construct (pCMV-
Luc) for 24 h. The cells were then stimulated with increasing amounts of
CpG-ODN 1826 for 6 h (A) or CpG-ODN 1826 (3 l
M
) for different
time periods (B). RAW 264.7 cells were transfected with pCMV-Luc
and treated with 3 l
M
of the indicated CpG-ODNs for 6 h and

luciferase assays were performed (C).
Fig. 9. LPS-induced and CpG-ODN 1826-induced CMV IE enhancer/
promoter activity in RAW 264.7 cells is inhibited by IjBaSR and the
dominant negative mutant of MyD88. RAW 264.7 cells were transiently
cotransfected with the CMV IE enhancer/promoter-luciferase con-
struct (pCMV-Luc) and LxSN control vector, IjBaSR or the dom-
inant negative mutant of MyD88 for 24 h. The cells were treated with
100 ngÆmL
)1
LPS (A) or 3 l
M
of CpG-ODN 1826 (B) for 6 h before
assaying for luciferase activity. The results are represented as fold
activation compared with the control vector alone.
Ó FEBS 2004 CMV IE enhancer/promoter regulation by LPS and CpG-ODNs (Eur. J. Biochem. 271) 1103
through the ectopic expression of c-Jun in RAW 264.7 cells,
which led to an increase in the promoter activity (Figs 2 and
6), we provided evidence that c-Jun contributes to activation
of the CMV IE enhancer/promoter in the LPS-signaling
pathways. Furthermore, by using deletion as well as site-
specific mutation analysis (Figs 5 and 7), we demonstrated
the role of the AP-1 element in the promoter. Our studies
identify the functional involvement of c-Jun in CMV IE
enhancer/promoter activation by LPS.
Because CpG-ODNs stimulate strong innate immune
responses, they have gained attention [23,24]. Optimal
immune responses are activated by the CpG motif in which
a central unmethylated CpG dinucleotide is flanked by two 5¢
purines and two 3¢ pyrimidines. Synthetic oligodeoxynucle-
otides that contain CpG motifs (CpG-ODNs) mimic the

direct immunostimulatory effects of native bacterial DNA;
they also activate multiple cell types including macrophages,
dendritic cells, NK cells and B lymphocytes [23–25,39,45–
47]. We now report the effects of the CpG-ODN 1826
sequence and the mechanisms of action regarding CMV IE
enhancer/promoter activation in a mouse macrophage cell
line. The CpG-ODN 1826 sequence that contains two CpG
motifs strongly stimulates the CMV IE enhancer/promoter
in a manner that depends on the CpG sequence (Fig. 8). The
CpG-ODN 1826 that contained two CpG motifs induced
maximal CMV IE enhancer/promoter activity (Fig. 8C)
compared to the CpG-ODNs in which the CpG dinucleo-
tides were replaced by GpC dinucleotides [CpG-
ODN 1826(S-1) and CpG-ODN 1826(S-2)]. This response
implies that the CpG motifs of CpG-ODNs may play a
critical role in CMV IE enhancer/promoter activation.
According to several reports, CpG-ODNs signal through
TLR9, a receptor that has a high degree of structural
homology with the LPS receptor, TLR4 [26–28]. The
signaling that CpG-ODNs and LPS induce through their
respective TLRs results in the recruitment of the common
adaptor protein MyD88 [32,34]. Activation of both signa-
ling pathways stimulates the transcription factors NF-jB
and AP-1, which in turn enhance the transcriptional
upregulation of genes downstream of the jB motif [39,40].
We have demonstrated that CMV IE enhancer/promoter
activation induced by LPS and CpG-ODNs is mediated by
the TLR/IL-1R signaling molecule MyD88 through mech-
anisms similar to those in the mouse macrophage cell line
RAW 264.7 (Fig. 9).

In conclusion, we found that LPS and CpG-ODNs
activated the CMV IE enhancer/promoter through activa-
tion of NF-jB, AP-1 and MyD88, possibly in a common
pathway. These results shed light on the mechanisms
involved in CMV reactivation. Robust activation of the
CMV IE enhancer/promoter by LPS or CpG-ODNs
implies that bacterial infection contributes to CMV reacti-
vation. Our results also suggest the potential application of
CpG-ODNs in gene therapy as a stimulator for the optimal
expression of target genes under the control of a CMV IE
enhancer/promoter.
Acknowledgements
This work was supported by the MOST grant CBM1-A900-001-0-0-0 of
Korea. Y. Lee was supported by a grant (SC12031) from the Stem Cell
Research Center of the 21st Century Frontier Research Program and a
KRIBB Innovation grant (KGS2110311). We thank Dr Harikrishna
Nakshatri and Dr Jurg Tschopp for the generous gift of the expression
plasmids encoding NF-jB p65, c-Jun, IjBaSR and DMyD88.
References
1. Mocarski, E.S. (1996) Cytomegaloviruses and their replication. In
Fields Virology (Fields, B.N., Knipe, D.M., Howley, P.M.,
Chanock, R.M., Melnick, J.L., Monath, T.P., Roizman, B. &
Straus, S.E., eds), 3rd edition, pp. 2447–2492. Lippincott-Raven
Publishers, Philadelphia.
2. Soderberg-Naucler, C., Fish, K.N. & Nelson, J.A. (1997)
Reactivation of latent human cytomegalovirus by allogeneic sti-
mulation of blood cells from healthy donors. Cell 91, 119–126.
3. Hahn, G., Jores, R. & Mocarski, E. (1998) Cytomegalovirus
remains latent in a common precursor of dendritic and myeloid
cells. Proc. Natl Acad. Sci. USA 95, 3937–3942.

4. Hummel, M. & Abecassis, M.M. (2002) A model for reactivation
of CMV from latency. J. Clin. Virol. 25, S123–S136.
5. Meier, J.L. & Pruessner, J.A. (2000) The human cytomegalovirus
major immediate-early distal enhancer region is required for effi-
cient viral replication and immediate-early gene expression.
J. Virol. 74, 1602–1613.
6. Meier, J.L., Keller, M.J. & McCoy, J.J. (2002) Requirement of
multiple cis-acting elements in the human cytomegalovirus major
immediate-early distal enhancer for viral gene expression and
replication. J. Virol. 76, 313–326.
7. Thomsen, D.R., Stenberg, R.M., Goins, W.F. & Stinski, M.F.
(1984) Promoter-regulatory region of the major immediate early
gene of human cytomegalovirus. Proc. Natl Acad. Sci. USA 81,
659–663.
8. Jeang, K.T., Rawlins, D.R., Rosenfeld, P.J., Shero, J.H., Kelly,
T.J. & Hayward, G.S. (1987) Multiple tandemly repeated binding
sites for cellular nuclear factor 1 that surround the major
immediate-early promoters of simian and human cytomegalo-
virus. J. Virol. 61, 1559–1570.
9. Nelson, J.A., Reynolds-Kohler, C. & Smith, B.A. (1987) Negative
and positive regulation by a short segment in the 5¢-flanking region
of the human cytomegalovirus major immediate-early gene. Mol.
Cell. Biol. 7, 4125–4129.
10. Sambucetti, L.C., Cherrington, J.M., Wilkinson, G.W. &
Mocarski,E.S.(1989)NF-jB activation of the cytomegalovirus
enhancer is mediated by a viral transactivator and by T cell
stimulation. EMBO J. 8, 4251–4258.
11. Stamminger, T., Fickenscher, H. & Fleckenstein, B. (1990) Cell
type-specific induction of the major immediate early enhancer
of human cytomegalovirus by cyclic AMP. J. Gen. Virol. 71,

105–113.
12. Meier, J.L. & Stinski, M.F. (1996) Regulation of cytomegalovirus
immediate early genes. Intervirology 39, 331–342.
13. Sun, B., Harrowe, G., Reinhard, C., Yoshihara, C., Chu, K. &
Zhou, S. (2001) Modulation of human cytomegalovirus
immediate-early gene enhancer by mitogen-activated protein
kinase kinase kinase-1. J. Cell. Biochem. 83, 563–573.
14. Chan, Y J., Chiou, C J., Huang, Q. & Hayward, G.S. (1996)
Synergistic interactions between overlapping binding sites for the
serum response factor and ELK-1 proteins mediate both basal
enhancement and phorbol ester responsiveness of primate cyto-
megalovirus major immediate-early promoters in monocyte and
T-lymphocyte cell types. J. Virol. 70, 8590–8605.
15. Angulo, A., Suto, C., Heymen, R.A. & Ghazal, P. (1996) Char-
acterization of the sequences of the human cytomegalovirus
enhancer that mediate differential regulation by natural and syn-
thetic retinoids. Mol. Endocrinol. 10, 781–793.
16. Prosch, S., Heine, A K., Volk, H D. & Kruger, D.H. (2001)
CCAAT/enhancer-binding proteins a and b negatively influence
1104 Y. Lee et al.(Eur. J. Biochem. 271) Ó FEBS 2004
the capacity of tumor necrosis factor a to up-regulate the
human cytomegalovirus IE1/2 enhancer/promoter by nuclear
factor jB during monocyte differentiation. J. Biol. Chem. 276,
40712–40720.
17. Laegreid, A., Thommesen, L., Jahr, T.G., Sundan, A. & Espevik,
T. (1995) Tumor necrosis factor induces lipopolysaccharide
tolerance in a human adenocarcinoma cell line mainly through the
TNF p55 receptor. J. Biol. Chem. 270, 25418–25425.
18. Prosch, S., Staak, K., Stein, J., Liebenthal, C., Stamminger, T.,
Volk, H D. & Kruger, D.H. (1995) Stimulation of the human

cytomegalovirus IE enhancer/promoter in HL-60 cells by TNFa is
mediated via induction of NF-jB. Virology 208, 197–206.
19. Janeway, C.A. Jr & Medzhitov, R. (1998) Introduction: the role of
innate immunity in the adaptive immune response. Semin.
Immunol. 10, 349–350.
20. Aderem, A. & Ulevitch, R.J. (2000) Toll-like receptors in the
induction of the innate immune response. Nature 406, 782–787.
21. Poltorak, A., He, X., Smirnova, I., Liu, M.Y., Du Huffel, C.V.X.,
Birdwell,D.,Alejos,E.,Silva,M.,Galanos,C.,Freudenberg,M.,
Ricciardi-Castagnoli, P., Layton, B. & Beutler, B. (1998) Defective
LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in
Tlr4 gene. Science 282, 2085–2088.
22. Hoshino, K., Takeuchi, O., Kawai, T., Sanjo, H., Ogawa, T.,
Takeda, Y., Takeda, K. & Akira, S. (1999) Cutting edge: Toll-like
receptor 4 (TLR4)-deficient mice are hyporesponsive to lipo-
polysaccharide: evidence for TLR4 as the LPS gene product.
J. Immunol. 162, 3749–3752.
23. Krieg, A.M., Yi, A K., Matson, A., Waldschmidt, T.J., Bishop,
G.A., Teasdale, R., Koretzky, G.A. & Klinman, D.M. (1995)
CpG motifs in bacterial DNA trigger direct B-cell activation.
Nature 374, 546–549.
24. Pisetsky, D.S. (1996) The immunologic properties of DNA.
J. Immunol. 156, 421–423.
25. Stacey, K.J., Sweet. M.J. & Hume, D.A. (1996) Macrophages
ingest and are activated by bacterial DNA. J. Immunol. 157, 2116–
2122.
26.Hemmi,H.,Takeuchi,O.,Kawai,T.,Sato,S.,Sanjo,H.,
Matsumoto, K., Hoshino, K., Wagner, H., Takeda, K. &
Akira, S. (2000) A Toll-like receptor recognizes bacterial DNA.
Nature 408, 740–745.

27. Bauer, S., Kirschning, C.J., Hacker, H., Redecke, V., Hausmann,
S., Akira, S., Wagner, H. & Lipford, G.B. (2001) Human TLR9
confers responsiveness to bacterial DNA via species-specific CpG
motif recognition. Proc. Natl Acad. Sci. USA 98, 9237–9242.
28. Takeshita, F., Leifer, C.A., Gursel, I., Ishii, K.J., Takeshita, S.,
Gursel, M. & Klinman, D.M. (2001) Cutting edge: Role of Toll-
like receptor 9 in CpG DNA-induced activation of human cells.
J. Immunol. 167, 3555–3558.
29. Yi, A K. & Krieg, A.M. (1998) CpG DNA rescue from anti-IgM-
induced WHEI-231 B lymphoma apoptosis via modulation of
IjBa and IjBb and sustained activation of nuclear factor-jB/
c-Rel. J. Immunol. 160, 1240–1245.
30. Anderson, K.V. (2000) Toll signaling pathways in the innate
immune response. Curr. Opin. Immunol. 12, 13–19.
31. Hawiger, J., Veach, R.A., Liu, X Y., Timmons, S. & Ballard,
D.W. (1999) Ieˆ B kinase complex is an intracellular target for
endotoxic lipopolysaccharide in human monocytic cells. Blood 94,
1711–1716.
32. Zhang, F.X., Kirschning, C.J., Mancinelli, R., Xu, X P., Jin, Y.,
Faure, E., Mantovani, A., Rothe, M., Muzio, M. & Arditi, M.
(1999) Bacterial lipopolysaccharide activates nuclear factor-jB
through interleukin-1 signaling mediators in cultured human
dermal endothelial cells and mononuclear phagocytes. J. Biol.
Chem. 274, 7611–7614.
33. Hull, C., McLean, G., Wong, F., Duriez, P.J. & Karsan, A. (2002)
Lipopolysaccharide signals an endothelial apoptosis pathway
through TNF receptor-associated factor 6-mediated activation of
c-Jun NH
2
-terminal kinase. J. Immunol. 169, 2611–2618.

34. Hacker, H., Vabulas, R.M., Takeuchi, O., Hoshino, K., Akira, S.
& Wagner, H. (2000) Immune cell activation by bacterial CpG-
DNA through myeloid differentiation marker 88 and tumor
necrosis factor receptor-associated factor (TRAF)6. J. Exp. Med.
192, 595–600.
35. Chu, W., Gong, X., Li, Z., Takabayashi, K., Ouyang, H., Chen,
Y.,Lois,A.,Chen,D.J.,Li,G.C.,Karin,M.&Raz,E.(2000)
DNA-PKcs is required for activation of innate immunity by
immunostimulatory DNA. Cell 103, 909–918.
36. DeFranco, A.L., Crowley, M.T., Finn, A., Hambleton, J. &
Weinstein, S.L. (1998) The role of tyrosine kinases and MAP
kinases in LPS-induced signaling. Prog. Clin. Biol. Res. 397,119–
136.
37. Yi, A.K. & Krieg, A.M. (1998) Rapid induction of mitogen-acti-
vated protein kinases by immune stimulatory CpG DNA.
J. Immunol. 161, 4493–4497.
38. Hambleton, J., Weinstein, S.L., Lem, L. & DeFranco, A.L. (1996)
Activation of c-Jun N-terminal kinase in bacterial lipopoly-
saccharide-stimulated macrophages. Proc. Natl Acad. Sci. USA
93, 2774–2778.
39. Krieg, A.M. (2002) CpG motifs in bacterial DNA and their
immune effects. Annu. Rev. Immunol. 20, 709–760.
40. Guha, M. & Mackman, N. (2001) LPS induction of gene
expression in human monocytes. Cell. Signal. 13, 85–94.
41. Ueda, A., Takeshita, F., Yamashiro, S. & Yoshimura, T. (1998)
Positive regulation of the human macrophage stimulating protein
gene transcription. J. Biol. Chem. 273, 19339–19347.
42. Liu, J. & Kagan, J. (1999) Use of a promoterless Renilla luciferase
vector as an internal control plasmid for transient co-transfection
assays of ras-mediated transcription activation. Biotechniques 26,

24–28.
43. Lee, Y., Gotoh, A., Kwon, H J., You, M., Kohli, L., Mantel, C.,
Cooper, S., Hangoc, G., Miyazawa, M., Ohyashiki, K. & Brox-
meyer, H.E. (2002) Enhancement of intracellular signaling asso-
ciated with hematopoietic progenitor cell survival in response
to SDF-1/CXCL12 in synergy with other cytokines. Blood 99,
4307–4317.
44. Gribaudo, G., Ravaglia, S., Gaboli, M., Gariglio, M., Cavallo, R.
& Landolfo, S. (1995) Interferon-alpha inhibits the murine cyto-
megalovirus immediate-early gene expression by down-regulating
NF-kappa B activity. Virology 211, 251–260.
45. Klinman, D.M., Yi, A K., Beaucage, S.L., Conover, J. & Krieg,
A.M. (1996) CpG motifs present in bacteria DNA rapidly induce
lymphocytes to secrete interleukin 6, interleukin 12, and interferon
gamma. Proc. Natl Acad. Sci. USA 93, 2879–2883.
46. Hartmann, G., Weiner, G.J. & Krieg, A.M. (1999) CpG DNA: a
potent signal for growth, activation, and maturation of human
dendritic cells. Proc. Natl Acad. Sci. USA 96, 9305–9310.
47. Stacey, K.J., Sester, D.P., Sweet, M.J. & Hume, D.A. (2000)
Macrophage activation by immunostimulatory DNA. Curr. Top.
Microbiol. Immunol. 247, 41–58.
Supplementary material
The following material is available from http://blackwell
publishing.com/products/journals/suppmat/EJB/EJB4011/
EJB4011sm.htm
Fig. S1. LPS and CpG-ODN 1826(S) do not stimulate SV40
promoter in RAW 264.7 cells.
Ó FEBS 2004 CMV IE enhancer/promoter regulation by LPS and CpG-ODNs (Eur. J. Biochem. 271) 1105