Báo cáo khoa học: The Thermoplasma acidophilum Lon protease has a Ser-Lys dyad active site pot

PRIORITY PAPER
The
Thermoplasma acidophilum
Lon protease has a Ser-Lys dyad
active site
Henrike Besche and Peter Zwickl
Department of Structural Biology, Max-Planck-Institute of Biochemistry, Martinsried, Germany
A g ene with significant s imilarity to bacterial Lon proteases
was identified during the s equencing o f the genome of the
thermoacidophilic archaeon Thermoplasma acidophilum.
Protein sequence comparison revealed t hat Thermoplasma
Lon protease ( TaLon) is more similar t o t he LonB proteases
restricted to Gram-positive bacteria than to the widely dis-
tributed bacterial L onA. However, th e active site residues of
the protease and ATPase domain a re highly conserved i n all
Lon proteases. U sing site-directed mutagenesis we s how here
that TaLon and EcLon, and probably all other L on pro-
teases, contain a Ser-Lys dyad activ e site. The Ta Lon active
site mutants were fully assembled and, similar to TaLon
wild-type, displayed an apparent molar mass
1
of 430 kDa
upon gelfiltration. This would be consistent with a hexameric
complex and indeed electron micrographs of TaLon
revealed ring-shaped p articles, although of unknown sym-
metry. Comparison of the ATPase activity o f Lon wild-type
from Therm oplasma or Escherichia coli with respective pro-
tease a ctive s ite mutants revealed differences in K
m
and
V values. T his suggests th at in the course of protein d egra-

dation by wild-type Lon the protease domain might influ-
ence the activity of the ATPase domain.
Keywords:AAA
+
protease; archaea; Lon(La) endopepti-
dase; Lon (La) protease; Ser-Lys dyad.
Endopeptidase La (EC 3.4.21.53) was the first ATP-
dependent proteo lytic enzyme to be identified [1,2]. Later
protease La was found to be the product of the
Escherichia coli lon gene
2
[3,4] and is now mainly called
Lon p eptidase or protease. T his c an be seen by the
respective entry and listed references in the MEROPS
peptidase database: peptidase family S16 (lon protease
family) ( />s16.htm) [5].
The L on protease domain is ubiquitously distr ibuted
and m ostly fused to different ATPase domains [6].
However, in the genomes of some Bacteria and A rchaea,
standalone Lon protease domains are present, but nothing
is known about their biological function. In contrast,
plenty of knowledge has accrued about bacterial and
mitochondrial Lon pr oteases [7–10], where t he Lon domain
is linked t o an N -terminal AAA
+
domain which, i n turn, is
extended N-terminally by a Lon N-terminal (LAN)
domain [6]. Certain bacteria contain a second Lon
protease, called LonB, which lacks the LAN domain [6]
and is assumed to be soluble [11]. Most Archaea contain a

LonB homologue, i.e. lacking the LAN domain, which
contains two transmembrane-spanning regions and w as
shown to b e membrane-bound [12,13].
It has been known for a l ong time that Lon proteases
have an active site serine residue [14], but despite extensive
mutagenesis the residual catalytic residues r emained e lusive
[15]. Ultimately, mutagenesis studies of a viral noncanon-
ical Lon protease l acking the ATPase domain revealed the
catalytic Ser-Lys dyad ( S-K dyad) for Lon p roteases [16].
We set out to mutate the conserved serine and lysine
residues in Thermoplasma acidophilum Lon protease
(TaLon) to generalize the S-K dyad for ATP-dependent
membrane-bound Lon proteases. In the course o f this
work an independent report confirmed the S-K dyad for
the E. coli Lon protease (EcLon), but without studying
mutual regulation of the ATPase a nd protease domain [ 17].
Based on mutagenesis studies it was p roposed that the
ATPase domain of EcLon regulates the protease in a
unidirectional manner, i.e. the mutational inactivated
protease domain did not influence t he ATPase activity
[18]. We investigated this aspect in more detail for TaLon
and Ec Lon b y detailed a nalysis o f p rotease active s ite
mutants.
Materials and methods
Sequence alignments
The a ctive-site regions of Lon protease protein sequences
were aligned with
CLUSTAL X
[19] on Macintosh PPC.
Correspondence to P. Zwickl, Max-Planck-Institute of Biochemistry,

Department of Structural Biology, Am Klopferspitz 18,
82152 Martinsried, Germany. Fax: +49 89 85782641,
Tel.: +49 89 85782647, E-mail:
Abbreviations: AAA
+
, ATPase associated with various cellular
activities; DDM, dodecyl-b-
D
-maltopyranoside; EcFtsH, Escherichia
coli FtsH; EcLon, Escherichia c o li Lon; LAN, LonN-terminal; Lonwt,
Lon wild-type; S-K, Ser-Lys; TaLon, Thermoplasma acidophilum Lon;
TaLonwt, Thermoplasma acidophilum Lon wild-type.
Enzyme: e ndopeptidase L a (EC 3.4.21.53).
(Received 19 August 2 0 04, revised 1 O cto ber 2004,
accepted 6 October 2004)
Eur. J. Biochem. 271, 4361–4365 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04421.x
Generation of active site mutants
Site-directed mutagenesis was performed using the Q uick-
ChangeÒ Kit (Stratagene, La Jolla, CA, USA)
3
.
pET22b(+)-TaLon-His
6
(S525A and K568A) and Lon
wild-type (pLonwt) (K722A) served a s PCR t emplates. The
respective primers are listed with the mutated codons
underlined: S525A, 5¢-CGAGGGAGTTGAAGGAGAC
GCGGCCAGCGTATCAATAGCC-3¢ (sense), 5¢-GGCT
ATTGATACGCTGGC
CGCGTCTCCTTCAACTCCCT

CG-3¢ (antisense); K568A, 5 ¢-CCGGTTGGCGGCGTAAC
CGCA
GCGGTTGAGGCAGCTATAGAAGC-3¢ (sense),
5¢-GCTTCTATAGCTGCCTCAAC
CGCTGCGGTTAC
GCCGCCAACCGG-3¢ (antisense); K7 22A, 5¢-GCCGA
TGGTGGTTTGAAAGAA
GCCCTCCTGGCAGCGCA
TCGCG -3¢ (sense), 5¢-CGCGATGCGCTGCCAGGAG
GGCTTCTTTCAAACCACCGATCGGC-3¢ (a ntisense).
DNA sequencing ( MWG, E bersberg, Germany)
4
of the
full-length gene che cked all generated plasmids.
Expression, purification and enzymic characterization
Wild-type a nd muta nt Ta Lon p roteases were produced, and
the hydrolysis of fluorigenic peptides, FITC-labelled casein
and ATP were assayed as described [13]. R. G lockshuber
(ETH Zu
¨
rich, Switzerland) kindly provided the plasmids
pLonwt and pLonS679A [20]. Cells of E. coli BL21(DE3)
(Novagen, M adison, WI, USA)
5
harbouring p Lon (-wt,
-S679A or -K722A) were grown at 37 °Cin6LLuria–
Bertani m edium containing 100 lgÆmL
)1
ampicillin. A t an
attenuance

6
of 0.6 (600 nm) isopropyl thio-b-
D
-galactoside
was a dded to a final concentration o f 1 m
M
.Afterfurther
incubation for 4 h the cells were harvested b y centrifugation
(4000 g,10min4°C),washedwith50m
M
Tris (pH 7.5)
and s tored until purification at )80 °C. Purification of the
EcLon variants was performed as described [20].
Results
Domain organization of Lon proteases
During the sequencing of the T. ac idophilum genome an
open reading frame (ORF 1081) was identified, which
showed significant sequence similarity to Lon proteases [21]
(Fig. 1 A,B). TaLon encompasses an N-terminal ATPase
associated with various cellular a ctivities ( AAA
+
domain)
and a C-terminal protease domain, but lacks the N-terminal
a-helical domain inherent in most bacterial and eukaryotic
Lon homologues (Fig. 1C). However, the AAA
+
domain
of TaLon contains an insert of approximately 9 0 a mino acid
residues between the Walker A and Walker B ATPase
signatures [22], which is not present in any bacterial or

eukaryotic Lon sequence. The 90-residue insert is found in
all archaeal L on homologues and is predicted t o contain
two consecutive transmembrane h elices, suggesting t hat
archaeal Lon proteases are membrane a ssociated [ 21].
Gram-positive bacteria, such as Bacilli and Clostridia,
contain a second Lon protease, called LonB which, like t he
archaeal Lon homologues, does not contain an N-terminal
a-helical domain ( Fig. 1C) . In contrast with archaeal Lon
proteases the b acterial LonB also lacks the 90-residue insert
harbouring the predicted t ransmembrane region and is
therefore probably a soluble protease, although this h as not
been addressed experimentally [11].
Notably, the archaeon Methanosarcina mazei has t wo lon
genes, an ar chaeal-type lon gene containing two transmem-
brane helices and a bacterial-type lon gene including an
N-terminal domain (Fig. 1). The M. maze i archaeal-type
lon gene was not included in a phylogenetic analysis [23]
although both genes are a lso p resent in the closely related
species Methanosarcina acetivorans and M. barkeri. Simi-
larly, the M. mazei genome contains both the comp lete
group I and group II chaperonin systems, i.e. the bacterial
GroEL/GroES and the archaeal thermosome/prefoldin
[24]. In general, approximately 31% of the ORFs in the
genomes of M. mazei and its close relatives share t he highest
similarity with bacterial genes, which is most probably a
result of horizontal gene transfer [23]. In addition to the
bacterial and archaeal lon genes the genome of M. mazei
contains a noncanonical lon gene (ORF Mm1931), enco-
ding for a Lon protease lacking the ATPase domain.
Noncanonical Lon proteases are also found in bacteria and

viruses (Fig. 1B,C). A separate study failed to detect the
ATP-binding region in the archaeal Lon proteases in
sequence c omparisons with bacterial homologues and
classified the Pyrococcus Lon homologues as ATP-inde-
pendent proteases [25]. This is easily explained by t he fact
Fig. 1. Sequence a lignment o f s elected r egions of distinct Lon proteases.
(A) Alignment of the Walker A an d W alker B motifs of the AAA
+
ATPase-domain. Identical residues are marked with #, conserved
residues with +. (B) A lignment of the S-K dyad of th e p rotease do-
main. Labelling as described in ( A). Essential residues o f TaLon pro-
tease activity are indicated below. (C) Schematic representation of the
domain organization of the prote ins aligned in (A) and ( B) . Bs, Bacillus
subtilis;Ec,Escherichia coli;IBDVP2,infectiousbursal disease virus
strain P2; M m, Methanosarcina mazei;Ta,Thermoplasma ac idophilum;
Tk, Th ermo coccus kodakarensis. The UniProt a ccession numbers of
the aligned proteins are: Bs-LonA, P37945; Bs-LonB, P42425;
Bs-YlbL, O34470; Ec-Lon, P08177; I BDVP2-VP4, Q82628; Mm-1913,
Q8PVP9; Mm-bLon, Q 8PSG1; Mm-Lon, Q8Q0K8; Ta-Lon,
Q9HJ89; Tk-Lon, Q8NKS6.
4362 H. Besche and P. Zwickl (Eur. J. Biochem. 271) Ó FEBS 2004
that archaeal Lon p roteases contain a 90 -re sidue insert
between the W alker A and Walker B motifs as mentioned
above, which impairs alignment of the bacterial with t he
archaeal ATPase domain. After removing the 90-residue
insert the bacterial and archaeal Walker A and W alker B
motifs can b e aligned ( Fig. 1A). Sequence alignment o f the
proteolytic core domain s hows that the active site S-K dyad
is conserved in archaeal L on, in bacterial LonA and LonB,
and in noncanonical Lon proteases ( Fig. 1B). In summary,

the Lon protease domain i s an e volutionarily ancient
domain, wh ich i s ubiquitously distributed and c an be fused
to various other domains [6].
Ta
Lon forms ring-shaped complexes
Overexpression in E. coli leads to m embrane insertion of
the TaLon protease. The isolated membranes were solu-
bilized with detergent, and r ecombinant TaLon was
purified by Ni
2+
-nitrilotriacetic a cid a ffinity chromatogra-
phy [13]. Subsequent size exclusion chromatography
revealed an apparent molar mass of 510 kDa. The
transmembrane domain of TaLon is surrounded by a
dodecyl-b-
D
-maltopyranoside (DDM) micelle with a mass
of  70 kDa. Subtraction of the DDM micelle suggests
that six TaLon mo no mers ( 72 kDa) ass emb le in to a
hexameric c omplex (Fig. 2A). C onsistently, electron micro-
scopic analysis revealed r ing-shaped particles of yet
unknown symmetry ( Fig. 2B). The isolated p roteolytic
domain of EcLon w as crystallised as a hexameric complex
[26]. In contrast, a structural analysis of the yeast
mitochondrial Lon protease by analytical ultracentrifuga-
tion and electron m icroscopy revealed heptameric ring-
shaped complexes [27]. The stoichiometry of the TaLon
complex remains to be determined.
S-K dyad active site
Lon from E. coli has been known for a l ong time to be a

serine protease [14,20], but only lately was an active site
lysine residue
7
identified [16,17]. These two catalytic residues
are conserved among all a rchaeal and bacterial Lon
homologues and form an S-K d yad. Very recently, the
crystal structure of the hexameric E. coli Lon protease
domain has been solved and revealed a unique fold not
observed in other S-K dyad peptidases [26]. Only the
catalytic core containing the active s ite residues is structur-
ally conserved between distinct S-K dyad peptidases [26].
To establish that the Therm oplasma me mbrane-bound Lon
protease has the same active site, t he two conserved residues
were individually muta ted to alanine (S52 5A and K568A).
As with TaLonwt, the S -K mutants were purified as
hexamers (data not shown) sustaining substantial ATPase
activity (Table 1), but no peptidase activity could be
detected (Fig. 3 A). Consequently, TaLonS525A and
TaLonK568A showed neither ATP-dependent nor ATP-
independent proteolytic activity (Fig. 3B).
ATPase activity of protease active site mutants
Kinetic analysis of TaLon and its protease active site
mutants r evealed t hat t he specific ATPase a ctivity o f
Fig. 2. Molar mass and electron microscopy of TaLon. (A) TaLo n
(30 mg) was s eparated on Supe rdex 200 HiLoad 26/60 column (25 m
M
Mes pH 6.2, 300 m
M
NaCl, 5 m
M

MgCl
2
,0.5m
M
DDM) and
detected by UV
280
. M olar mass of marker pro teins an d their respective
elution volume s are in dicated. G el filtration r evea led an a pparen t
molar mass o f 510 kDa corresponding to a hexameric complex a fter
subtraction of 70 kDa for the DDM micelle. (B) Electron micrograph
of negatively stained (2% uranylacetate) TaLo n from the Superdex
200 peak fraction, recorded with a Philips C M 200 FEG transmission
electron microscope at 16 0 kV.
Table 1. ATPase ac tivity of TaLon and EcLon.
Protease K
m
(m
M
) V (P
i
Æmin
)1
Ælg
)1
)
TaLonwt 0.196 ± 0.004 0.631 ± 0.003
TaLonS525A 0.176 ± 0.014 0.561 ± 0.012
TaLonK568A 0.111 ± 0.003 0.477 ± 0.003
EcLonwt 0.201 ± 0.004 0.554 ± 0.012

EcLonS679A 0.140 ± 0.014 0.273 ± 0.009
EcLonK722A 0.189 ± 0.011 0.782 ± 0.015
Ó FEBS 2004 T. acidophilum Lon is a Ser-Lys dyad protease (Eur. J. Biochem. 271) 4363
TaLonK568A was 25% lower and the affinity for ATP
was increased by 43% when compared with wild-type
TaLon (Table 1). The K
m
of TaLonS525A remained
unaffected and the specific ATPase activity was only
slightly reduced (10%; T able 1). Thus the mutation o f the
catalytic protease residues, especially of Lys568 seems to
enhance ATP binding and concomitantly slow down ATP
hydrolysis. In order to generalize this observation the
corresponding E. coli lysine mutant was generated (EcLon-
K722A) and purified along with the active site serine
mutant (EcLonS679A). B oth m utants were proteolytically
inactive (data not shown). I n accordance with our model
that the protease domain might have a r egulative influence
on the protease domain, both mutants were affected in
their ATPase activity i n comparison with the wild-type
enzyme. The EcLon Ser679 mutant showed only h alf the
wild-type ATPase activity but a 30% higher affinity for
ATP, while the lysine mutant w as stimulated with resp ect
to ATP hydrolysis (40%) and hardly affected in its affinity
for ATP (Table 1).
Discussion
The Lon protease is ubiquitously distributed and was found
to exist as a standalone protein as well as fused to a AAA
+
ATPase-domain (Fig. 1C ) [6]. Whereas the b acterial Lon

protease and its homologues i n eukaryal organelles are
soluble, the archaeal c ounterpart is membrane-attached
[13]. Bacterial LonB proteases, like archaeal Lon, lack the
LAN domain p resent in bacterial L onA pro teases, but like
bacterial LonA, also miss the membrane anchor foun d in
archaeal Lon proteases. Taken together the Lon protease
domain is h ighly versatile and can function in different
contexts, i.e. standalone or fused t o an ATPase, and s oluble
or membrane-bound.
Solubilized TaLon has a m olar mass of 430 kDa
corresponding to a hexameric complex. T he s ame o ligome-
rization state w as revealed r ecently in t he crys tal structure of
the hexameric EcLon protease domain [26], whereas
electron microscopy of yeast m itochondrial Lon proteaese
showed a heptameric complex [27].
Using site-directed mutagenesis we established t he S-K
dyad for the membrane-bound Ta Lon and confirmed it f or
the soluble EcLon. Subsequently, we characterized the
TaLon and EcLon protease-deficient mutants lacking the
catalytic serine o r lysine residue. K inetic analysis and
comparison of their r espective ATPase activity revealed a
potential regulation of ATPase hydrolysis depending on
the p roteolytic cycle. Though the unidirectional regulation
of the peptidase activity by the ATPase has been described
for the EcLon protease several years ago [18], the
reciprocal regulatio n of the ATPase b y the protease
remained unrecognized, altho ugh two reports described
impaired ATP hydrolysis of FtsH m utants lacking p rotease
activity. Karata et al . [28] reported that mutation of the
zinc-binding residue His421 in Escherichia coli FtsH

(EcFtsH) completely abolished protease activity an d
reduced the ATPase activity to 23% of wild-type FtsH.
In this case, it c an be claimed that the prevention of zinc
ion b inding might l ead to structural perturbations that
reduce the ATPase activity. However, i n two independent
studies mutations of the catalytic aspartate in the conserved
HEAGH motif of EcFtsH [29] and Bacillus subtilis FtsH
[30] were generated. The conserved aspartate residue
activates a w ater molecule for the nucleo philic attack but
does not affect zinc ion binding. Again these mutant Fts H
proteins were reported to lack proteolytic activity and
showed a 20% reduced ATPase activity. Taken together
with our observation that mutation of the Ta Lon and
EcLon protease active site residues dec reases the ATPase
activity, we propose that bidirectional crosstalk between
the ATPase a nd peptidase domains is necessary for
controlled protein degradation.
Fig. 3. Pr oteoly tic activity of TaLonwtandtheactivesitemutants
TaLonS525A and TaLonK568A. (A) TaLon (46 n
M
)andThermo-
plasma acidophilum p roline iminopeptidase (1.83 l
M
)wasincubated
with 100 l
M
succinyl-LLVY-7-amido-4-methylcoumarin in assay
buffer ( 50 m
M
Mes pH 6.2, 20 m

M
MgCl
2
,0.5m
M
DDM) at 60 °C.
TaLonwt and the ATPase d eficient mu tant Ta LonK63A (compare
[13]) served as control; the wild -type activity was set equal to o ne . (B)
TaLon (116 n
M
)wasincubatedwith5l
M
fluorescein isothiocyanate-
casein i n the assay buffer with or without 2 m
M
ATP a t 60 °C. For the
S-K dyad m utants n o diffe renc e w as obse rved in the presence or
absence o f ATP.
4364 H. Besche and P. Zwickl (Eur. J. Biochem. 271) Ó FEBS 2004
Acknowledgements
We tha nk Ulf Klein (MPI Martinsried) f or assistance, Oana Mihalache
(MPI Martinsried) for e lectron microscopy, Erik Roth (MPI Martins-
ried) for calibration of the Sup erdex 200 column and Rudi Glockshuber
(ETH Zu
¨
rich) for providing EcLon expression plasmids. We are
indebted to Wolfgang Baumeister (MPI Martinsried) for g enerous a nd
continuous support. Fin ally, we want to thank the referees for their
valuable suggestions. This work was supported by a grant from the
DFG t o Peter Z wickl (Z w58/3-2).

References
1. Swamy, K.H. & Goldberg, A.L. (1981) E. coli conta ins e i ght
soluble proteolytic activities, o ne being ATP dependent. Nature
292, 652–654.
2. Chung, C.H. & Goldberg, A.L. (2004) Endopeptidase La. In
Handbook of Proteolytic E nyzmes (Barret,A.J.,Rawlings,N.D.&
Woessner, J.F., eds), pp. 1998–2002. Elsevier Academic Press,
London, UK.
3. Chung, C.H. & Goldberg, A.L. (1981) The product of the lon
(capR)geneinEsch erichia co li is the A TP-dep endent pro tease,
protease La. Pro c. Natl Acad. Sci. USA 78, 493 1–4935.
4. Charette, M.F., Henderson, G.W. & Markovitz, A. (1981)
ATP hydrolysis-dependent protease activity of the lon (capR)
protein of Escherichia coli K-12. Proc. Natl Acad. Sci. USA 78,
4728–4732.
5. Barrett, A.J., R awlings, N.D. & O’Brien, E.A. ( 2001) The
MEROPS database as a protease information system. J. Struct.
Biol. 134, 95–102.
6. Iyer, L.M., Leipe, D.D., Koonin, E.V. & Aravind, L. (2004)
Evolutionary history a nd higher ord er classification of AAA
+
ATPases. J. Struct. Biol. 146, 1 1–31.
7. Goldberg, A.L. (1992) The mechanism and functions of ATP-
dependent proteases i n bacterial and animal cells. Eur. J. Biochem.
203, 9–23.
8. Gottesman, S. (1996) P roteases and t heir targets i n Esche richia
coli. Annu. Rev . Genet. 30 , 465–506.
9. Ka
¨
ser, M. & Langer, T. (2000) Protein degradation in

mitochondria. Se min. Cell Dev . Biol. 11 , 181–190.
10. Liu, T., L u, B., Lee, I ., Ondrovicova, G., Kutejova, E. & S uzuki,
C.K. (2004) DNA and RNA binding b y the m itochondrial lon
protease is regulated by nucleotide and protein substrate. J. Biol.
Chem. 279, 13902–13910.
11. Serrano,M.,Hovel,S.,Moran,C.P.,Henriques,A.O.&Vo
¨
lker,
U. (2001) F orespore-specific transcription o f t he lonB gene during
sporulation in Bacillus subtilis. J. Bacteriol. 183, 2995–3003.
12. Fukui, T., Eguchi, T ., Atomi, H. & Imanaka, T. (2002) A mem -
brane-bound archaeal Lon p rotease displays AT P-indepen dent
proteolytic activity towards unfo lded p roteins an d ATP-depen -
dent activity fo r folded p ro teins. J. Bacteriol. 184, 3689–3698.
13. Besche, H., Tam ura, N ., Tam ura, T . & Zwickl, P. (2004) Muta-
tional analysis of conserved AAA
+
residues in the archaeal Lon
protease from Thermoplasma acidophilum. FEBS Lett. 574,
161–166.
14. Amerik, A.Y., Antonov, V.K., Gorbalenya, A.E., Kotova, S.A.,
Rotanova, T.V. & Shimbarevich, E.V. (1991) Site- directed muta-
genesis of La protease. A catalytically active serine residue. FEBS
Lett. 287, 211–214.
15. Rotanova, T.V. (1999) Structural and functional peculiarities of
the ATP-dependent L on protease f rom Escherichia coli. Russ.
J. Bioorganic C hem. 25, 883–891.
16. Birghan, C., Mundt, E. & Gorbalenya, A.E. (2000) A non-cano -
nical L on proteinase lac king the ATPase domain employs the
Ser-Lys c atalytic dyad to exercise broad control ove r the l ife c ycle

of a d ouble -stranded RNA virus. EMBO J. 19, 114–123.
17. Rotanova, T.V., Mel’nikov, E.E. & Tsirulnikov, K.B. (20 03) A
catalytic Ser-Lys d yad in the active site of the ATP -dependent Lon
protease from Escherichia coli. Russ. J. Bioorganic Chem. 29,
85–87.
18. Fischer, H. & Glockshuber, R . (1994) A point mutation w ithin the
ATP-binding site inactivates both catal ytic functions of the ATP-
dependent protease La (Lon) f rom Escherichia coli. FEBS Lett.
356, 1 01–103.
19. Thompson, J.D., G ibson, T.J., Plewniak, F., J eanm ougin, F. &
Higgins, D.G. (1997) The C lustal-X windows interfa ce – flex ible
strategies for multiple sequence alignment aided by quality ana-
lysis tools. Nucleic Acids Re s. 25, 4 876–4882.
20. Fischer, H. & Glockshuber, R. (1993) ATP hydrolysis is not
stoichiometrically linked with proteolysis in the ATP-dependent
protease La from Escherichia coli. J. Biol. Chem. 268, 22502–
22507.
21. Ruepp, A., Graml, W., S antos-Martinez , M.L., K oretke, K.K.,
Volker, C ., Mewes, H.W., Frishman, D., Stocker, S., Lupas, A.N.
& Baumeister, W. (2000) The genome sequence of the thermo-
acidophilic scavenger Thermoplasma acidophilum. Nature 407,
508–513.
22.Walker,J.E.,Saraste,M.,Runswick,M.J.&Gay,N.J.(1982)
Distantly Related Sequences i n the a-andb-Subunits of ATP
synthase, myosin, kinases and other ATP-requiring enzymes and a
common nucleotide binding f old. EMBO J. 1, 945–951.
23. Deppenmeier, U ., Johann, A., Hartsch, T., Merkl, R., Schmitz,
R.A., Martinez-Arias, R., Henne, A., Wiezer, A., Baumer, S.,
Jacobi,C.,Bruggemann,H.,Lienard,T.,Christmann,A.,Bom-
eke, M., Steckel, S., B hattach aryya, A., Ly kidis, A., O verbee k, R.,

Klenk,H.P.,Gunsalus,R.P.,Fritz,H.J.&Gottschalk,G.(2002)
The genome of Methanosarcina mazei: e vidence for lateral g ene
transfer between bac teria an d archae a. J. Mol. Microbiol. B io-
technol. 4, 4 53–461.
24. Klunker,D.,Haas,B.,Hirtreiter,A.,Figueiredo,L.,Naylor,D.J.,
Pfeifer, G., Mu
¨
ller, V., D eppe nmeier, U ., G ottschalk, G ., H artl,
F.U. & Hayer-Hartl, M. (2003) Coexistence of Group I and
Group II chaperonins in th e archaeon Methanosarcina mazei.
J. Bi ol. Chem. 278, 33256–33267.
25. Ward, D.E., Shockley, K.R., Ch ang, L.S., Levy, R.D., Michel,
J.K., Conners, S. B. & Kelly, R.M. ( 2002) Proteolysis in
hyperthermophilic microorganisms. Ar chaea 1, 63–74.
26. Botos, I., Melnikov, E.E., Cherry, S., Tropea, J.E., Khalatova,
A.G.,Rasulova,F.,Dauter,Z.,Maurizi,M.R.,Rotanova,T.V.,
Wlodawer, A. & Gustchina, A. (2004) The catalytic domain of
Escherichia coli Lon protease h as a unique f old and a Ser-Lys dyad
in the a ctive site. J. Bio l. Chem. 279, 8 140–8148.
27. Stahlberg, H., K utejova, E. , S uda, K., Wolpensinger, B., Lustig,
A., Schatz, G., Engel, A. & Suzuki, C.K. (1999) Mitochondrial
Lon o f Saccharomyces cerevisiae is a ring-shaped protease with
seven fexible subunits. Proc. Natl A cad. Sci. USA 96, 6787–6790.
28. Karata, K ., Inagawa, T., Wilkinson, A.J. , Tatsuta, T. & Ogura , T.
(1999) Dissecting the role of a con served mo tif (the secon d region
of homology) in the AAA family of ATPases – Site-directed
mutagenesis of the ATP-depe ndent prot ease FtsH. J. Bi ol. Chem .
274, 2 6225–26232.
29. Jayasekera, M.M.K., Foltin, S.K., Olson, E.R. & Holler, T.P.
(2000) Escherichia coli requires the protease activity of FtsH for

growth. Arch. Biochem. Biophys. 380, 1 03–107.
30. Kotschwar,M.,Harfst,E.,Ohanjan,T.&Schumann,W.(2004)
Construction and analyses of mutant ftsH alleles of Bacillus
subtilis involving the ATPase- a nd Zn-binding domains. Curr.
Microbiol. 49, 1 80–185.
Ó FEBS 2004 T. acidophilum Lon is a Ser-Lys dyad protease (Eur. J. Biochem. 271) 4365