Báo cáo khoa học: Characterization of the secreted chorismate mutase from the pathogen Mycobacterium tuberculosis potx

Characterization of the secreted chorismate mutase from
the pathogen Mycobacterium tuberculosis
Severin Sasso, Chandra Ramakrishnan, Marianne Gamper, Donald Hilvert and Peter Kast
Laboratorium fu
¨
r Organische Chemie, Swiss Federal Institute of Technology, Zu
¨
rich (ETH), Switzerland
The intracellular shikimate pathway is essential in bac-
teria, fungi, algae and plants for the synthesis of aro-
matic compounds [1], but is absent from mammals and
thus represents a promising target for antimicrobial or
antifungal agents and herbicides. The branch point
intermediate of the shikimate pathway is chorismate,
and its partitioning towards the individual aromatic
products is controlled by the activities of several chor-
ismate-metabolizing enzymes. One of these is choris-
mate mutase (CM; EC 5.4.99.5), which catalyzes the
Claisen rearrangement of chorismate to prephenate,
the committed step [2] in the biosynthesis of tyrosine
and phenylalanine (Fig. 1A) [1].
Interestingly, two totally unrelated protein scaffolds
have evolved to carry out the CM reaction with similar
efficiencies ([3,4], Fig. 1B). Enzymes of the relatively
rare AroH class, including the monofunctional CMs
from Bacillus subtilis (BsCM) and Thermus thermophi-
lus have a trimeric pseudo a ⁄ b barrel structure [5–7].
In contrast, proteins of the a-helical AroQ class, repre-
sented by the structurally characterized CM domain
of the Escherichia coli chorismate mutase-prephenate
dehydratase (EcCM [8]), and the CM from the yeast

Saccharomyces cerevisiae [9,10], are considerably more
abundant. EcCM, the prototype for an AroQ class
member, is an intertwined dimer consisting of two
subunits of three a-helices each ([8], Fig. 1B). The
S. cerevisiae CM is a more elaborate variant of the
basic AroQ fold. It is also dimeric, but each subunit,
which is believed to have arisen from a duplicated
Keywords
chorismate mutase; Mycobacterium
tuberculosis; pathogenesis; shikimate
pathway; signal sequence
Correspondence
P. Kast, Laboratorium fu
¨
r Organische
Chemie, Swiss Federal Institute of
Technology, ETH Ho
¨
nggerberg – HCI F333,
CH-8093 Zu
¨
rich, Switzerland
Fax: +41 1633 1326
Tel: +41 1632 2908
E-mail:
(Received 12 October 2004, revised 4
November 2004, accepted 12 November
2004)
doi:10.1111/j.1742-4658.2004.04478.x
The gene encompassing ORF Rv1885c with weak sequence similarity to

AroQ chorismate mutases (CMs) was cloned from the genome of Mycobac-
terium tuberculosis and expressed in Escherichia coli. The gene product
(*MtCM) complements a CM-deficient E. coli strain, but only if produced
without the predicted N-terminal signal sequence typical of M. tuberculosis.
The mature *MtCM, which was purified by exploiting its resistance to irre-
versible thermal denaturation, possesses high CM activity in vitro. The
enzyme follows simple Michaelis–Menten kinetics, having a k
cat
of 50 s
)1
and a K
m
of 180 lm (at 30 °C and pH 7.5). *MtCM was shown to be a
dimer by analytical ultracentrifugation and size-exclusion chromatography.
Secondary-structure prediction and CD spectroscopy confirmed that
*MtCM is a member of the all-a-helical AroQ class of CMs, but it seems
to have a topologically rearranged AroQ fold. Because CMs are normally
intracellular metabolic enzymes required for the biosynthesis of phenyl-
alanine and tyrosine, the existence of an exported CM in Gram-positive
M. tuberculosis is puzzling. The observation that homologs of *MtCM with
a predicted export sequence are generally only present in parasitic or
pathogenic organisms suggests that secreted CMs may have evolved to par-
ticipate in some aspect of parasitism or pathogenesis yet to be unraveled.
Abbreviations
CM, chorismate mutase; *MtCM, secreted Mycobacterium tuberculosis CM; BsCM, Bacillus subtilis CM; EcCM, CM domain of the
bifunctional Escherichia coli chorismate mutase-prephenate dehydratase; IPTG, isopropyl thio-b-
D-galactoside.
FEBS Journal 272 (2005) 375–389 ª 2004 FEBS 375
primordial AroQ gene of the EcCM type, is made up
of 12 a-helices. Each polypeptide forms a catalytic

domain, which superimposes closely on the corres-
ponding EcCM structure, and an additional, divergent
regulatory domain for the binding of the allosteric
effectors tyrosine or tryptophan at the interface of the
dimer [9,10]. It is noteworthy that the active sites of
AroQ and AroH CMs are similarly functionalized,
indicating convergent evolution [3,11].
Among the AroQ CMs is a subgroup, dubbed
*AroQ by Jensen and coworkers [12], whose members
apparently are exported from the cytoplasm [4,12,13].
So far, *AroQ proteins have been isolated from Gram-
negative bacteria, such as Erwinia herbicola, Salmonella
typhimurium and Pseudomonas aeruginosa [12,13],
where they are targeted to another subcellular com-
partment, the periplasmic space, which surrounds the
cytoplasm but features a more oxidizing milieu [14].
As the classical metabolic routes to tyrosine and phe-
nylalanine are entirely cytoplasmic in bacteria, export
of a CM does not seem to make sense. Furthermore,
secreted functional *AroQ homologs have been discov-
ered in nematodes, which do not even possess a shiki-
mate pathway [15–17]. Although the role of exported
CMs is still obscure, it is striking that the presence of
an *AroQ protein in an organism correlates with its
pathogenicity [4,12,13,15–19].
With the availability of the genomic sequence,
Mycobacterium tuberculosis has become a model
organism for pathogenic bacteria [20,21], and great
efforts are currently being made to characterize its
proteome in detail [22–24]. In this work, we report the

cloning of an M. tuberculosis gene the product of
which is homologous to *AroQ CMs. Expression in
B
A
Fig. 1. Chorismate mutase. (A) Biosynthesis of aromatic compounds via the shikimate pathway. Chorismate mutase (CM) catalyzes the com-
mitted step of the branch towards phenylalanine and tyrosine. The information next to the arrows corresponding to enzymatic steps refers
to already assigned genes in the M. tuberculosis genome [20] ( see Discussion). (B) Ribbon diagrams of
EcCM [8] and BsCM [5,6], the prototypic enzymes of the AroQ and AroH class, respectively, complexed with transition state analog 1 (as
ball and stick model). The atomic coordinates for the crystal structures of EcCM and BsCM are available in the Research Collaboratory for
Structural Bioinformatics Protein Databank under PDB numbers 1ECM and 2CHT, respectively.
Secreted chorismate mutase from M. tuberculosis S. Sasso et al.
376 FEBS Journal 272 (2005) 375–389 ª 2004 FEBS
E. coli demonstrates that the protein is indeed a CM,
which is exported from the cytoplasm. As M. tuber-
culosis is Gram-positive and thus lacks a periplasmic
space, this CM is the first example of an *AroQ pro-
tein that may be secreted directly into the surrounding
medium and away from the bacterial cell. Further-
more, this study represents the most rigorous struc-
tural and functional characterization to date of a
member of a topological subclass of AroQ CMs, which
may be involved in the etiology of diseases such as
tuberculosis [25] which claim many millions of lives
every year.
Results
Cloning of an aroQ homolog from
the M. tuberculosis genome
Homology searches for aroQ genes in GenBank [26]
revealed that M. tuberculosis possesses a gene (ORF
Rv1885c in strain H37Rv, accession number CAB10064

in DDBJ⁄ EMBL⁄ GenBank [20]), encoding a putative
protein with high similarity to the exported *AroQ
CMs. Analysis of the primary sequence of the encoded
protein (termed *MtCM) using the neural network pro-
gram SignalP ( />[27,28]), predicted a cleavable 33-amino-acid export sig-
nal peptide at the N-terminus. We have cloned the gene
(subsequently referred to as *aroQ) from the chromoso-
mal DNA of M. tuberculosis and inserted it into several
different plasmid constructs for in vivo and in vitro
studies. Plasmids pKTU1-HCW and pKTU2-HNW
carry the entire *aroQ gene, including the sequence for
the presumed leader peptide, and in addition specify
either a C-terminal or an N-terminal His tag, respect-
ively. Plasmids pKTU3-HCT and pKTU3-HT encode a
leaderless version of *MtCM corresponding to the
mature form with and without a C-terminal His tag.
Genetic complementation
To probe whether the product of the ORF Rv1885c
has CM activity in vivo, the CM-deficient E. coli
KA12 ⁄ pKIMP-UAUC was provided with the *aroQ
plasmids described above. KA12 ⁄ pKIMP-UAUC
grows on M9c ⁄ S+F minimal medium agar plates only
if Tyr is added exogenously, or if the strain receives a
functional and expressed CM gene [11]. Table 1 shows
that transformants that produce *MtCM bearing a sig-
nal sequence do not grow in the absence of Tyr. This
suggests that post-translational export of (unfolded)
full-length *MtCM is very efficient [29] or that unproc-
essed protein present in the cytoplasm is not very act-
ive. In contrast, leaderless *MtCM complemented the

CM deficiency very well, provided that the sal promo-
ter was switched on by salicylate. Cells producing the
leaderless but untagged protein (encoded on pKTU3-
HT) grew as well as those transformed with pKTU3-
HCT (data not shown).
Localization of *MtCM in subcellular compart-
ments and determination of the signal sequence-
processing site
To obtain further experimental evidence for the func-
tionality of the predicted N-terminal signal sequence,
the distribution of CM activity in subcellular compart-
ments of E. coli was determined for transformants car-
rying pKTU1-HCW, pKTU2-HNW or pKTU3-HCT.
As judged from the recovered enzymatic activities, the
leaderless protein resided largely in the cytoplasm,
whereas the plasmids carrying the full-length *aroQ
gene directed *MtCM to the periplasmic space
(Table 2).
To experimentally determine the signal sequence
cleavage site of *MtCM in E. coli, the protein variant
produced with its native N-terminal signal sequence in
Table 1. In vivo complementation of CM deficiency. The selection strain for CM activity, E. coli KA12 ⁄ pKIMP-UAUC [11], was transformed
with the plasmids listed, which carry the genes for *MtCM variants or a B. subtilis CM (BsCM; positive control) or no CM (negative control).
Growth on minimal medium (M9c+F) in the absence or presence of Tyr (Y) or 0.1 m
M salicylate ( ⁄ S) was evaluated after 3 days at 30 °C.
Colony sizes were scored on an arbitrary, comparative scale ranging from good (+), moderate (+ ⁄ –), weak (–) to no (0) growth.
Plasmid
Encoded
protein
Signal

peptide
His tag
location
Growth on minimal medium agar plates
M9c+F M9c ⁄ S+F M9c+FY M9c ⁄ S+FY
pKTU1-HCW *MtCM Yes C 0 0 + +
pKTU2-HNW *MtCM Yes N 0 0 + –
a
pKTU3-HCT *MtCM No C 0 + + +
pMG212H-W BsCM No N +
b
+++
pMG212H-0 None No None 0 0 + +
a
High gene expression level appears to be toxic.
b
Uninduced basal sal promoter activity sufficient for complementation with BsCM.
S. Sasso et al. Secreted chorismate mutase from M. tuberculosis
FEBS Journal 272 (2005) 375–389 ª 2004 FEBS 377
E. coli KA13 ⁄ pKTU1-HCW was isolated. The pro-
tein preparation obtained under denaturing conditions
contained the processed and uncleaved forms of
*MtCM in a ratio of 10 : 1 as estimated by
SDS ⁄ PAGE (not shown). The deconvoluted ESI mass
spectrum showed a peak maximum at a M
r
of
19 536.2. This correlates well with the calculated value
for the *MtCM variant lacking the N-terminal 33 resi-
dues (predicted, 19 537.4). In parallel, the leaderless

*MtCM variant with the additional start methionine
as specified by pKTU3-HCT was produced, purified,
and subjected to ESI MS. Also in this case, the experi-
mental M
r
correlated well with the theoretical value
derived from the sequence (predicted, 19 668.6;
observed 19 666).
Overproduction and purification of *MtCM
variants
The leaderless forms of *MtCM with and without a
C-terminal His tag were overproduced in a CM-defici-
ent E. coli host strain. A specific purification protocol
was developed to optimize yield and purity of un-
tagged *MtCM by implementing three key features.
(a) The highest yields were obtained using strain KA29
(rather than KA13) as the production strain. KA29,
which is deficient in thioredoxin reductase, has a more
oxidative cytoplasm than wild-type E. coli strains and
is therefore recommended for the cytoplasmic produc-
tion of proteins with disulfide bonds [30], a probable
feature of *MtCM (see Discussion). (b) Heating to
95 °C for 5 min removed the majority of E. coli host
proteins (Fig. 2). This step was added because initial
thermal denaturation studies showed that most of the
*MtCM protein denatured reversibly. (c) Subsequent
anion-exchange chromatography under nonbinding
conditions (pH 4.5; the calculated isoelectric point of
*MtCM is 4.9) eliminated most of the nucleic acid im-
purities. In a second anion-exchange chromatography

step under binding conditions (pH 8.0), *MtCM was
eluted as a sharp peak, affording a highly pure sample
(Fig. 2). The final yield of untagged, leaderless *MtCM
was 3 mg per liter of bacterial culture (His-tagged
*MtCM was obtained at 10 mgÆ L
)1
).
The apparent M
r
values observed for all examined
*MtCM species on denaturing polyacrylamide gels run
under reducing conditions were generally significantly
higher than expected from the sequence. For instance,
the 167-residue untagged leaderless *MtCM has a cal-
culated M
r
of 18 603.5 (including the engineered initi-
ator Met), in good agreement with the value of
18 602.2 from ESI MS. In contrast, it migrated as a
M
r
23 000 band on SDS ⁄ PAGE (Fig. 2).
Structural characteristics
The primary sequence of the translated *aroQ gene
was analyzed with the program predictprotein [31],
which predicted the secondary structure of the leader-
Table 2. Localization of CM activity in subcellular compartments. Variants of *MtCM with and without export leader sequence were pro-
duced by CM-deficient E. coli KA13 ⁄ pLysS also carrying one of the plasmids listed. No CM activity was detectable in the absence of an
*aroQ gene. CM activities in the isolated fractions of the indicated compartments were determined at 50 l
M chorismate and normalized to

1 mL bacterial culture.
Plasmid Signal peptide His tag location
CM activity [l
M converted chorismateÆs
)1
Æ(mL culture)
)1
]
Cytoplasm Periplasm Medium
pKTU1-HCW Yes C 140 (28%)
a
330 (66%) 28 (6%)
pKTU2-HNW Yes N 270 (18%)
a
1100 (75%) 100 (7%)
pKTU3-HCT No C 54 (95%) 2.6 (5%) 0.45 (1%)
a
Residual CM activity may be an artifact from incomplete fractionation of compartments or from partial re-activation during sample prepar-
ation of insoluble *MtCM originally present in inclusion bodies.
Fig. 2. Purification of untagged, leaderless *MtCM monitored by
SDS ⁄ PAGE. Lanes: 1, total cellular protein before IPTG induction of
*aroQ expression; 2, after induction; 3, crude lysate (after lysozyme
treatment, sonication and removal of insoluble debris); 4, fraction of
crude lysate remaining soluble after 5 min at 95 °C; 5, insoluble
fraction after heating; M, LMW marker; 6–8, final purified *MtCM,
loaded at different concentrations.
Secreted chorismate mutase from M. tuberculosis S. Sasso et al.
378 FEBS Journal 272 (2005) 375–389 ª 2004 FEBS
less *MtCM to consist of six a-helices, connected by
loop segments (Fig. 3A). Such a predominantly a-heli-

cal structure was confirmed by CD spectroscopy
(Fig. 3B) with the observed troughs at 208.0 and
220.5 nm typical of a-helical proteins [32]. The a-heli-
cal content predicted from the primary sequence (67%;
Fig. 3B) matches well with the 69% estimated from
the CD spectrum [33].
The quaternary structure of *MtCM was investi-
gated by gel filtration applying protein samples in a
concentration range of 1–61 lm (Fig. 4A). The average
apparent M
r
from five runs was 43 400 ± 3500. Divi-
sion by the theoretical subunit M
r
yields a ratio of
2.3 ± 0.2. The elution volume for *MtCM was
independent of the concentration of the injected pro-
tein sample (Fig. 4A, inset).
Analytical ultracentrifugation of *MtCM was
carried out as a complementary experiment to gel fil-
tration. Samples with three different *MtCM concen-
Fig. 3. Secondary structure of *MtCM. (A) Secondary-structure
assignment of the *MtCM sequence [20], using the program Pre-
dictProtein [31]. The six a-helices (H1 through H6) predicted for the
leaderless *MtCM are indicated (L, loop; E, extended; H, helical
structure). Lower case letters denote the signal sequence predicted
with the program
SIGNALP [27,28]. (B) CD spectrum. The concentra-
tion of the leaderless, untagged protein was 0.73 l
M in 20 mM

potassium phosphate buffer, pH 7.5. h
m,r
is the mean molar ellipti-
city per residue.
Fig. 4. Quaternary structure of leaderless, untagged *MtCM. (A)
Analytical size-exclusion chromatography. The elution parameter K
av
of each protein is plotted against the logarithm of the relative
molecular mass (M
r
) of the standard proteins (s), or of the M
r
cal-
culated from the sequence for a dimeric *MtCM (d). Inset: appar-
ent oligomeric state of *MtCM as a function of the concentration
of the injected sample. (B) Analytical ultracentrifugation. Shown is
the concentration gradient, the computed fit to a dimer model, and
the residuals to the fit for the representative sedimentation equilib-
rium experiment with 11 l
M *MtCM at 19 000 r.p.m. and 20 °C.
S. Sasso et al. Secreted chorismate mutase from M. tuberculosis
FEBS Journal 272 (2005) 375–389 ª 2004 FEBS 379
trations were run at three different velocities each. A
representative sedimentation equilibrium experiment is
shown in Fig. 4B. The data fitted in good agreement
to a dimer model. The apparent M
r
values calculated
from the nine data sets are summarized in Table 3.
The mean value is 35 400 ± 2200, which corresponds

to 1.9 ± 0.1 times the calculated M
r
of the polypep-
tide chain.
Thermal stability
Thermal denaturation and renaturation of *MtCM
was followed between 20 and 70 °C by measuring the
ellipticity at 222 nm. The denaturation curve shows a
sharp transition from the native to the denatured state
(Fig. 5), with a calculated melting temperature (T
m
)of
48 °C. Upon subsequent cooling, the protein renatured
easily (Fig. 5).
Kinetic studies
The CM activity of the leaderless, untagged form of
*MtCM was also measured in vitro. The enzyme fol-
lows Michaelis–Menten kinetics with the catalytic
parameters k
cat
¼ 50 s
)1
and K
m
¼ 180 lm (at 30 °C
and pH 7.5). As shown in Table 4, the corresponding
values for the C-terminally His-tagged enzyme deviated
only slightly. The k
cat
parameter increases slightly with

increasing pH (between pH 5 and pH 8), whereas K
m
increases more dramatically by a factor of over 20-fold
over the same range (Fig. 6A). As a consequence, the
catalytic efficiency, k
cat
⁄ K
m
, drops by two orders of
magnitude between pH 5 and pH 9.
Inclusion of 1 mm tryptophan, phenylalanine or tyro-
sine, or 0.5 mm salicylate in the kinetic assays did not
alter CM activity by more than 10% (data not shown).
Established CM transition state analog inhibitors,
which include the oxabicyclic carboxylic acids 1 [34]
and 2 [35,36], and adamantane-1-phosphonate 3 [37,38]
(Fig. 6B), were tested for their impact on *MtCM activ-
ity. Whereas compounds 2 and 3 did not inhibit
*MtCM up to concentrations of 100 lm and 1 mm,
respectively (data not shown), compound 1 showed
competitive inhibition with a K
i
of 3.7 lm (Fig. 6C).
Discussion
Our data establish that the ORF Rv1885c from the
genome of M. tuberculosis encodes an exported CM.
The enzyme was overproduced in E. coli and subjected
to detailed structural and functional studies. Sequence
Table 3. Analytical ultracentrifugation of *MtCM. Sedimentation
equilibrium experiments were carried out at three different protein

concentrations at three different velocities each. Listed are the M
r
values calculated from the nine data sets.
Rotor
velocity
(r.p.m.)
Calculated M
r
at
different *MtCM concentrations
1.0 l
M 3.0 lM 11 lM
13 000 33 400 32 900 36 900
16 000 34 500 35 400 36 300
19 000 33 000 39 500 36 900
Table 4. Kinetic parameters of *AroQ proteins in comparison with
other CMs. Abbreviations: *MtCM-C, leaderless *MtCM with C-ter-
minal His tag; *StCM, *PaCM and *EhCM are the *AroQ homologs
in S. typhimurium, P. aeruginosa and E. herbicola, respectively.
EcCM and BsCM are cytoplasmic CMs described in the text.
Assays were performed in 50 m
M potassium phosphate buffer,
pH 7.5, at 30 °C, unless stated otherwise. k
cat
was calculated per
active site. The inhibition constant K
i
is listed for transition state
analog 1. ND, Not determined.
Enzyme

k
cat
(s
)1
)
K
m
(lM)
k
cat
⁄ K
m
(M
)1
Æs
)1
)
K
i
(lM)
*MtCM
a
50 ± 2 180 ± 10 2.7 · 10
5
3.7
*MtCM-C
a
56 ± 1 150 ± 10 3.7 · 10
5
ND

*StCM
b
8.9 142 6.3 · 10
4
ND
*PaCM
b
6.4 98 6.5 · 10
4
ND
*EhCM
b
9.7 169 5.7 · 10
4
ND
EcCM
c
64 ± 3 390 ± 51 1.6 · 10
5
2.3
BsCM
c
41 ± 2 74 ± 8 5.5 · 10
5
1.0
a
The standard deviation indicated was calculated from duplicate
measurements.
b
Measured at 32 °C; data from [12].

c
From [36].
Fig. 5. Thermal denaturation of *MtCM. The concentration of the
leaderless, untagged protein was 0.73 l
M in 20 mM degassed
potassium phosphate buffer, pH 7.5. The CD signal was followed
at 222 nm for the same sample during heating (s) and subse-
quently during cooling (h). h
m,r,222
is the mean molar ellipticity per
residue at 222 nm.
Secreted chorismate mutase from M. tuberculosis S. Sasso et al.
380 FEBS Journal 272 (2005) 375–389 ª 2004 FEBS
analysis and CD spectroscopy showed that the mature
(leaderless) *MtCM is an a-helical AroQ protein. The
polypeptide is predicted to fold into six a-helices,
connected by loop segments (Fig. 3A). In contrast,
each of the two identical subunits of EcCM adopts
only three a-helices which combine to form an inter-
twined dimer (Fig. 1B) [8]. The protein sequence
encompassing the first three predicted helices of
*MtCM aligns well with EcCM (Fig. 7A). However,
the first 12 amino acids of EcCM, and thus part of the
very long H1-helix which contains the active-site resi-
due Arg11 (Fig. 7B), are missing from *MtCM H1.
Interestingly, the sequence predicted to form the H4-
helix of *MtCM (Fig. 3A) aligns reasonably well with
the first part of EcCM H1 (Fig. 7A). This stretch in
*MtCM includes a match (Arg134) to Arg11 of EcCM
and a pattern of hydrophobic residues which are well

conserved among AroQ proteins [4] and which provide
helix–helix contacts in EcCM [8]. Indeed, combinato-
rial mutagenesis and selection experiments have shown
that Arg134 is functionally essential in *MtCM
Fig. 7. Conservation and sequence location of presumed active-site
residues in *MtCM. (A) Alignment of the sequences of *MtCM
(mature form) and EcCM. Residues lining the active site in EcCM
and the (presumably) homologous residues in *MtCM are shown in
bold. Underlined residues indicate the a-helical regions: for EcCM,
this assignment is based on the structurally resolved residues 5–95
in the crystal [8] while for *MtCM, the predicted locations are used
(Fig. 3). (B) Scheme of the active site of EcCM, complexed with
transition state analog 1 [8].
Fig. 6. Kinetic investigation of leaderless, untagged *MtCM. (A) pH
dependence of k
cat
(d), K
m
(j) and the catalytic efficiency k
cat
⁄ K
m
(e). The high K
m
value at pH 8.7 only allowed the determination of
k
cat
⁄ K
m
because of the limitation of the maximum chorismate con-

centration to 1.3 m
M. (B) CM transition state analog inhibitors used
in this work: 1 [34]; 2 [35]; 3, adamantane-1-phosphonate [38]. (C)
Lineweaver–Burk plot [70] with inhibitor 1. Chorismate concentra-
tions were varied in the CM assays at fixed inhibitor concentrations
of 0 l
M (d), 0.75 lM (j), 1.5 lM (r), 3.0 lM (s), 6.0 lM (h), and
12 l
M (e)in50mM potassium phosphate buffer, pH 7.5. Inset:
replot of the slopes of the Lineweaver–Burk plot.
S. Sasso et al. Secreted chorismate mutase from M. tuberculosis
FEBS Journal 272 (2005) 375–389 ª 2004 FEBS 381
(unpublished work), as is its presumed counterpart
Arg11 in EcCM [39]. These findings hint at *AroQ
proteins being topologically rearranged alternatives of
other typical members of the AroQ class.
What might be the role of helices H5 and H6?
Although the melting temperature of *MtCM is only
48 °C and significantly lower than the 63 °C measured
for its mesophilic AroQ homolog EcCM and much
lower than the 88 °C for the CM of the thermophile
Methanococcus jannaschii [4], we found that *MtCM
rapidly renatures after heat denaturation. Preliminary
studies with reductants suggest that an intramolecular
disulfide bond located in the last two helices (formed
between Cys160 and Cys193) contributes to this effi-
cient refolding (unpublished work), a feature that was
exploited to eliminate most E. coli proteins during
*MtCM purification. Thus, the two extra helices might
have a stabilizing role. The results of analytical ultra-

centrifugation and size-exclusion chromatography
experiments show that *MtCM is clearly a dimer. In
these experiments, which were carried out over a range
of protein concentrations, the ratios of observed M
r
to
calculated subunit M
r
values were 1.9 (± 0.1) and 2.3
(± 0.2), respectively, and there was no indication of
an equilibrium with other quaternary states. The
slightly higher value obtained by gel filtration could be
explained by an elongated shape of the a-helical dimer;
similar observations were previously made for other
AroQ proteins [4,40]. To our knowledge, all character-
ized members of the AroQ family share a dimeric
structure [4,8,9], including the isochorismate pyruvate
lyase (PchB) from P. aeruginosa [40]. The permutated
helix topology in *AroQ proteins will, however,
require a different mode of subunit interaction from
that observed in the prototype EcCM. Thus, helices
H5 and H6, which are found exclusively in *AroQ
subclass members, may also contribute to protein
packing in the context of the alternative dimerization
interface.
Kinetic studies show that *MtCM is a very active
CM. Its catalytic parameters are comparable to those
of the well-established cytoplasmic enzymes EcCM and
BsCM. Moreover, the k
cat

of *MtCM is fivefold to
eightfold higher than k
cat
of three previously character-
ized *AroQ homologs, which results (at similar K
m
val-
ues) in a significantly higher catalytic efficiency
(Table 4). As shown in Fig. 7, residues that line the
active site in EcCM are in general well conserved in
*MtCM. The fact that the K
m
significantly increases
between pH 5 and 9 is consistent with *MtCM having
a glutamate (Glu109) at the position corresponding to
Gln88 of EcCM (Fig. 7). An analogous pH dependence
of K
m
has been reported for the Gln88Glu variant of
EcCM [39,41]. The allosteric CM from S. cerevisiae,
the other AroQ protein for which the crystal structure
is known, also has a glutamate at the homologous posi-
tion, and this residue was shown to be responsible for
the strong pH dependence of the CM activity [42]. It is
noteworthy that *MtCM is inhibited by transition state
analog 1 to the same extent as EcCM and BsCM
(Table 4). In contrast, compound 2, which is known to
be a 24-fold more selective inhibitor for BsCM than
for EcCM [36], did not appreciably inhibit *MtCM.
Taken together, these results are consistent with the

active site of *MtCM being structurally and function-
ally similar to that of a typical AroQ enzyme (Fig. 7B).
In vivo assays in E. coli have clearly demonstrated
that M. tuberculosis *aroQ can successfully complement
the CM deficiency of a heterologous host. Comple-
mentation was, however, only observed in constructs
devoid of the leader sequence (Table 1). This can be
rationalized by the fact that the normal site of action
for a CM in E. coli is the cytoplasm, where the enzymes
of the shikimate pathway are located. The data from
the complementation assays, the cellular fractionation
(Table 2), and ESI MS of the exported protein confirm
that the predicted signal sequence of *MtCM is recog-
nized and cleaved in E. coli. The leader sequence also
possesses all of the typical features of signal peptides
from M. tuberculosis [43]. The matching criteria include
(a) its total length (33 residues), (b) the length of its
N-terminal, central hydrophobic, and C-terminal
regions (encompassing nine, 15, and nine residues,
respectively), (c) the presence of alanines at the ante-
penultimate and last positions (AXA motif), and (d)
the fact that the mature protein starts with aspartate
[43]. From the combined experimental and signal pep-
tide prediction data available, we presume that *MtCM
is exported by M. tuberculosis, too. As this bacterium is
Gram-positive, any transfer of a nonmembrane protein
from the cytoplasm must occur directly into the sur-
rounding medium rather than into the periplasmic space,
the target compartment of the *AroQ homologs from
E. herbicola [13], S. typhimurium and P. aeruginosa [12].

The biological significance of an exported CM
remains mysterious, however. M. tuberculosis is able
to grow in minimal medium lacking aromatic amino
acids [44,45]. In its genome, all seven genes corres-
ponding to the biosynthetic steps leading from
d-erythrose 4-phosphate and phosphoenolpyruvate to
chorismate have been identified. Most steps from chor-
ismate to the aromatic amino acids were also assigned
(see Fig. 1A), including genes for a cytoplasmic pre-
phenate dehydratase and a putative cytoplasmic
prephenate dehydrogenase [20,46] (http://genolist.
pasteur.fr/TubercuList). Although no gene encoding
Secreted chorismate mutase from M. tuberculosis S. Sasso et al.
382 FEBS Journal 272 (2005) 375–389 ª 2004 FEBS
a cytoplasmic CM in M. tuberculosis has yet been
assigned, sequence similarity searches [26,47] have
revealed a candidate (Rv0948c) which is currently
being examined. Moreover, the secreted *MtCM des-
cribed in this work appears unsuitable to close the gap
between chorismate made by the cytoplasmic shiki-
mate pathway and the terminal (cytoplasmic) branches
from prephenate towards Phe and Tyr. Interestingly,
Jensen and coworkers found evidence for a mini bio-
synthetic pathway from chorismate to phenylalanine in
the periplasm of some bacterial species, which utilizes
an *AroQ CM and periplasmic versions of prephenate
dehydratase (or cyclohexadienyl dehydratase, *PheC)
and aromatic amino-acid aminotransferase (*Aat) [12].
However, the absence of *PheC and *Aat homologs
from M. tuberculosis argues against a contemporary

role for *MtCM in such extracellular Phe biosynthesis,
the biological significance of which is also still obscure
[12].
It is possible that *MtCM may play some role in
the pathogenesis of M. tuberculosis. In both M. tuber-
culosis and M. bovis,*aroQ is the second gene in an
operon consisting of seven ORFs. While no charac-
terized homolog is known for the fourth gene
(Rv1883c), the putative intracellular or membrane-
bound products of genes 5 (Rv1882c), 6 (Rv1881c)
and 7 (Rv1880c) exhibit similarities to a short-chain
alcohol dehydrogenase, a membrane lipoprotein
(LppE) and a cytochrome P450 (Cyp140), respectively
( In contrast
with these genes, for which information on function in
Mycobacterium is still lacking, the genes immediately
flanking *aroQ were experimentally investigated and
are believed to be disease-related. The first gene in the
operon (fbpB, Rv1886c) encodes a secreted mycolyl-
transferase (FbpB), which is involved in the final
assembly of the mycobacterial cell wall [48], an essen-
tial barrier responsible for disease persistence and
shielding of the organism from many antibiotics [49].
FbpB is also one of the predominant exported proteins
and a constituent of the antigen 85 complex known for
its strong fibronectin binding [50,51]. It may play a
key role in the invasion of human macrophages, which
then leads to intracellular bacterial multiplication or to
the notorious dormant infection by M. tuberculosis
that affects one third of the world’s population [25].

For these reasons, FbpB is considered an essential tar-
get for the development of antimycobacterial chemo-
therapeutic agents [48,51]. Immediately downstream of
*aroQ is rpfC, which encodes a resuscitation-promo-
ting factor that was shown to shorten the lag phase in
liquid cultures of closely related mycobacterial species
[52]. RpfC has thus been implicated in promoting
growth of dormant M. tuberculosis cells [52], which
might subsequently lead to open tuberculosis.
There are also hints that *AroQ proteins themselves
could be pathogenicity factors. For instance, even
though animals are believed to lack the shikimate path-
way and need to take up essential aromatic compounds
from their diet [53], an *aroQ gene encoding a secreted
CM was isolated from a cDNA library prepared from
the esophageal gland region of the root-knot nematode
Meloidogyne javanica [15]. This obligate plant parasite
induces the production of giant feeder cells in the root
of its host plant presumably by injecting esophageal
gland secretions through its stylet. Furthermore, this
CM, if produced recombinantly in soybean root cells,
suppressed lateral root development and vascular tissue
formation in the plant, phenotypes that are also
observed during infection [54]. The *aroQ gene of
Heterodera glycines, the soybean cyst nematode, was
shown to be polymorphic, and this *aroQ polymorph-
ism clearly correlated with the virulence of different
nematode inbred lines [17]. As the nematode CMs are
probably injected into the plant’s cytoplasm [15], a
model was presented in which the parasitic enzyme

alters the balance of metabolic fluxes within the plant
cell to favor establishment of phytonematodic parasit-
ism [54]. This hypothesis could also be valid for other
phytopathogens found to possess *aroQ genes such as
the bacteria E. herbicola [13], Pseudomonas syringae,
Ralstonia solanacearum, Xantomonas campestris and
Xylella fastidiosa, but not for pathogens of mammals,
as their hosts do not possess the shikimate pathway.
Apart from Mycobacterium,*aroQ genes are present
in several other bacterial pathogens of mammals inclu-
ding Burkholderia fungorum, P. aeruginosa, Rhodococ-
cus equi, Salmonella typhi, S. typhimurium and Yersinia
pestis ([12], unpublished work). Evidence that *AroQ
proteins might contribute to virulence in animals was
provided by a study with S. typhimurium; the *aroQ
promoter was one of four promoters that were found
to be induced after infection of mice [18]. In R. equi,a
pulmonary pathogen of foals and humans, the *aroQ
gene was found to reside in the pathogenicity island
on the virulence plasmid [19]. However, the mechanism
by which secreted bacterial CMs such as *MtCM may
support the pathogenicity process is not known. It will
be interesting to examine hypotheses about its involve-
ment in the synthesis of compounds that aid in colon-
izing the host, for instance, by interaction or
interference with coinfecting pathogens, or by engage-
ment with the host’s immune system. An understand-
ing of the function of *AroQ proteins may ultimately
lead to better concepts for fighting diseases such as
tuberculosis.

S. Sasso et al. Secreted chorismate mutase from M. tuberculosis
FEBS Journal 272 (2005) 375–389 ª 2004 FEBS 383
Experimental procedures
Materials and general procedures
Chromosomal DNA of M. tuberculosis strain H37Rv was
obtained from R Brosch (Institut Pasteur, Paris, France).
Oligonucleotides were custom-synthesized by Microsynth
(Balgach, Switzerland). DNA sequencing was performed on
an ABI PRIZM 310 or 3100-Avant Genetic Analyzer
(Applied Biosystems, Foster City, CA, USA) by the chain
termination method [55], using the BigDye Terminator
Cycle Sequencing Kit from the same company. Chorismate
and transition state analogs 1 [34], 2 [35] and 3 [38]
(Fig. 6B) were prepared by D Ku
¨
nzler [56], R Pulido [57],
A Mandal [36] and S Raillard [37], respectively, following
published protocols. Cloning techniques and general media
compositions were according to standard procedures [58].
For the calculation of M
r
, molar absorption coefficients
and isoelectric points from the primary sequence, the pro-
gram package from Genetics Computer Group, Inc. (Madi-
son, WI, USA) was used.
Strains and plasmid vectors
General cloning was carried out in E. coli strain XL1-Blue
(Stratagene, La Jolla, CA, USA). The in vivo selection sys-
tem KA12 ⁄ pKIMP-UAUC was described previously [11].
E. coli strain KA13 [4,59] was used for *MtCM localization

experiments, and strain KA29 for protein overproduction.
KA29 carries on its chromosome an isopropyl thio-b-d-gal-
actoside (IPTG)-inducible gene coding for T7 RNA polym-
erase [60] to allow high-level gene expression controlled by
a T7 promoter. It was constructed by site-specific integra-
tion of prophage kDE3 into the chromosome of E. coli
strain KA25 using the kDE3 Lysogenization Kit from Nov-
agen (Madison, WI, USA). KA25 was derived from E. coli
strain KA19 by generalized P1 transduction to delete the
recA gene employing a JC10289 ⁄ pKY102 lysate [61,62].
The construction of the precursor KA19 will be detailed
elsewhere; briefly, it is derived from the thioredoxin reduc-
tase-deficient E. coli strain AD494 [30,63] by chromosomal
replacement of both endogenous E. coli CM genes tyrA
and pheA by a fragment carrying the cat gene of pKIMP-
UAUC [11] as well as its tyrA* and pheC genes, which were
placed under tac promoter control. The genotype of KA29
is consequently P1
–
, D(srlR-recA)306::Tn10 (Tet
R
), D(pheA–
tyrA)::[tyrA*-pheC-cat (Cam
R
)], trxB::kan (Kan
R
), D(ara-
leu)7697, araD139, DlacX74 , galE, galK, rpsL (Str
R
), phoR,

D(phoA)PvuII, DmalF3, thi, F¢[lac-pro, lacI
q
], k (DE3)
[(lacUV5-expressed) T7-RNA-pol gene, imm21, Dnin5,
Sam7(int-)].
Plasmids pMG212H-W and pMG212H-0, which were
used as positive and negative controls, respectively, have
been described previously [64]. Plasmid pLysS was pur-
chased from Novagen. The high-copy number plasmid
pMG211 is a derivative of pKSS [65]. It features the dual-
promoter system described previously [64] with a sal and
T7 promoter in tandem, the latter being lac repressor-
controlled and thus IPTG inducible. The nahR gene on
pMG211 codes for an activator of the sal promoter and
renders it salicylate inducible. Cloning of a gene into
pMG211 using the XhoI site yields a protein with a
C-terminal His
6
tag, connected by a Leu-Glu linker.
pMG211 also carries a T7 terminator and an ampicillin
resistance gene. pMG211 (4690 bp) was constructed in two
steps. First, the 2838 bp PshI–BsaI fragment of pMG208
[64] was ligated to the 952 bp NspI(NspI overhang blunt-
ended by T4-DNA polymerase treatment)–Bsa I fragment
from pKSS [65], yielding pMG210. Secondly, the 2652 bp
BstEII–XhoI fragment of pMG210 was ligated to the
2038 bp BstEII–XhoI fragment of pMG209 [64], resulting
in pMG211.
Construction of *aroQ expression plasmids
The M. tuberculosis gene *aroQ was cloned using chromo-

somal DNA as the template for PCR. Several different
PCR experiments were carried out to obtain plasmids pos-
sessing either the entire *aroQ gene with the native signal
sequence (affix –W) or a truncated gene without this
sequence but having instead an added initiator Met codon
(affix –T). The encoded protein either carried a C-terminal
His
6
tag linked by Leu-Glu (second affix –C) or an N-ter-
minal His
6
tag fused to the presumed leader peptide by a
Ser-Ser-Gly linker (affix –N), or no tag (no additional
affix). Affix –H denotes a high-copy-number plasmid.
The plasmids were assembled as follows: the 600 bp NdeI–
XhoI PCR fragment with oligonucleotides 133-TUS (ACC
GATGT
CATATGCTTACCCGTCCACGTGAGATATA;
restriction site used for cloning underlined) and 134-TUN
(CGATAAT
CTCGAGGGCCGGCGGTAGGGCCTGGC
AAT) was ligated to the 4561 bp NdeI–XhoI fragment of
pMG211, yielding pKTU1-HCW (5161 bp). The 635 bp
NdeI–SpeI PCR fragment with oligonucleotides 135-TUS
(ACCGATGT
CATATGCACCATCATCATCATCATTCTT
CTGGTATGCTTACCCGTCCACGTGAGATATAC) and
136-TUN (CGATAC
ACTAGTTATTAGGCCGGCGGTA
GGGCCTGGCAAT) was ligated to the 4529 bp NdeI–SpeI

fragment of pMG211, yielding pKTU2-HNW (5164 bp).
The 504 bp NdeI–XhoI PCR fragment with oligonucleotides
134-TUN and 137-TUS (ACCGATGT
CATATGGAC
GGCACCAGCCAGTTAGCCGAGTT) was ligated to the
4561 bp NdeI–XhoI fragment of pMG211, yielding pKTU3-
HCT (5065 bp). The 509 bp NdeI–SpeI fragment of the
PCR with oligonucleotides 136-TUN and 137-TUS was
ligated to the 4529 bp NdeI–SpeI fragment of pMG211,
yielding pKTU3-HT (5038 bp). All plasmid segments
derived from PCR were checked by DNA sequencing using
oligonucleotides T7PRO2 (TAATACGACTCACTATA
GGG) and 131-TERM (CCCTCAAGACCCGTTTAGA).
Secreted chorismate mutase from M. tuberculosis S. Sasso et al.
384 FEBS Journal 272 (2005) 375–389 ª 2004 FEBS
Complementation of a CM-deficient strain
In vivo complementation assays were carried out using the
previously described selection system E. coli KA12 ⁄ pKIMP-
UAUC for CM activity [11]. Minimal medium M9c ⁄ S devi-
ates from the previously described M9c [66] by additionally
containing 0.1 mm salicylate. Selection plates M9c ⁄ S+F
contained 20 lgÆmL
)1
l-phenylalanine; positive control
plates M9c ⁄ S+FY in addition contained 20 lgÆmL
)1
l-tyro-
sine. Provision of 133 lm IPTG fully induced *aroQ genes as
well as the auxiliary functions on pKIMP-UAUC.
Overproduction and purification of leaderless

*MtCM
Five milliliters of Luria–Bertani medium containing
150 lgÆmL
)1
sodium ampicillin were inoculated with a single
colony of E. coli strain KA29 carrying pKTU3-HCT or
pKTU3-HT and incubated overnight at 37 °C. Then 500 mL
Luria–Bertani medium provided with 150 lgÆmL
)1
sodium
ampicillin were inoculated with the fresh overnight culture
and shaken at 170 r.p.m. at 37 °C; best yields were obtained
when the medium contained 2.0% (w ⁄ v) glucose. Between an
attenuance at 600 nm of 0.3 and 0.5, IPTG was added to
0.5 mm, and incubation was continued overnight. The cells
were chilled in an ice-water bath for 15 min, harvested by
centrifugation (20 min, 4000 g,4°C) and resuspended in
3 vol. sonication buffer (50 mm sodium phosphate buffer,
pH 8.0, containing 300 mm NaCl). After the addition of
lysozyme to 1 mgÆmL
)1
and incubation on ice for 30 min,
cells were ruptured by sonication. Removal of the insoluble
debris by centrifugation (20 min, 10 500 g,4°C) yielded the
crude lysate.
Protein tagged with a His
6
tail (encoded on pKTU3-
HCT) was purified by metal affinity chromatography [67].
The crude lysate was adjusted to 20 mm imidazole and

applied to a nickel ⁄ nitrilotriacetate ⁄ agarose column
(Qiagen, Basel, Switzerland). The main fraction was eluted
with 200 mm imidazole and subsequently dialyzed against
20 mm potassium phosphate (pH 7.5).
Untagged, leaderless *MtCM protein (encoded on
pKTU3-HT) was purified by a heat shock procedure.
Crude lysate was incubated at 95 °C for 5 min and subse-
quently kept at room temperature for 30 min. Denatured,
precipitated proteins were removed by centrifugation
(60 min, 10 500 g,4°C). The supernatant was dialyzed
twice at 4 °C for at least 4 h against 20 mm N-methylpip-
erazine (pH 4.5) and applied to a Mono Q 16 ⁄ 10 FPLC
anion-exchange column (Amersham Biosciences, Freiburg,
Germany). *MtCM was eluted with the latter buffer and
subsequently dialyzed against 20 mm Tris ⁄ HCl, pH 8.0
(buffer A). The protein solution was loaded on to a
second Mono Q column, which was developed with a lin-
ear gradient from 0 mm to 350 mm NaCl in buffer A over
150 mL at a flow rate of 3 mLÆmin
)1
. The fraction con-
taining *MtCM, which was eluted as a sharp peak at
170 mm NaCl, was dialyzed against 20 mm Tris ⁄ HCl
(pH 8.0) and stored at either 4 °Cor) 20 °C (no loss of
activity was observable after a single freeze–thaw cycle).
Protein concentration was generally determined by the
Micro BCA Protein Assay (Pierce, Rockford, IL, USA)
with BSA as the reference. For the pH variation kinetics,
*MtCM concentration was derived from UV absorption at
280 nm using a calculated molar absorption coefficient,

which results in about 10% higher values than from the
Micro BCA Protein Assay. Integrity and purity of the
samples were confirmed by SDS ⁄ PAGE under reducing
conditions using the Phast System and the LMW marker
from Amersham Biosciences, and for the untagged protein
additionally with ESI MS.
Fractionation of subcellular compartments
Cultures of E. coli KA13 ⁄ pLysS additionally transformed
with one of the plasmids pKTU1-HCW, pKTU2-HNW or
pKTU3-HCT were grown in 5 mL LB + Amp medium
(Luria–Bertani medium plus ampicillin) each and induced
as described above. The periplasmic fraction was obtained
by a modified published procedure [68]. For each mutant,
1.5 mL bacterial culture was spun down (3 min, 9000 g),
and the pellet was resuspended in 150 lL sucrose buffer
(200 gÆL
)1
sucrose, 30 mm Tris ⁄ HCl, pH 8.0). Spheroplasts
were obtained by the addition of lysozyme to 0.1 mgÆmL
)1
,
incubation at room temperature for 2 min, addition of
EDTA to 1 mm, incubation for 10 min, addition of 10 mm
MgSO
4
and incubation for 20 min The spheroplasts were
pelleted by centrifugation at 12 000 g at 4 °C for 20 min,
and the supernatant (¼ periplasmic fraction) was removed.
The pellet was resuspended in 283 lL sonication buffer
(described above), and, after the addition of lysozyme to

1mgÆmL
)1
, incubated on ice for 20 min. Then, 11 lL 20%
Triton X-100 were added, and after 10 min on ice, the
spheroplasts were broken by sonication. The supernatant
after 5 min centrifugation at 10 000 g at 4 °C represents the
soluble cytoplasmic fraction.
Determination of the processing site of *MtCM
To experimentally determine the processing site of the sig-
nal sequence of *MtCM in E. coli, the protein variants pro-
duced by E. coli transformants KA13 ⁄ pKTU1-HCW and
KA13 ⁄ pKTU3-HCT were purified under denaturing condi-
tions from crude lysates. The sonication buffer additionally
contained 8 m urea, and purification involved nickel ⁄ nitrilo-
triacetate affinity chromatography as described above.
*MtCM from KA13 ⁄ pKTU1-HCW was concentrated by
ultrafiltration using Macrosep and Microsep centrifugal
devices (Pall AG, Basel, Switzerland). Protein sizes were
obtained from ESI MS experiments.
S. Sasso et al. Secreted chorismate mutase from M. tuberculosis
FEBS Journal 272 (2005) 375–389 ª 2004 FEBS 385
Mass spectrometry
A 500 lL portion of an  10 lm protein solution was
desalted on a NAP-5 size-exclusion column (Amersham
Biosciences), which was equilibrated and eluted with 0.1%
acetic acid. ESI MS was performed on a Finnigan MAT
TSQ 7000 spectrometer (Thermo Electron, Waltham, MA,
USA). Standard errors of the masses obtained after decon-
volution are typically £ 0.1%.
CD spectroscopy and thermal denaturation

Far-UV CD spectra were recorded at 25 °C on an Aviv
202 CD spectrometer (Aviv Biomedical, Lakewood, NJ,
USA). A cuvette with a path length of 1.0 cm was used. Spec-
tra were obtained by averaging five scans from 260 to
200 nm in 0.5 nm steps, with a bandwidth of 1 nm and a sig-
nal averaging time of 3 s. To quantify the secondary-struc-
ture content from the spectra, a neural network was used
( [33]. Thermal
denaturation ⁄ renaturation was followed between 20 and
70 °Cin1°C steps by measuring the ellipticity at 222 nm. At
each temperature, the sample was allowed to equilibrate with
constant stirring for 90 s and was subsequently measured for
30 s. Data were fitted to a two-state model for a dimer [4].
Analytical size-exclusion chromatography
The oligomeric state of *MtCM was investigated by analyt-
ical size-exclusion chromatography using a Superose 12
(10 ⁄ 30) FPLC column (Amersham Biosciences). Chroma-
tography was performed at 4 °C with phosphate-buffered
saline (10 mm sodium phosphate, 160 mm NaCl, pH 7.5) as
the running buffer. Protein elution was detected by measur-
ing A
280
. A calibration curve was generated with the follow-
ing proteins: aprotinin (M
r
6500), cytochrome c (M
r
12 400), RNase A (M
r
13 700), trypsinogen (M

r
24 000),
carbonic anhydrase (M
r
30 000), ovalbumin (M
r
43 000)
and BSA (M
r
67 000). The void volume, V
0
, and the total
bed volume, V
t
, were determined using blue dextran (M
r
2 · 10
6
) and dithiothreitol, respectively. The elution param-
eter, K
av
, was calculated for each protein from its elution
volume (V
e
) using the equation
K
av
¼ (V
e
– V

0
) ⁄ (V
t
– V
0
).
Analytical ultracentrifugation
Conventional sedimentation equilibrium experiments were
performed at 20 °C on a Beckman XL-A analytical ultracen-
trifuge (Beckman Coulter, Fullerton, CA, USA). *MtCM
samples were run in 20 mm potassium phosphate buffer
(pH 7.5) containing 80 mm NaCl at three different protein
concentrations (1.0, 3.0, 11 lm) each at three different veloci-
ties (13 000, 16 000, 19 000 r.p.m.; rotor An-60 Ti) yielding
nine data sets. Absorbance was measured at 220, 233 and
280 nm, respectively, for the three different concentrations.
The calculated molar absorption coefficient of *MtCM at
280 nm, e
280
¼ 27 940 m
)1
Æcm
)1
, was used with an experi-
mental absorption spectrum to determine the remaining two
molar absorption coefficients e
233
¼ 94 940 m
)1
Æcm

)1
and
e
220
¼ 245 200 m
)1
Æcm
)1
. Data were collected at a radial spa-
cing of 0.001 cm. Ten scans were averaged for each set up.
Established methods [69] afforded a dimer model as best fit.
Kinetic assays
The disappearance of the substrate chorismate was followed
at 274 nm (e
274
¼ 2630 m
)1
Æcm
)1
) or 310 nm (e
310
¼
370 m
)1
Æcm
)1
). Standard assays were performed at 30 °Cin
50 mm potassium phosphate buffer, pH 7.5. The pH depend-
ence of the reaction was assessed in Universal Buffer [4] at
pH 5.1, pH 5.9, pH 6.8, pH 7.6 and pH 8.7. The data were

fitted to the Michaelis–Menten equation [70] with the pro-
gram kaleidagraph (Synergy Software, Reading, PA, USA).
Acknowledgements
We thank Roland Brosch for generously providing
M. tuberculosis DNA, Richard Thomas for carrying
out analytical ultracentrifugation experiments, and
Dominik Ku
¨
nzler, Rosalino Pulido, Ajay Mandal and
Stephan Raillard for provision of substrates and inhib-
itors. This work was supported by Novartis Pharma,
the ETH Zu
¨
rich and the Schweizerischer National-
fonds grant 3152A0-102211.
References
1 Haslam E (1993) Shikimic Acid: Metabolism and
Metabolites. Wiley, New York, NY.
2 Kast P, Tewari YB, Wiest O, Hilvert D, Houk KN &
Goldberg RN (1997) Thermodynamics of the conversion
of chorismate to prephenate: experimental results and
theoretical predictions. J Phys Chem B 101, 10976–
10982.
3 Lee AY, Stewart JD, Clardy J & Ganem B (1995) New
insight into the catalytic mechanism of chorismate
mutases from structural studies. Chem Biol 2, 195–203.
4 MacBeath G, Kast P & Hilvert D (1998) A small, ther-
mostable, and monofunctional chorismate mutase from
the archaeon Methanococcus jannaschii. Biochemistry 37,
10062–10073.

5 Chook YM, Ke H & Lipscomb WN (1993) Crystal
structures of the monofunctional chorismate mutase
from Bacillus subtilis and its complex with a transition
state analog. Proc Natl Acad Sci USA 90, 8600–8603.
6 Chook YM, Gray JV, Ke H & Lipscomb WN (1994)
The monofunctional chorismate mutase from Bacillus
Secreted chorismate mutase from M. tuberculosis S. Sasso et al.
386 FEBS Journal 272 (2005) 375–389 ª 2004 FEBS
subtilis: structure determination of chorismate mutase
and its complexes with a transition state analog and
prephenate, and implications for the mechanism of the
enzymatic reaction. J Mol Biol 240, 476–500.
7 Helmstaedt K, Heinrich G, Merkl R & Braus GH
(2004) Chorismate mutase of Thermus thermophilus is a
monofunctional AroH class enzyme inhibited by tyro-
sine. Arch Microbiol 181, 195–203.
8 Lee AY, Karplus PA, Ganem B & Clardy J (1995)
Atomic structure of the buried catalytic pocket of
Escherichia coli chorismate mutase. J Am Chem Soc
117, 3627–3628.
9 Xue Y, Lipscomb WN, Graf R, Schnappauf G &
Braus G (1994) The crystal structure of allosteric choris-
mate mutase at 2.2-A
˚
resolution. Proc Natl Acad Sci
USA 91, 10814–10818.
10 Stra
¨
ter N, Schnappauf G, Braus G & Lipscomb WN
(1997) Mechanisms of catalysis and allosteric regulation

of yeast chorismate mutase from crystal structures.
Structure 5, 1437–1452.
11 Kast P, Asif-Ullah M, Jiang N & Hilvert D (1996)
Exploring the active site of chorismate mutase by com-
binatorial mutagenesis and selection: the importance of
electrostatic catalysis. Proc Natl Acad Sci USA 93,
5043–5048.
12 Calhoun DH, Bonner CA, Gu W, Xie G & Jensen RA
(2001) The emerging periplasm-localized subclass of
AroQ chorismate mutases, exemplified by those from
Salmonella typhimurium and Pseudomonas aeruginosa.
Genome Biol 2 , 30.01–30.16.
13 Xia T, Song J, Zhao G, Aldrich H & Jensen RA (1993)
The aroQ-encoded monofunctional chorismate mutase
(CM-F) protein is a periplasmic enzyme in Erwinia
herbicola. J Bacteriol 175, 4729–4737.
14 Oliver DB (1996) Periplasm. In Escherichia coli and
Salmonella (Neidhardt FC, Curtiss R III, Ingraham JL,
Lin ECC, Low KB, Magasanik B, Reznikoff WS,
Riley M, Schaechter M & Umbarger HE, eds), pp.
88–103. ASM Press, Washington DC.
15 Lambert KN, Allen KD & Sussex IM (1999) Cloning
and characterization of an esophageal-gland-specific
chorismate mutase from the phytoparasitic nematode
Meloidogyne javanica. Mol Plant Microbe Interact 12 ,
328–336.
16 Jones JT, Furlanetto C, Bakker E, Banks B, Blok V,
Chen Q, Phillips M & Prior A (2003) Characterization
of a chorismate mutase from the potato cyst nematode
Globodera pallida. Mol Plant Pathol 4, 43–50.

17 Bekal S, Niblack TL & Lambert KN (2003) A choris-
mate mutase from the soybean cyst nematode
Heterodera glycines shows polymorphisms that
correlate with virulence. Mol Plant Microbe Interact 16,
439–446.
18 Bumann D (2002) Examination of Salmonella gene
expression in an infected mammalian host using the
green fluorescent protein and two-colour flow cyto-
metry. Mol Microbiol 43, 1269–1283.
19 Takai S, Hines SA, Sekizaki T, Nicholson VM, Alperin
DA, Osaki M, Takamatsu D, Nakamura M, Suzuki K,
Ogino N et al. (2000) DNA sequence and comparison
of virulence plasmids from Rhodococcus equi ATCC
33701 and 103. Infect Immun 68, 6840–6847.
20 Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C,
Harris D, Gordon SV, Eiglmeier K, Gas S, Barry CE,
III et al. (1998) Deciphering the biology of Mycobacteri-
um tuberculosis from the complete genome sequence.
Nature 393, 537–544 (erratum appeared in Nature 396,
190–198).
21 Smith CV & Sacchettini JC (2003) Mycobacterium tuber-
culosis: a model system for structural genomics. Curr
Opin Struct Biol 13, 658–664.
22 Terwilliger TC, Park MS, Waldo GS, Berendzen J,
Hung L-W, Kim C-Y, Smith CV, Sacchettini JC, Bellin-
zoni M, Bossi R et al. (2003) The TB structural geno-
mics consortium: a resource for Mycobacterium
tuberculosis biology. Tuberculosis 83, 223–249.
23 Sassetti CM, Boyd DH & Rubin EJ (2003) Genes
required for mycobacterial growth defined by high den-

sity mutagenesis. Mol Microbiol 48, 77–84.
24 Jungblut PR, Mu
¨
ller E-C, Mattow J & Kaufmann SHE
(2001) Proteomics reveals open reading frames in Myco-
bacterium tuberculosis H37Rv not predicted by geno-
mics. Infect Immun 69, 5905–5907.
25 Stewart GR, Robertson BD & Young DB (2003) Tuber-
culosis: a problem with persistence. Nat Rev Microbiol
1, 97–105.
26 Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J &
Wheeler DL (2004) GenBank: update. Nucleic Acids Res
32, D23–D26.
27 Nielsen H, Engelbrecht J, Brunak S & von Heijne G
(1997) Identification of prokaryotic and eukaryotic
signal peptides and prediction of their cleavage sites.
Protein Eng 10, 1–6.
28 Nielsen H & Krogh A (1998) Prediction of signal
peptides and signal anchors by a hidden Markov
model. In Proceedings of the Sixth International Confer-
ence on Intelligent Systems for Molecular Biology
(Glasgow J, ed.), pp. 122–130. AAAI Press, Menlo
Park, CA.
29 Danese PN & Silhavy TJ (1998) Targeting and assembly
of periplasmic and outer-membrane proteins in Escheri-
chia coli. Annu Rev Genet 32, 59–94.
30 Derman AI, Prinz WA, Belin D & Beckwith J (1993)
Mutations that allow disulfide bond formation in the
cytoplasm of Escherichia coli. Science 262, 1744–1747.
31 Rost B & Sander C (1993) Prediction of protein second-

ary structure at better than 70% accuracy. J Mol Biol
232, 584–599.
32 Johnson WC Jr (1992) Analysis of circular dichroism
spectra. Methods Enzymol 210, 426–447.
S. Sasso et al. Secreted chorismate mutase from M. tuberculosis
FEBS Journal 272 (2005) 375–389 ª 2004 FEBS 387
33 Andrade MA, Chaco
´
n P, Merelo JJ & Mora
´
n F (1993)
Evaluation of secondary structure of proteins from UV
circular dichroism spectra using an unsupervised learn-
ing neural network. Protein Eng 6, 383–390.
34 Bartlett PA & Johnson CR (1985) An inhibitor of chor-
ismate mutase resembling the transition-state conforma-
tion. J Am Chem Soc 107, 7792–7793.
35 Kangas E & Tidor B (2001) Electrostatic complementar-
ity at ligand binding sites: application to chorismate
mutase. J Phys Chem B 105, 880–888.
36 Mandal A & Hilvert D (2003) Charge optimization
increases the potency and selectivity of a chorismate
mutase inhibitor. J Am Chem Soc 125, 5598–5599.
37 Stetter H & Last W-D (1969) U
¨
ber Verbindungen mit
Urotropin-Struktur, XLIV: U
¨
ber Adamantan-phos-
phonsa

¨
ure-(1)-dichlorid. Chem Ber 102, 3364–3366.
38 Chao HS-I & Berchtold GA (1982) Inhibition of choris-
mate mutase activity of chorismate mutase-prephenate
dehydrogenase from Aerobacter aerogenes. Biochemistry
21, 2778–2781.
39 Liu DR, Cload ST, Pastor RM & Schultz PG (1996)
Analysis of active site residues in Escherichia coli choris-
mate mutase by site-directed mutagenesis. J Am Chem
Soc 118, 1789–1790.
40 Gaille C, Kast P & Haas D (2002) Salicylate biosynth-
esis in Pseudomonas aeruginosa: purification and charac-
terization of PchB, a novel bifunctional enzyme
displaying isochorismate pyruvate-lyase and chorismate
mutase activities. J Biol Chem 277, 21768–21775.
41 Zhang S, Kongsaeree P, Clardy J, Wilson DB & Ganem
B (1996) Site-directed mutagenesis of monofunctional
chorismate mutase engineered from the E. coli P-pro-
tein. Bioorg Med Chem 4, 1015–1020.
42 Schnappauf G, Stra
¨
ter N, Lipscomb WN & Braus GH
(1997) A glutamate residue in the catalytic center of the
yeast chorismate mutase restricts enzyme activity to
acidic conditions. Proc Natl Acad Sci USA 94, 8491–
8496.
43 Wiker HG, Wilson MA & Schoolnik GK (2000) Extra-
cytoplasmic proteins of Mycobacterium tuberculosis:
mature secreted proteins often start with aspartic acid
and proline. Microbiology 146, 1525–1533.

44 Sauton MB (1912) Sur la nutrition mine
´
rale du
bacille tuberculeux. C R Hedb Seances Acad Sci 155,
860–861.
45 Agranoff D, Monahan IM, Mangan JA, Butcher PD &
Krishna S (1999) Mycobacterium tuberculosis expresses
a novel pH-dependent divalent cation transporter
belonging to the Nramp family. J Exp Med 190, 717–
724.
46 Camus J-C, Pryor MJ, Me
´
digue C & Cole ST (2002)
Re-annotation of the genome sequence of Mycobacter-
ium tuberculosis H37Rv. Microbiology 148, 2967–2973.
47 Altschul SF, Madden TL, Scha
¨
ffer AA, Zhang J,
Zhang Z, Miller W & Lipman DJ (1997) Gapped
BLAST and PSI-BLAST: a new generation of protein
database search programs. Nucleic Acids Res 25, 3389–
3402.
48 Belisle JT, Vissa VD, Sievert T, Takayama K, Brennan
PJ & Besra GS (1997) Role of the major antigen of
Mycobacterium tuberculosis in cell wall biogenesis.
Science 276, 1420–1422.
49 Brennan PJ & Nikaido H (1995) The envelope of myco-
bacteria. Annu Rev Biochem 64, 29–63.
50 Peake P, Gooley A & Britton WJ (1993) Mechanism of
interaction of the 85B secreted protein of Mycobacter-

ium bovis with fibronectin. Infect Immun 61, 4828–4834.
51 Ronning DR, Klabunde T, Besra GS, Vissa VD, Belisle
JT & Sacchettini JC (2000) Crystal structure of the
secreted form of antigen 85C reveals potential targets
for mycobacterial drugs and vaccines. Nat Struct Biol 7,
141–146.
52 Mukamolova GV, Turapov OA, Young DI, Kaprely-
ants AS, Kell DB & Young M (2002) A family of auto-
crine growth factors in Mycobacterium tuberculosis. Mol
Microbiol 46, 623–635.
53 Schmid J & Amrhein N (1995) Molecular organization
of the shikimate pathway in higher plants. Phytochemis-
try 39, 737–749.
54 Doyle EA & Lambert KN (2003) Meloidogyne javanica
chorismate mutase 1 alters plant cell development. Mol
Plant Microbe Interact 16, 123–131.
55 Sanger F, Nicklen S & Coulson AR (1977) DNA
sequencing with chain-terminating inhibitors. Proc Natl
Acad Sci USA 74, 5463–5467.
56 Grisostomi C, Kast P, Pulido R, Huynh J & Hilvert D
(1997) Efficient in vivo synthesis and rapid purification
of chorismic acid using an engineered Escherichia coli
strain. Bioorg Chem 25, 297–305.
57 Smith WW & Bartlett PA (1993) An improved synthesis
of the transition state analog inhibitor of chorismate
mutase. J Org Chem 58, 7308–7309.
58 Sambrook J & Russell DW (2001) Molecular Cloning: A
Laboratory Manual, 3rd edn. Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY.
59 MacBeath G & Kast P (1998) UGA read-through arti-

facts: when popular gene expression systems need a
pATCH. Biotechniques 24, 789–794.
60 Studier FW & Moffatt BA (1986) Use of bacteriophage
T7 RNA polymerase to direct selective high-level
expression of cloned genes. J Mol Biol 189, 113–130.
61 Ihara M, Oda Y & Yamamoto K (1985) Convenient
construction of strains useful for transducing recA
mutations with bacteriophage P1. FEMS Microbiol Lett
30, 33–35.
62 Kast P & Hennecke H (1991) Amino acid substrate spe-
cificity of Escherichia coli phenylalanyl-tRNA synthetase
altered by distinct mutations. J Mol Biol 222, 99–124.
63 Prinz WA, A
˚
slund F, Holmgren A & Beckwith J (1997)
The role of the thioredoxin and glutaredoxin pathways
Secreted chorismate mutase from M. tuberculosis S. Sasso et al.
388 FEBS Journal 272 (2005) 375–389 ª 2004 FEBS
in reducing protein disulfide bonds in the Escherichia
coli cytoplasm. J Biol Chem 272, 15661–15667.
64 Gamper M, Hilvert D & Kast P (2000) Probing the role
of the C-terminus of Bacillus subtilis chorismate mutase
by a novel random protein-termination strategy. Bio-
chemistry 39, 14087–14094.
65 Kast P (1994) pKSS: a second-generation general pur-
pose cloning vector for efficient positive selection of
recombinant clones. Gene 138, 109–114.
66 Kast P, Grisostomi C, Chen IA, Li S, Krengel U, Xue
Y & Hilvert D (2000) A strategically positioned cation
is crucial for efficient catalysis by chorismate mutase.

J Biol Chem 275, 36832–36838.
67 Van Dyke MW, Sirito M & Sawadogo M (1992)
Single-step purification of bacterially expressed
polypeptides containing an oligo-histidine domain.
Gene 111, 99–104.
68 Torriani A (1966) Alkaline phosphatase from Escheri-
chia coli.InProcedures in Nucleic Acid Research (Can-
toni CL & Davies R, eds), pp. 224–235. Harper & Row,
New York, NY.
69 Laue TM, Shah B, Ridgeway TM & Pelletier SL (1992)
Computer-aided interpretation of analytical sedimenta-
tion data for proteins. In Analytical Ultracentrifugation
in Biochemistry and Polymer Science (Harding SE,
Rowe AJ & Horton JC, eds), Royal Society of Chemi-
stry, Cambridge, UK.
70 Segel IH (1976) Biochemical Calculations: How to Solve
Mathematical Problems in General Biochemistry, 2nd
edn. Wiley, New York, NY.
S. Sasso et al. Secreted chorismate mutase from M. tuberculosis
FEBS Journal 272 (2005) 375–389 ª 2004 FEBS 389