Báo cáo khoa học: De novo RNA synthesis by a recombinant classical swine fever virus RNA-dependent RNA polymerase pot

De novo
RNA synthesis by a recombinant classical swine fever virus
RNA-dependent RNA polymerase
Guang-Hui Yi, Chu-Yu Zhang, Sheng Cao, Hai-Xiang Wu and Yi Wang
Institute of Virology, College of Life Sciences, Wuhan University, Wuhan, Hubei, China
Classical swine fever virus nonstructural protein 5B (NS5B)
encodes an RNA-dependent RNA polymerase, a key
enzyme of the viral replication complex. To better under-
stand the initiation of viral RNA synthesis and to establish
an in vitro replication system, a recombinant NS5B protein,
lacking the C-terminal 24-amino acid hydrophobic domain,
was expressed in Escherichia coli. The truncated fusion
protein (NS5BD24) was purified on a Ni-chelating HisTrap
affinity column and demonstrated to initiate either plus-
or minus-strand viral RNA synthesis de novo in a primer-
independent manner but not by terminal nucleotidyle
transferase activity. De novo RNA synthesis represented the
preferred mechanism for initiation of classical swine fever
virus RNA synthesis by RNA-dependent RNA polymerase
in vitro.BothMg
2+
and Mn
2+
supported de novo initiation,
however, RNA synthesis was more efficient in the presence
of Mn
2+
than in the presence of Mg
2+
. De novo initiation of
RNA synthesis was stimulated by preincubation with

0.5 m
M
GTP, and a 3¢-terminal cytidylate on the viral RNA
template was preferred for de novo initiation. Furthermore,
the purified protein was also shown, by North-Western blot
analysis, to specifically interact with the 3¢-end of both plus-
and minus-strand viral RNA templates.
Keywords: classical swine fever virus; RNA-dependent
RNA polymerase; nonstructural protein 5B; de novo RNA
synthesis; RNA-binding activity.
Classical swine fever virus (CSFV) is a small enveloped
positive-strand RNA virus classified in the genus of
Pestivirus, which also comprises bovine viral diarrhea virus
(BVDV) and border disease virus (BDV). Together with the
genera Flavivirus and Hepacivirus, they form the family
Flaviviridae [1,2]. The genomic RNA,  12.3 kb in length,
contains a single long ORF encoding a polyprotein of
 3898 amino acids which is flanked by 5¢-and3¢-UTRs [3].
The 5¢-UTR contains an internal ribosomal entry site
(IRES) for cap-independent translation of the viral poly-
protein [4,5], whereas the 3¢-UTR may contain replication
signals involved in minus-strand RNA synthesis, as in
BVDV [6]. The polyprotein is processed, co- and post-
translationally, into 12 polypeptides by viral and cellular
proteases. The order of polypeptides is NH
2
-N
pro
-C-E
rns

-
E1-E2-p7-NS2-NS3-NS4A-NS4B-NSA-NS5B-COOH [7].
N
pro
, a nonstructural autoprotease, can release itself from
its precursor, but is not necessary for viral replication in cell
culture [8]. Nuclecapsid protein C, and glycoproteins E
rns
,
E1 and E2, represent four structural proteins, and form the
capsid and envelope of the virion, respectively. The others
are nonstructural proteins (NS) [3]. Most of the NS are
speculated to be components in the viral replication cycle.
Among them, NS3 is a multifunctional enzyme and
responsible for functions associated with the replication
and biotype of cytopathogenicity in cell culture [9]. The last
viral protein (NS5B), at the C terminus of the polyprotein, is
a key component responsible for the replication of viral
RNA genome. It also contains motifs shared by RNA-
dependent RNA polymerases (RdRps), such as the Gly–
Asp–Asp (GDD) motif, which is highly conserved among
RdRps [10] and has been demonstrated to possess RdRp
activity in insect cells [11,12] and porcine kidney cells (PK-
15) [13]. It is believed that certain enzymatic functions of
NS3 and NS5B may play an important role during the
replication of viral RNA.
The replication of the CSFV genome is generally thought
to be similar to other positive-strand RNA viruses: synthesis
of complementary minus-strand RNA with the plus-strand
genomic RNA as template, and subsequent synthesis of the

progeny RNA with the minus-strand RNA as template.
Thus, the 3¢-end of both plus- and minus-strand RNAs may
contain the cis-acting elements, such as promoter or
enhancer, involved in the initiation of viral RNA synthesis
by RdRp. Although several infectious cDNA clones of
CSFV have been developed [14–18], facilitating the research
of cytopathogenicity, replication and function of viral
proteins by reverse genetic approach in the cell culture
system [8,9,19], another method to study CSFV replication
would be to work towards identification of the cis-acting
elements at the 3¢-end of both plus- and minus-strand RNAs
and possibly the viral or cellular proteins that interact with
it to form a replication complex for initiating viral RNA
synthesis in vitro. At present, the molecular mechanism of
Correspondence to C Y. Zhang, Institute of Virology, College of Life
Sciences, Wuhan University, Wuhan 430072, China.
Fax: + 86 27 87883833, Tel.: + 86 27 87682833,
E-mail:
Abbreviations: ALP, alkaline phosphatase; BVDV, bovine viral
diarrhea virus; CSFV, classical swine fever virus; DIG, digoxin;
RdRp, RNA-dependent RNA polymerase; IRES, internal
ribosomal entry site; NS5B, nonstructural protein 5B; TNTase,
terminal nucleotidyle transferase.
(Received 23 September 2003, accepted 24 October 2003)
Eur. J. Biochem. 270, 4952–4961 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03897.x
initiating CSFV RNA synthesis is not well understood.
Previous reports have shown that the recombinant CSFV
NS5B (expressed in insect cells) catalyzed RNA synthesis
was strictly primer-dependent and that intramolecular
priming copy-back synthesis represented the preferred

mechanism for initiation of RNA synthesis [11]. However,
the activity of the cellular terminal nucleotidyle transferase
(TNTase) was also demonstrated to be present in the
cytoplasmic extracts of insect cells [20,21]. The cellular
TNTase could add extra nucleotides to the 3¢-terminus of
the RNA template and might serve as primer for template-
primed copy-back synthesis. Moreover, evidence was
obtained that the TNTase activity associated with the
hepatitis C virus NS5B might be the result of a contamin-
ating cellular protein present in minute amounts in the
enzyme preparation [21].
To better understand the initiation of CSFV RNA
replication, we expressed and purified a recombinant
NS5BD24 fusion protein from Escherichia coli BL21
(DE3). The fusion protein was demonstrated to have the
ability to initiate de novo either plus- or minus-strand viral
RNA synthesis in a primer-independent manner and to
specifically interact with viral RNA templates. This in vitro
RdRp assay will be useful for using to study the sequences
and proteins required for the initiation of CSFV RNA
synthesis.
Materials and methods
Plasmid constructs
The plasmid pGEM5b, containing full-length CSFV (Shi-
men strain) NS5B, was constructed as described previously
[13]. The NS5B fragment lacking the C terminal 24 amino
acids (NS5BD24) was PCR amplified with the following
primer pair – NS5BFor and NS5BRev – from pGEM5b
(Table 1). A polyhistidine tag (GSHHHHHH) was intro-
duced at the C terminus to facilitate purification of the

NS5BD24 protein. After purification, the PCR products
were digested with NcoIandBglII and then inserted into
the NcoI/BamHI sites of vector pET-28a (Novagen). The
resulting expression vector, pET-NS5BD24, which was
driven by the T7 RNA polymerase promoter, was trans-
formed into E. coli DH5a. Site-directed mutagenesis of
GDD to GAA, containing the double substitution of both
Asp448 and Asp449 to alanine, was carried out by
overlapping PCR. The N terminal 1370 bp fragment was
amplified by NS5BFor and NS5Bm2, and the C terminal
780 bp fragment was amplified by NS5Bm1 and NS5BRev.
Then, the two fragments were purified and combined to
generate the mutant NS5BD24GAA using the outer primers
NS5BFor and NS5BRev. After modification with NcoI
and BglII, the mutant fragment was subcloned into vector
pET-28a. Transformants were analyzed by restriction
enzyme mapping and confirmed by the dideoxy sequencing
method.
Expression and purification of recombinant CSFV
NS5BD24
E. coli BL21 (DE3), transformed with either pET-NS5BD24
or pET-NS5BD24GAA, was grown in Luria–Bertani (LB)
medium, at 37 °C, to an attenuance (D) at 600 nm of  0.6–
0.8. Then, the temperature was lowed to 18 °C, and protein
expression was induced for 20 h by the addition of 0.4 m
M
isopropyl thio-b-
D
-galactoside (IPTG). The cell pellet
obtained from 500 mL of culture was resuspended in

30 mL of binding buffer containing 20 m
M
sodium phos-
phate, pH 8.0, 500 m
M
NaCl, 20 m
M
imidazole, 10 m
M
b-mercaptoethanol, 20% glycerol, 1% Triton-X-100, 1 m
M
phenylmethanesulfonyl fluoride, and 10 lgÆmL
)1
lysozyme.
Then 20 lL of DNase I (Takara) was added to the
suspension for 30 min at room temperature. The lysates
were sonicated on ice to reduce viscosity, and any insoluble
materials were removed by centrifugation at 13 000 g for
15 min. The clear supernatant was applied to a 1-mL
Ni-chelating HisTrap affinity column (Amersham) pre-
equilibrated with the binding buffer containing 50 m
M
imidazole. The bound protein was then eluted stepwise
with elution buffer (20 m
M
sodium phosphate, pH 8.0,
500 m
M
NaCl, 5 m
M

b-mercaptoethanol, 20% glycerol,
0.2% Triton-X-100) containing a gradient imidazole con-
centration from 150 to 450 m
M
.Thefractionswere
monitored by SDS/PAGE and staining with Coomassie
Brilliant Blue R250. Then, the His-tagged protein peaks
were collected and dialyzed against buffer (20 m
M
Tris/HCl
pH 8.0, 500 m
M
NaCl and 20% glycerol), followed by
storage at )40 °C in small aliquots. The concentration of
purified protein was determined by the Bradford method
using BSA as a standard.
SDS/PAGE and Western blot
Protein fractions from the HisTrap affinity column were
separated by 12% SDS/PAGE and electrotransferred to a
nitrocellulose membrane. The membrane was blocked with
Table 1. Sequence of the primers used in this study. The T7 polymerase
promoter sequence is shown in italics. The mutated nucleotides are
shown in bold and the additional polyhistidine amino acid sequences
are underlined.
Primers Sequence (5¢)3¢)
NS5BFor CATGCCATGGGCAGTAATTGGGTGATGCA
NS5BRev GAAG
ATCTTAATGATGATGATGATGATG
GCTGCCATTGTACCTGTCTGCCCCTT
NS5Bm1 ATCAGGAGACCAGCAGCCCCGCACACAT

NS5Bm2 ATGTGTGCGGGGCTGCTGGTCTCCTGAT
5¢-UTRfor GTATACGAGGTTAGTTCATTC
5¢-UTRfor1 CTATACGAGGTTAGTTCATTC
5¢-UTRfor2 TTATACGAGGTTAGTTCATTC
5¢-UTRfor3 ATATACGAGGTTAGTTCATTC
5¢-UTRrev TAATACGACTCACTATAGGGTGCCATGAA
CAG
5¢-UTRrev2 GTGCCATGAACAGCAGAGATTTTTATAC
P1 TAGCCATGCCCATAGTAGG
P2 ATCAGGTCGTACTCCCATCAC
3¢-UTRfor TAATACGACTCACTATAGCGCGGGTAAC
3¢-UTRfor2 GCGCGGGTAACCCGGGATCTGAA
3¢-UTRrev GGGCCGTTAGGAAATTACCTTAGTC
3¢-UTRrev1 CGGCCGTTAGGAAATTACCTTAGTC
3¢-UTRrev2 TGGCCGTTAGGAAATTACCTTAGTC
3¢-UTRrev3 AGGCCGTTAGGAAATTACCTTAGTC
Ó FEBS 2003 De novo RNA synthesis by CSFV RdRp (Eur. J. Biochem. 270) 4953
3% BSA in NaCl/P
i
and treated with rabbit anti-swine
serum infected with CSFV. Alkaline phosphatase (ALP)-
conjugated goat anti-(rabbit IgG) was used as the secondary
antibody. After washing three times with NaCl/P
i
contain-
ing 0.1% Tween-20, membrane-bound antibodies were
detected with Nitro Blue tetrazolium/5-bromo-4-chloro-
indol-2-yl phosphate.
Preparation of RNA templates and RNA labeling
RNA templates were prepared by in vitro transcription. The

plasmid T6-1, containing the full-length CSFV 3¢-UTR,
and the plasmid pGEM61s-2, containing the full-length
5¢-UTR, were constructed as previously reported [18]. The
DNAfragmentofthe3¢-end of the plus-strand RNA
(+)3¢-UTR was amplified using primers 3¢-UTRfor and
3¢-UTRrev from T6-1; and the 3¢-end of the minus-strand
RNA (–)IRES, which is complementary to the CSFV
5¢-UTR, was amplified from pGEM61s-2 using the primers
5¢-UTRfor and 5-¢UTRrev. To generate (+)3¢-UTR
mutants with substitution of the 3¢ terminus cytidylate with
G, A and T, PCR was performed with sense primer
3¢-UTRfor and antisense primers 3¢-UTRrev1, 3¢-UTRrev2
or 3¢-UTRrev3, respectively, using T6-1 as template. For
(–)IRES mutants, PCR was perfomed using the sense
primers 5¢-UTRfor1, 5¢-UTRfor2 or 5¢-UTRfor3 and anti-
sense primer 5¢-UTRrev from pGEM61s-2. All the PCR
amplifications were performed using pfu DNA polymerase
(MBI), and the DNA fragments were recovered using a
DNA purification kit. The T7 RNA polymerase promoter
sequence was introduced into the primers 3¢-UTRfor and
5¢-UTRrev to initiate RNA synthesis. In vitro transcription
was carried out with T7 RNA polymerase, according to the
manufacturer’s instructions (Promega). After a 2 h incuba-
tion at 37 °C, the DNA templates were digested twice with
RNase-free DNase I. The RNA transcripts were extracted
with acid phenol/chloroform (1 : 1, v/v), followed by
precipitation with two volumes of ethanol and 0.4
M
sodium
acetate. The precipitated RNA was dissolved in diethyl

pyrocarbonate-treated water and the RNA concentration
determined by measuring the absorbance (A)at260nm.
Occasionally, RNA transcripts were further purified by 6%
PAGE containing 7
M
urea. The gel fragment containing the
RNA was excised and incubated overnight in 10 m
M
Tris/
HCl, pH 7.5, 25 m
M
NaCl, 1 m
M
EDTA. After elimination
of polyacrylamide, the RNA was precipitated by ethanol.
The 3¢-hydroxyl group of RNA transcripts was blocked by
sodium periodate, as described previously [22]. Ten micro-
grams of RNA transcript was dissolved in 100 lLof50m
M
sodium acetate. After the addition of 25 lL sodium perio-
date (100 m
M
), the mixture was incubated for 1 h at room
temperature, then phenol/chloroform extracted and ethanol
precipitated. Residual sodium periodate was removed by
several washes using 70% ethanol.
For preparation of digoxin (DIG)-labeled RNA probes
or templates, the DNA fragments of (+)3¢-UTR and
(–)IRES were used as templates for in vitro transcription.
RNA labeling was performed according to the instruction

manual supplied with the DIG RNA labeling kit of Roche
Molecule Biochemicals. The mixtures were incubated for
2 h at 37 °C, and DNA templates were removed by
digestion with RNase-free DNase I.
In vitro
RdRp
The in vitro RdRp standard assay was performed in a total
volume of 50 lL containing 20 m
M
Tris/HCl, pH 8.0,
5m
M
MgCl
2
,5m
M
MnCl
2
,2m
M
dithiothreitol, 50 m
M
NaCl, 0.25 m
M
of each NTP, 0.3 lgofRNAtemplateand
 0.1 lg of purified protein. The reaction mixtures were
incubated at 25 °C for 2 h and stopped by the addition of
20 m
M
EDTA. The RNA products were extracted with acid

phenol/chloroform (1 : 1, v/v) followed by ethanol precipi-
tation. Then, the precipitates were dissolved with either
20 lL of diethyl pyrocarbonate-treated water or denaturing
buffer (see below).
Northern blot analysis
The precipitated RdRp products were dissolved in a
denaturing buffer containing 95% formamide, 10 m
M
EDTA, 20 m
M
Tris/HCl, pH 8.0, at 100 °Cfor5min,
and then separated by PAGE (8% gel containing 7
M
urea)
in 1· Tris/borate/EDTA (TBE) buffer. After electrophor-
esis, the gels were transferred to a positively charged nylon
membrane (Hybond) and electroblotted for 4 h at 4 °C.
The membrane was dried for 2 h at 80 °C and exposed to
ultraviolet irradiation (254 nm) for 2 min at 0.12 JÆsq cm
)1
.
Hybridization was performed overnight, at 68 °C, in 10 mL
of a solution containing 50% formamide, 2% blocking
reagent (Roche), 5 · NaCl/Cit and 20 lgÆmL
)1
yeast
tRNA, together with the appropriate DIG-labeled RNA
transcripts. The excess probes were eliminated gradually by
washing the membrane from low stringency (2· NaCl/Cit,
0.2% SDS) to high stringency (0.1· NaCl/Cit, 0.1% SDS)

at 68 °C. Then, the bound RNA was treated with ALP-
conjugated anti-DIG Ig (1 : 5000) in dilution buffer
(1· blocking reagent in 0.1
M
maleic acid buffer, pH 7.0)
for 30 min. The reaction complexes were visualized using
Nitro Blue tetrazolium/5-bromo-4-chloroindol-2-yl phos-
phate, according to the manufacturers of the DIG RNA
detection kit (Roche).
RT–PCR and real-time quantitative RT–PCR
The strand-specific oligodeoxynucleotide primers, 5¢-UTR-
rev2 and 3¢-UTRfor2, complementary to the synthesized
plus- and minus-strand RNAs, were used for RT-catalyzed
cDNA synthesis, followed by PCR amplification of cDNAs.
Six microlitres of dissolved RNA was subjected to RT with
M-MLV according to the manufacturer’s instructions
(Promega). PCR was performed with 5¢-UTRfor and
5¢-UTRrev2 primers for detection of synthesized plus-
strand RNA. For detection of synthesized minus-strand
RNA, 3¢-UTRfor2 and 3¢-UTRrev primers were used.
The synthesized RNA was real-time quantified using the
TaqMan assay, according to McGoldrick et al. [23] and
Cheng et al. [24], with some modifications. A set of 5¢-UTR-
specific primers, P1 (forward) and P2 (reverse), were used to
amplify a 222-bp fragment of the 5¢-UTR (nucleotides
95–316). The fluorogenic probe was designed with the
following sequence: 5¢-TACAGGACAGTCGTCAGTAG
TTCGACGTGA-3¢. RNA quantification was performed as
follows: the precipitated RNA was reverse transcribed to
cDNA using P

2
as a primer, then 2 lL of cDNA was used
4954 G H. Yi et al. (Eur. J. Biochem. 270) Ó FEBS 2003
as the template for amplification in a 20-lL volume
containing 15 pmol of each primer, 4.5 m
M
MgCl
2
, 1 unit
of Taq polymerase (MBI) and 3 pmol of TaqMan probe
(Alpha). The PCR mixtures were placed in a thermocycler
(Corbett) and subjected to 45 cycles of the following
reaction parameters: denaturation at 95 °Cfor30s,
annealing at 60 °C for 30 s and extension at 72 °Cfor45s.
RNA-binding activity by North-Western blot
The protein samples were resolved by SDS/PAGE (10%
gel) and transferred to nitrocellulose membrane. Mem-
brane-bound proteins were renatured in buffer A (10 m
M
Tris/HCL, 50 m
M
NaCl, 5% glycerol, 5 m
M
MgCl
2
,0.1%
Triton-X-100, pH 7.8) containing 5 mgÆmL
)1
BSA and
1m

M
dithiothreitol, at room temperature for 4 h. After
washing with buffer A, membranes were transferred to
RNA binding buffer (10 m
M
Tris/HCl, 100 m
M
NaCl, 5%
glycerol, 5 m
M
MgCl
2
,0.2m
M
dithiothreitol, 0.1% Triton-
X-100, 20 lgÆmL
)1
tRNA, 0.5 mgÆmL
)1
BSA, pH 7.8). One
microlitre of DIG-labeled RNA was added and the
membranes were incubated for 2 h with gentle shaking.
Membranes were washed twice with RNA binding buffer,
without dithiothreitol and tRNA, and then the bound RNA
was treated with ALP-conjugated anti-DIG Ig (1 : 5000).
RNA–protein complexes were visualized using Nitro Blue
tetrazolium/5-bromo-4-chloroindol-2-yl phosphate.
Results and discussion
Expression and purification of bacterial recombinant
NS5BD24 and its mutant, NS5BD24GAA

To isolate the function of CSFV NS5B from other viral
and cellular proteins and to establish an in vitro replication
system for studying the initiation of viral RNA replica-
tion, NS5B protein was expressed in an E. coli system.
Earlier attempts to express and purify the full-length
NS5B had been hampered as a result of the poor
solubility. Sequence analysis and analysis of the hydro-
pathy profile of CSFV NS5B revealed that there was a
conserved hydrophobic domain at the C terminus of
different CSFV strains (Fig. 1A). Prompted by reports
that removal of the C terminal hydrophobic domain of
the RdRps of hepatitis C virus [25–27], hepatitis G virus
[28], and BVDV [29] could significantly improve the
solubility of the protein expressed in E. coli,theC
terminal 24 amino acids of NS5B were deleted and
NS5BD24 was inserted into the pET-28a vector. To
facilitate protein expression and purification, additional
Met–Glu residues were introduced at the N terminus for
initiating translation, and a polyhistidine epitope tag
(GSHHHHHH) was introduced to the C terminal of
NS5BD24 for affinity purification. The fusion protein, of
 75 kDa, was obtained with an imidazole elution gradi-
ent of 150 to 250 m
M
(Fig. 1B). The protein was identified
as the recombinant NS5B by Western blot analysis using
CSFV-infected pig serum as primary antibody (Fig. 1C).
To maximize the amount of soluble protein, expression
was performed at a low temperature (18 °C) and the cell
pellet was resuspended in a nonionic detergent (1%

Triton-X-100) in combination with a high concentration
of salt (500 m
M
) and glycerol (20%). We succeeded in
recovering  2 mg of soluble protein from 1 L of E. coli
culture. The other mutant protein, NS5BD24GAA, was
expressed and purified in parallel to the NS5BD24 protein.
The sufficient amounts of soluble protein thus obtained
provided the basis for further studying the characteriza-
tion of the enzyme and for the development of an in vitro
replication system.
Fig. 1. Expression and purification of classical
swine fever virus (CSFV) NS5BD24 and
NS5BD24GAA fusion proteins from Escheri-
chia coli. (A) Hydropathy profile (Kyte and
Doolittle) of CSFV NS5B. NS5B contains a
highly hydrophobic region at the C terminus.
(B) Proteins were expressed and purified as
described in the Materials and methods.
Fractions of sample eluted from the HisTrap
affinity column by a concentration gradient of
imidazole were separated by SDS/PAGE
(12% gel) and stained with Coomassie Brilli-
ant Blue. Lane M, molecular mass markers;
lanes 1–4, eluted with 150 m
M
imidazole buf-
fer; lanes 5–8, eluted with 250 m
M
imidazole

buffer; lanes 9–11, eluted with 350 m
M
imi-
dazole buffer. (C) Western blot analysis of the
purified protein. Lane 1, NS5BD24 protein;
lane 2, pET-28a vector as a negative control;
lane 3, NS5BD24GAA protein.
Ó FEBS 2003 De novo RNA synthesis by CSFV RdRp (Eur. J. Biochem. 270) 4955
NS5BD24 fusion protein possessed RdRp activity
To determine whether the truncated NS5B (NS5BD24)
protein could direct a viral-specific sequence for initiation of
RNA synthesis in vitro,the3¢-end of plus-strand (+)3¢-UTR
and minus-strand (–)IRES RNA transcripts were used as
templates because they were believed to contain cis-acting
promoters for initiating viral RNA synthesis. As T7 RNA
polymerase was able to elongate self-complementary RNA
templates by template-directed RNA synthesis during
in vitro transcription [30], both (+)3¢-UTR and (–)IRES
RNA transcripts were purified before being used as
templates. RNA templates were loaded onto the same gel
as the marker and were visualized by silver staining. The
RNA products synthesized by CSFV NS5BD24 were
separated by denaturing PAGE (8% gel) and detected
using a Northern blot assay. As shown in Fig. 2 (lane 3), the
purified NS5BD24 was able to synthesize either the plus-
strand or minus-strand RNA products from the respective
templates. The predominant RNA products migrated
similarly to the respective RNA templates (373 nucleotides
for synthesized plus-strand RNA and 228 nucleotides for
synthesized minus-strand RNA). When (–)IRES was used

as a template, a very small amount of high molecular weight
RNA products was also observed. However, no RNA
products were obtained in the absence of purified protein or
RNA templates, indicating that purified NS5BD24 was not
contaminated with T7 RNA polymerase or RNA/DNA
that could serve as a template. Furthermore, mutation of
the conserved motif, GDD, to GAA almost abolished RNA
synthesis (Fig. 2, lane 4), similar to the reports for hepatitis
C virus RdRp [31,32]. These results showed that purified
NS5BD24 fusion protein, lacking the C terminal 24 amino
acids, possessed RdRp activity in vitro and that the C
terminal hydrophobic domain was not necessary for RdRp
activity.
Evidence of
de novo
RNA synthesis with either plus-
or minus-strand viral RNA as template
For the positive strand RNA viruses, the mechanisms of
initiating viral RNA synthesis are rather different. Poliovi-
rus has been shown to use a uridylylated protein as primer
(protein-primed) to initiate RNA synthesis [33]. Phage Qb
initiated de novo RNA synthesis [34], whereas rabbit
hemorrhagic disease virus (RHDV) initiated RNA synthesis
by using a template-primed copy-back mechanism [35].
Besides copy-back synthesis, Dengue virus RdRp was also
demonstrated to be capable of de novo initiation of RNA
synthesis [36]. Previous work has shown that crude extracts
of recombinant CSFV NS5B expressed in insect cells could
produce two RNA products using D-RNA (an mRNA of
the liver-specific transcription factor DCoH) as template.

One product, which was identical in size to the input RNA
template, might have resulted from a TNTase activity, while
the other was determined to be a double-stranded hairpin
dimer RNA synthesized by a copy-back mechanism [11].
However, our work found that the predominant RNA
products were template-sized, and thus the question was
whether the template-sized RNA products were generated
through de novo RNA synthesis. As the template-sized
RNA could be detected by complementary probes, and
RNA polymerization required all four ribonucleotides as
substrates (data not shown), it seemed that the template-
sized RNA products probably represented RNA synthes-
ized by a de novo initiation mechanism but should not result
from a terminal transferase activity. If RNA products were
synthesized by TNTase activity, it would have the same
polarity as the input RNA template [37]. To provide further
evidence of de novo RNA synthesis, the 3¢-hydroxyl group
of RNA templates were blocked by treatment with sodium
periodate. The migration patterns of RNA products are
shown in Fig. 3A, indicating that the template-sized RNA
products were truly synthesized by de novo initiation, but
not by the 3¢-end elongation copy-back synthesis. It should
be pointed out that a very small amount of high molecular
weight RNA products were still observed with 3¢-blocked
(–)IRES as template, possibly because the polymerase used
the nascent RNA as template for additional rounds of RNA
synthesis. Furthermore, we performed RT using strand-
specific oligodeoxynucleotides as a primer that could anneal
only to the 3¢-terminus of either synthesized plus- or minus-
strand RNA products, followed by PCR amplification. The

amplified fragments were analyzed by agarose gel electro-
phoresis and stained by ethidium bromide. As shown in
Fig. 3B, the expected sizes of DNA fragments (373 nucleo-
tides for new synthesized plus-strand and 228 nucleotides
for the minus-strand) were observed, verifying that tem-
plate-sized RNA products were initiated de novo from the
3¢-terminus of the template but not by premature termin-
ation or internal initiation, as suggested in reports for
tomato bushy stunt virus, cucumber necrosis virus [38] and
hepatitis C virus [39]. Taken together, these results strongly
suggest that the purified CSFV NS5BD24 could preferen-
tially initiate either plus- or minus-strand viral RNA
synthesis de novo in the absence of primers and viral or
Fig. 2. RNA-dependent RNA polymerase (RdRp) activity of classical
swine fever virus (CSFV) NS5BD24 protein. The RNA templates were
purified before use. RNA products were separated by PAGE (8% gel
containing 7
M
urea) and detected by Northern blot. (A) The 228-
nucleotide (+)3¢-UTR RNA transcripts were used as template. (B)
RdRp assay with 373-nucleotide (–)IRES RNA transcripts as tem-
plate. Lane 1, absence of RNA template; lane 2, absence of NS5BD24;
lane 3, presence of NS5BD24 and RNA template; lane 4, presence of
NS5BD24GAA and RNA template. The position of the input RNA
template is shown as Ô-Õ.
4956 G H. Yi et al. (Eur. J. Biochem. 270) Ó FEBS 2003
host factors. This result is contrary to the previous reports
for CSFV RdRp [11], as well as BVDV RdRp [40], another
member of the Pestivirus genus, in which the major RNA
products catalyzed by RdRp were shown to be a covalently

linked double-stranded molecule generated by a copy-back
mechanism. At present it is unknown whether this discrep-
ancy is caused by the various viral enzyme preparations or
different templates used. In fact, reports have shown that
the RdRp of BVDV could preferentially initiate RNA
synthesis by a de novo initiation mechanism with chemically
synthesized short RNA (21 nucleotides) as a template [41],
although a primer extension RNA product was also
observed [42]. Therefore, de novo initiation of RNA
synthesis might represent the preferred mechanism used
by Pestivirus RdRps in vitro.
Optimal conditions for
de novo
RNA synthesis using
(–)IRES as template
To optimize conditions for de novo RNA synthesis by
the NS5BD24 protein, the 3¢-end of minus-strand RNA
(–)IRES, was used as template and newly synthesized RNA
products were quantified by real-time quantitative RT–PCR
(TaqMan assay), which allowed quantification of the
starting copies of the reaction, rather than the end products,
by monitoring the increment of fluorescence released [43].
We first examined the effects of time and temperature on
RNA synthesis. As shown in Fig. 4A, the synthesis of RNA
products occured for at least 120 min, and the preferred
temperature for the RdRp assay was  25 °C (Fig. 4B). The
divalent cations Mg
2+
and/or Mn
2+

are known to be
required for RdRp activity. Our results showed that both
Mg
2+
and Mn
2+
supported de novo RNA synthesis;
however, Mn
2+
(Fig. 4D) induced RdRp activity more
efficiently than Mg
2+
(Fig. 4C). Maximum activity was
observed at 5–7.5 m
M
Mn
2+
and 7.5–10 m
M
Mg
2+
.The
high concentrations of Mn
2+
and Mg
2+
had negative
impacts on RNA synthesis. Next, we determined the
optimal concentrations of template and protein for RdRp
assay. As shown in Fig. 4E, the synthesis of RNA products

increased with increasing amounts of enzyme to 100 ng,
excess amounts of enzyme inhibited the RdRp reaction.
However, a high concentration of the RNA template had
no significant inhibition on RNA synthesis (Fig. 4F), which
differed from the previous report for hepatitis C virus RdRp
using homologous RNA as template [44]. This might be
a result of the various enzymes and template used in the
RdRp reaction.
Analysis of initiation of
de novo
RNA synthesis
To examine the effect of preincubation with 0.5 m
M
NTP
on the initiation of RNA synthesis, the RdRp mixtures were
first preincubated with 0.5 m
M
of each NTP for 30 min,
thenfurtherincubatedfor90minwith0.25m
M
NTP as
substrates. Higher activities of de novo RNA synthesis were
obtained when either (+)3¢-UTR or (–)IRES template was
preincubated with 0.5 m
M
NTP, respectively, compared to
the RdRp reaction without preincubation (Fig. 5A,B).
When (+)3¢-UTR was used as template, preincubation
with 0.5 m
M

GTP and ATP resulted in higher activities,
whereas higher activities were observed following preincu-
bation with 0.5 m
M
GTP and UTP using (–)IRES as
template.
Previous studies have shown that a 3¢-cytidylate in the
template is preferred, by several viral RdRps, for de novo
initiation of RNA synthesis [41,45]. To determine whether
this is also the case for CSFV RdRp, we investigated the
influence of substitution of the 3¢-terminal cytidylate with
guanidylate, adenylate or uridylate, on de novo RNA
Fig. 3. De novo initiation of viral RNA synthesis by classical swine fever virus (CSFV) RNA-dependent RNA polymerase (RdRp). Both viral plus- and
minus-strand RNA templates were treated with sodium periodate to block the 3¢-OH group and then used as template for RdRp assay. (A)
Northern blot assay with (+)3¢-UTR and (–)IRES as templates. Lane 1, RdRp assay with NS5BD24GAA as a control; lane 2, RdRp assay with
NS5BD24 and 3¢-blocked RNA template. (B) Synthesized RNA was subjected to RT-PCR. RT was performed using a primer complementary to
the newly synthesized minus-strand (lanes 2 and 3) or plus-strand RNA (lanes 4 and 5), followed by PCR amplification. Lane 1, 100 bp DNA
ladder; lanes 2 and 4, RNA template (T) used as a control; lanes 3 and 5, RT–PCR results of newly synthesized products (P); lane 6, NS5BD24
protein as a control. PCR products were electrophoresed through an agarose gel and visualized by ethidium bromide staining. The expected
fragments were 228 nucleotides (newly synthesized minus-strand RNA) and 373 nucleotides (synthesized plus-strand RNA) in length.
Ó FEBS 2003 De novo RNA synthesis by CSFV RdRp (Eur. J. Biochem. 270) 4957
synthesis. As shown in Fig. 5C,D, changing the 3¢ terminal
C, of both plus-strand and minus-strand RNA templates, to
G, A or U dramatically decreased RNA synthesis, indica-
ting that a 3¢-terminal cytidylate was necessary for efficient
de novo RNA synthesis. Surprisingly, RNA polymerization
was slightly higher when the 3¢-terminal C was replaced with
U, rather than A or G, with (+)3¢-UTR as template
(Fig. 5C). For (–)IRES as template, RNA synthesis was
slightly higher when the 3¢-terminal C was replaced with G,

rather than with A or U (Fig. 5D). This result was in
Fig. 4. Effects of reaction conditions on
de novo RNA synthesis with (–)IRES as tem-
plate. The synthesized RNA was quantified by
real-time RT–PCR. Effects of: (A) time, (B)
temperature, (C) Mg
2+
concentration, (D)
Mn
2+
concentration, (E) enzyme concentra-
tion and (F) template concentration.
Fig. 5. Analysis of initiation of d e nov o RNA synthesis. (A) and (B) The RNA-dependent RNA polymerase (RdRp) mixtures were first preincubated
with 0.5 m
M
of each NTP for 30 min, then further incubated for 90 min with 0.25 m
M
of each NTP as substrates. (A) (+)3¢-UTR as template. (B)
(–)IRES as template. Lane 1, no preincubation control; lane 2, preincubation with 0.5 m
M
GTP; lane 3, preincubation with 0.5 m
M
CTP; lane 4,
preincubation with 0.5 m
M
ATP; lane 5, preincubation with 0.5 m
M
UTP. (C) and (D) Effect of substitution of the 3¢-terminal cytidylate with
guanidylate, adenylate or uridylate on de novo RNA synthesis. (C) (+)3¢-UTR as template. (D) (–)IRES as template. Lane 1, normal template as
control; lane 2, substitution of the 3¢ C with G; lane 3, substitution of the 3¢ C with U; lane 4, substitution of the 3¢ C with A. The relative activity

compared with the control is shown below each lane as a percentage.
4958 G H. Yi et al. (Eur. J. Biochem. 270) Ó FEBS 2003
agreement with those of Reigadas et al.[45]forhepatitisC
virus using (–)IRES as template, but differed from those of
Kao et al. [41] for BVDV with synthesized short RNA as
template, who showed that changing the 3¢-terminal C to G
did not direct any product synthesis. This indicated that
sequences and/or structures present in other parts of the
template might play an important role for efficient de novo
RNA synthesis by CSFV RdRp.
Specific interaction between CSFV RdRp and viral RNA
templates
Viral RNA synthesis requires the initiation, recognition
and specific binding between RdRp and template RNA.
The 3¢-end of several positive strand RNA viruses is
known to specifically bind to their respective RdRps
[46–50]. To determine whether purified and refolded
CSFV RdRp could specifically interact with either the
plus- or minus-strand viral RNA template, North-Western
blot assays were performed. tRNA was included in the
binding reaction mixtures to avoid any nonspecific bind-
ing. Figure 6A shows that CSFV RdRp was able to
interact with the 3¢-end of viral minus-strand RNA
template. No detectable complexes were observed when
BSA was used as a control. The specificity of the RNA–
protein interaction was confirmed by template competition
assays in which unlabelled homologous or heterologous
RNAs were preincubated with the protein for 10 min
prior to addition of the DIG-labeled RNA template. The
binding to either plus- or minus-strand RNA template

showed a concentration response, because the band
intensity decreased as the amount of unlabelled homolog-
ous RNA (cold RNA) was increased. The addition of a
50-fold molar excess of unlabelled RNA almost abolished
the interaction of protein with DIG-labeled RNA tem-
plate (Fig. 6B,C, lane 5). However, the unlabelled hetero-
logous RNA, like yeast tRNA, showed no reduction in
the intensity of the RNA–protein complexes, even at
concentrations as high as 50-fold molar excess (Fig. 6B,
lane 6). These results showed that the CSFV RdRp was
able to specifically interact with the 3¢ end of both plus-
and minus-strand viral RNA templates, and that the C
terminus of NS5B was not necessary for binding activity.
At present, we do not know whether other viral or
cellular proteins might interact with RNA templates or
RdRp to form a replication complex for initiating CSFV
RNA synthesis. In fact, the binding of cellular proteins to
the 3¢-end of RNA templates has been described for some
viruses [51,52]. Interaction of the viral proteins NS3 and
NS5 has been reported in Japanese encephalitis virus [53],
Dengue virus [54] and hepatitis C virus [55,56]. Nevertheless,
our recombinant NS5BD24 expressed in E. coli has several
properties that resemble the functional CSFV RdRp and
permit an in vitro replication system (a) it possesses RNA
polymerase activity with either plus- or minus-strand RNA
as template, (b) it contains RNA binding activity and (c) it
can initiate de novo RNA synthesis from viral RNA
templates and does not require an exogenous primer. This
in vitro replication system represents a starting point in the
search for cis-elements at the 3¢ end of RNA templates and

possibly viral or cell proteins required for the initiation of
viral RNA synthesis.
Acknowledgements
This work was supported by National Basic Research Developmental
Projects (G1999011900) and National Natural Science Foundation of
China (30170214).
References
1. Wengler, G., Bradley, D.W., Collett, M.S., Heinz, F.X., Schles-
inger, R.W. & Strauss, J.H. (1995) Family Flaviviridae.InClas-
sification and Nomenclature of Viruses: 6th Report of the
Fig. 6. Specific interaction between classical swine fever virus (CSFV) RNA-dependent RNA polymerase (RdRp) and viral RNA templates by North-
Western blot assays. Proteins were transferred to nitrocellulose membranes and renatured as described in the Materials and methods. (A) Binding
activity of NS5BD24 with (–)IRES RNA template. Lane 1, purified NS5BD24 protein; lane 2, BSA control. Specificity of NS5BD24 interaction with
(–)IRES RNA template (B) and (+)3¢-UTR template (C). Template competition assays were performed with homologous and heterologous RNAs
(cold RNA) as competitors. Increasing amounts of unlabeled RNA were preincubated with NS5BD24 for 10 min prior to the addition of DIG-
labeled RNA template. The diagram was processed using Adobe
PHOTOSHOP
. Lane 1, no competitor; lanes 2–5, competition with fivefold, 10-fold,
20-fold and 50-fold molar excesses of unlabeled homologous RNA, respectively; lane 6, competition with 50-fold heterlogous yeast tRNA.
Ó FEBS 2003 De novo RNA synthesis by CSFV RdRp (Eur. J. Biochem. 270) 4959
International Committee on Taxonomy of Viruses (Murphy, F.A.,
Fauquet, C.M., Bishop, D.H.L., Ghabrial, S.A., Jarvis, A.W.,
Martelli, G.P., Mayo, M.A. & Summers, M.D., eds), pp. 415–427.
Springer-Verlag, Berlin.
2. Thiel, H.J., Plagemann, P.G.W. & Moennig, V. (1996) Pesti-
viruses. In Fundamental Virology, 3rd edn. (Fields, B.N., Knipe,
D.M. & Howley, P.M., eds), pp. 1059–1073. Raven Press, New
York.
3. Meyers, G. & Thiel, H.J. (1996) Molecular characterization of
Pestiviruses. Adv. Virus Res. 47, 53–118.

4. Rijnbrand, R., van der Straaten, T., van Rijn, P.A., Spaan, W.J.,
Bredenbeek, P.J. (1997) Internal entry of ribosomes is directed by
the 5¢ noncoding region of classical swine fever virus and is
dependent on the presence of an RNA pseudoknot upstream of
the initiation codon. J. Virol. 71, 451–457.
5. Fletcher, S.P. & Jackson, R.J. (2002) Pestivirus internal ribosome
entry site (IRES) structure and function: elements in the 5¢
untranslated region important for IRES function. J. Virol. 76,
5024–5033.
6. Yu, H., Grassmann, C.W. & Behrens, S.E. (1999) Sequence and
structural elements at the 3¢ terminus of bovine viral diarrhea virus
genomic RNA: functional role during RNA replication. J. Virol.
73, 3638–3648.
7. Rice, C.M. (1996) Flaviviridae: The viruses and their replication. In
Fields Virology (Fields, B.N., Knipe, D.M. & Howley, P.M., eds),
pp. 931–960. Lippincott-Raven Publishers, Philadelphia.
8. Tratschin, J.D., Moser, C., Ruggli, N. & Hofmann, M.A. (1998)
Classical swine fever virus leader proteinase N
pro
is not required
for viral replication in cell culture. J. Virol. 72, 7681–7684.
9. Moser, C., Stettler, P., Tratschin, J.D. & Hofmann, M.A. (1999)
Cytopathogenic and noncytopathogenic RNA replicons of clas-
sical swine fever virus. J. Virol. 73, 7787–7794.
10. Koonin, E.V. (1991) The phylogeny of RNA-dependent RNA
polymerase of positive-strand RNA viruses. J. Gen. Virol. 72,
2197–2206.
11. Steffens, S., Thiel, H.J. & Behrens, S.E. (1999) The RNA-depen-
dent RNA polymerases of different members of the family Flavi-
viridae exhibit similar properties in vitro. J. Gen. Virol. 80, 2583–

2590.
12. Lohmann, V., Overton, H. & Bartenschlager, R. (1999) Selective
stimulation of hepatitis C virus and pestivirus NS5B RNA poly-
merase activity by GTP. J. Biol. Chem. 274, 10807–10815.
13. Xiao, M., Zhang, C.Y., Pan, Z.S., Wu, H.X. & Guo, J.Q. (2002)
Classical swine fever virus NS5B-GFP fusion protein possesses an
RNA-dependent RNA polymerase activity. Arch. Virol. 147,
1779–1787.
14. Meyers, G., Thiel, H.J. & Rumenapf, T. (1996) Classical swine
fever virus: recovery of infectious viruses from cDNA constructs
and generation of recombinant cytopathogenic defective interfer-
ing particles. J. Virol. 70, 1588–1595.
15. Moormann, R.J.M., van Gennip, H.G.P., Miedema, G.K.W.,
Hulst, M.M. & van Rijn, P.A. (1996) Infectious RNA transcribed
from an engineered full-length cDNA template of the genome of a
pestivirus. J. Virol. 70, 763–770.
16. Ruggli, N., Tratschin, J.D., Mittelholzer, C. & Hofmann, M.A.
(1996) Nucleotide sequence of classical swine fever virus strain
Alfort/187 and transcription of infectious RNA from stably
cloned full-length cDNA. J. Virol. 70, 3478–3487.
17. van Gennip, H.G., van Rijn, P.A., Widjojoatmodjo, M.N. &
Moormann, R.J.M. (1999) Recovery of infectious classical swine
fever virus (CSFV) full-length genomic cDNA clones by a swine
kidney cell line express bacteriophage T7 RNA polymerase.
J. Virol. Methods 78, 117–128.
18. Wu, H., Zhang, C., Zheng, C., Wang, J., Pan, Z., Li, L., Cao, S. &
Yi, G. (2003) Construction of cytopathic PK-15 cell model of
classical swine fever virus. Chin. Sci. Bull. 48, 887–891.
19. Widjojoatmodjo, M.N., van Gennip, H.G.P., Bouma, A., van
Rijn, P.A. & Moormann, R.J.M. (2000) Classical swine fever virus

E
rns
deletion mutants: trans-complementation and potential use as
nontransmissible. J. Virol. 74, 2973–2980.
20. Behrens, S.E., Tomei, L. & De Francesco, R. (1996) Identification
and properties of the RNA-dependent RNA polymerase of
hepatitis C virus. EMBO J. 15, 12–22.
21. Lohmann, V., Korner, F., Herian, U. & Bartenschlager, R. (1997)
Biochemical properties of hepatitis C virus NS5B RNA-dependent
RNA polymerase and identification of amino acid sequence motifs
essential for enzymatic activity. J. Virol. 71, 8416–8428.
22. De Francesco, R., Behrens, S.E., Tomei, L., Altamura, S. & Jir-
icny, J. (1996) RNA-dependent RNA polymerase of hepatitis C
virus. Methods Enzymol. 275, 58–67.
23. McGoldrick,A.,Lowings,J.P.,Ibata,G.,Sands,J.J.,Belak,S.&
Paton, D.J. (1998) A novel approach to the detection of classical
swine fever virus by RT-PCR with a fluorogenic probe (TaqMan).
J. Virol. Methods 72, 125–135.
24. Chen,Y.,Zhang,C.,Zhou,J.,Pan,Z.,Chen,L.,Li,T.&Guo,C.
(2003) Development of a fluorogenic quantitative PCR assay for
rapid quantification of hog cholera lapinized virus. Virologica Sin.
18, 124–128.
25. Yamashita,T.,Kaneko,S.,Shirota,Y.,Qin,W.,Nomura,T.,
Kobayashi, K. & Murakami, S. (1998) RNA-dependent RNA
polymerase activity of the soluble recombinant hepatitis C virus
NS5B protein truncated at the C-terminal region. J. Biol. Chem.
273, 15479–15486.
26. Ferrari, E., Wright-Minogue, J., Fang, J.W.S., Baroudy, B.M.,
Lau, J.Y.N. & Hong, Z. (1999) Characterization of soluble
hepatitis C virus RNA-dependent RNA polymerase expressed in

Escherichia coli. J. Virol. 73, 1649–1654.
27. Tomei, L., Vitale, R.L., Incitti, I., Serafini, S., Altamura, S., Vitelli,
A. & De Francesco, R. (2000) Biochemical characterization of a
hepatitis C virus RNA-dependent RNA polymerase mutant
lacking the C-terminal hydrophobic sequence. J. Gen. Virol. 81,
759–767.
28. Zhong, W., Ingravallo, P., Wright-Minogue, J., Uss, A.S., Skel-
ton, A., Ferrari, E., Lau, J.Y. & Hong, Z. (2000) RNA-dependent
RNA polymerase activity encoded by GB virus-B non-structural
protein 5B. J. Viral Hepat. 7, 335–342.
29. Lai, V.C.H., Kao, C.C., Ferrari, E., Park, J., Uss, A.S., Wright-
Minogue, J., Hong, Z. & Lau, J.Y. (1999) Mutational analysis of
bovine viral diarrhea virus RNA-dependent RNA polymerase.
J. Virol. 73, 10129–10136.
30. Triana-Alonso, F.J., Dabrowski, M., Wadzack, J. & Nierhaus,
K.H. (1995) Self-coded 3¢-extension of runoff transcripts produces
aberrant products during in vitro transcription with T7 RNA
polymerase. J. Biol. Chem. 270, 6298–6307.
31. Ranjith-Kumar, C.T., Gajewski, J., Gutshall, L., Maley, D.,
Sarisky, R.T. & Kao, C.C. (2001) Terminal nucleotidyl transferase
activity of recombinant Flaviviridae RNA-dependent RNA poly-
merases: implication for viral RNA synthesis. J. Virol. 75, 8615–
8623.
32. Wang, Q.M., Hockman, M.A., Staschke, K., Johnson, R.B., Case,
K.A., Lu, J., Parsons, S., Zhang, F., Rathnachalam, R., Kirk-
egaard, K. & Colacino, J.M. (2002) Oligomerization and
cooperative RNA synthesis activity of hepatitis C virus RNA-
dependent RNA polymerase. J. Virol. 76, 3865–3872.
33. Paul, A.V., van Boom, J.H., Filippov, D. & Wimmer, E. (1998)
Protein-primed RNA synthesis by purified poliovirus RNA

polymerase. Nature 393, 280–284.
34. Biebricher, C.K., Eigen, M. & Luce, R. (1981) Product analysis
of RNA generated de novo by Qb replicase. J. Mol. Biol. 148,
369–390.
35. Lopez Vazquez, A.L., Martin Alonso, J.M. & Parra, F. (2001)
Characterisation of the RNA-dependent RNA polymerase from
4960 G H. Yi et al. (Eur. J. Biochem. 270) Ó FEBS 2003
Rabbit hemorrhagic disease virus produced in Escherichia coli.
Arch. Virol. 146, 59–69.
36. Ackermann, M. & Padmanabhan, R. (2001) De novo synthesis of
RNA by the Dengue virus RNA-dependent RNA polymerase
exhibits temperature dependence at the initiation but not elonga-
tion phase. J. Biol. Chem. 276, 39926–39937.
37. Luo, G., Hamatake, R.K., Mathis, D.M., Racela, J., Rigat, K.L.,
Lemm, J. & Colonno, R.J. (2000) De novo initiation of RNA
synthesis by the RNA-dependent RNA polymerase (NS5B) of
hepatitis C virus. J. Virol. 74, 851–863.
38. Nagy, P.D. & Pogany, J. (2000) Partial purification and char-
acterization of Cucumber necrosis virus and Tomato bushy stunt
virus RNA-dependent RNA polymerases: similarilties and differ-
ences in template usage between tombusvirus and carmovirus
RNA-dependent RNA polymerases. Virology 276, 279–288.
39. Pellerin, C., Lefebvre, S., Little, M.J., Mckercher, G., Lamarre, D.
& Kukolj, G. (2002) Internal initiation sites of de novo RNA
synthesis within the hepatitis C virus polypyrimidine tract.
Biochem. Biophys. Res. Commun. 295, 682–688.
40. Zhong, W., Gutshall, L.L. & Del Vecchio, A.M. (1998) Identifi-
cation and characterization of an RNA-dependent RNA poly-
merase activity within the nonstructural protein 5B region of
bovine viral diarrhea virus. J. Virol. 72, 9365–9369.

41. Kao, C.C., del Vecchio, A.M. & Zhong, W. (1999) De novo
initiation of RNA synthesis by a recombinant flavivirdae RNA-
dependent RNA polymerase. Virology 253,1–7.
42. Ranjith-Kumar, C.T., Kim, Y., Gutshall, L., Silverman, C.,
Khandekar, S., Sarisky, R.T. & Kao, C.C. (2002) Mechanism of
de novo initiation by the hepatitis C virus RNA-dependent RNA
polymerase:roleofdivalentmetals.J. Virol. 76, 12513–12525.
43. Heid, C.A., Stevens, J., Livak, K.J. & Williams, P.M. (1996) Real
time quantitative PCR. Genome Res. 6, 986–994.
44. Sun, X.L., Johnson, R.B., Hockman, M.A. & Wang, Q.M. (2000)
De novo RNA synthesis catalyzed by HCV RNA-dependent RNA
polymerase. Biochem. Biophys. Res. Commun. 268, 798–803.
45. Reigadas, S., Ventura, M., Sarih-Cottin, L., Castroviejo, M.,
Litvak, S. & Astier-Gin, T. (2001) HCV RNA-dependent RNA
polymerase replicates in vitro the 3¢ terminal region of the minus-
strand viral RNA more efficiently than the 3¢ terminal region of
the plus RNA. Eur. J. Biochem. 268, 5857–5867.
46. Cui, T., Sankar, S. & Porter, A.G. (1993) Binding of encep-
helomyocarditis virus RNA polymerase to the 3¢ noncoding region
of the viral RNA is specific and requires the 3¢ poly A tail. J. Biol.
Chem. 268, 26093–26098.
47. Todd, S., Nguyen, J.H.C. & Semler, B.L. (1995) RNA–protein
interactions directed by the 3¢ end of human rhinovirus genomic
RNA. J. Virol. 69, 3605–3614.
48. Pata, J.D., Schultz, S.C. & Kirkegaard, K. (1995) Functional
oligomerization of poliovirus RNA-dependent RNA polymerase.
RNA 1, 466–477.
49. Cheng, J.C., Chang, M.F. & Chang, S.C. (1999) Specific interac-
tion between the hepatitis C virus NS5B RNA polymerase and the
3¢ end of the viral RNA. J. Virol. 73, 7044–7049.

50. Agrawal, S., Gupta, D. & Panda, S.K. (2001) The 3¢ end of
hepatitis E virus (HEV) genome binds specifically to the viral
RNA-dependent RNA polymerase (RdRp). Virology 282, 87–101.
51. Yocupicio-Monroy,R.M.,Medina,F.,Reyes-delValle,J.&del
Angel, R.M. (2003) Cellular proteins from human monocytes bind
to dengue 4 virus minus-strand 3¢untranslated region RNA.
J. Virol. 77, 3067–3076.
52. Luo, G. (1999) Cellular proteins bind to the poly (U) tract of the 3¢
untranslated region of hepatitis C virus RNA genome. Virology
256, 105–118.
53. Chen, C.J., Kuo, M.D., Chien, L.J., Hsu, S.L., Wang, Y.M. &
Lin, J.H. (1997) RNA–protein interactions: involvement of NS3,
NS5, and 3¢noncoding regions of Japanese encephalitis virus
genomic RNA. J. Virol. 71, 3466–3473.
54. Kapoor, M., Zhang, L., Ramachandra, M., Kusukawa, J., Ebner,
K.E. & Padmanabhan, R. (1995) Association between NS3 and
NS5proteinsofdenguevirustype2intheputativeRNAreplicase
is linked to differential phosphorylation of NS5. J. Biol. Chem.
270, 19100–19106.
55. Ishido, S., Fujita, T. & Hotta, H. (1998) Complex formation of
NS5B with NS3 and NS4A proteins of hepatitis C virus. Biochem.
Biophys. Res. Commun. 244, 35–40.
56. Piccininni, S., Varaklioti, A., Nardelli, M., Dave, B., Raney, K.D.
& McCarthy, J.E. (2002) Modulation of the hepatitis C virus
RNA-dependent RNA polymerase activity by the non-structural
(NS)3helicaseandtheNS4Bmembraneprotein.J. Biol. Chem.
277, 45670–45679.
Ó FEBS 2003 De novo RNA synthesis by CSFV RdRp (Eur. J. Biochem. 270) 4961