Báo cáo khoa học: The GxxxG motif of the transmembrane domain of subunit e is involved in the dimerization/oligomerization of the yeast ATP synthase complex in the mitochondrial membrane doc

The GxxxG motif of the transmembrane domain of subunit e is
involved in the dimerization/oligomerization of the yeast ATP synthase
complex in the mitochondrial membrane
Genevie
`
ve Arselin, Marie-France Giraud, Alain Dautant, Jacques Vaillier, Daniel Bre
`
thes,
Be
´
ne
´
dicte Coulary-Salin, Jacques Schaeffer and Jean Velours
Institut de Biochimie et Ge
´
ne
´
tique Cellulaires du CNRS, Universite
´
Victor Segalen, Bordeaux, France
A conserved putative dimerization GxxxG motif located in
the unique membrane-spanning segment of the ATP syn-
thase subunit e was altered in yeast both by insertion of an
alanine residue and by replacement of glycine by leucine
residues. These alterations led to the loss of subunit g and the
loss of dimeric and oligomeric forms of the yeast ATP syn-
thase. Furthermore, as in null mutants devoid of either
subunit e or subunit g, mitochondria displayed anomalous
morphologies with onion-like structures. By taking advant-
age of the presence of the endogenous cysteine 28 residue in
the wild-type subunit e, disulfide bond formation between

subunits e in intact mitochondria was found to increase the
stability of an oligomeric structure of the ATP synthase in
digitonin extracts. The data show the involvement of the
dimerization motif of subunit e in the formation of supra-
molecular structures of mitochondrial ATP synthases and
are in favour of the existence in the inner mitochondrial
membrane of associations of ATP synthases whose masses
are higher than those of ATP synthase dimers.
Keywords: ATP synthase; oligomerization; subunit e;
GxxxG motif; yeast.
The F
0
F
1
-ATP synthase is a molecular rotary motor that is
responsible for the aerobic synthesis of ATP. It exhibits a
headpiece (catalytic sector), a basepiece (membrane sector)
and two connecting stalks. The sector F
1
containing the
headpiece is a water-soluble unit retaining the ability to
hydrolyse ATP when in a soluble form. F
0
is embedded in
the membrane and is mainly composed of hydrophobic
subunits forming a specific proton conducting pathway.
When the F
1
and F
0

sectors are coupled, the enzyme
functions as a reversible H
+
-transporting ATPase or ATP
synthase [1–4]. The two connecting stalks are constituted of
components from F
1
and F
0
. The central stalk is a part
of the rotor of the enzyme. The second stalk, which is part
of the stator, connects F
1
and hydrophobic membranous
components of the enzyme. High resolution X-ray crystal-
lographic data have led to solving the structure of the F
1
[5–8] from different sources. Stock et al. [9] reported
the 3.9 A
˚
resolution X-ray diffraction structure of the
Saccharomyces cerevisiae F
1
associated with the c
10
-ring
oligomer.
In Escherichia coli,F
0
is composed of subunits a, b and c

only. The mitochondrial F
0
of mammals is composed of 10
different subunits [10]. The same 10 components have been
identifiedintheS. cerevisiae enzyme [11–13]. It has been
shown that the yeast ATP synthase exists as dimeric and
oligomeric forms in Triton X-100 and digitonin extracts and
that the subunits of F
0
, e, g and 4(b) are essential for such a
process [12,14,15]. In addition, the existence of the dimeric
form in the inner mitochondrial membrane has been
recently demonstrated [16].
Under its mature form, the yeast subunit e is composed of
95 amino-acid residues and displays a mass of 10 744 Da. It
is an integral membrane protein anchored to the inner
mitochondrial membrane by its unique membrane-spanning
segment at its N-terminus, and which adopts, such as the
mammalian ATP synthase subunit e, an N
in
–C
out
topology
[11,17]. A stoichiometry of 2 mol of subunit e per mol of rat
liver ATP synthase has been estimated [18]. In mammals,
expression of the gene encoding subunit e is regulated in
tissues and cells in response to physiological stimuli, thus
suggesting that subunit e plays a regulatory role in the ATP
synthase [19–21]. In yeast, subunit e is involved in the
dimerization/oligomerization of ATP synthases, prob-

ably in association with subunit g [12]. Surprisingly,
mutant mitochondria devoid of either subunits e or g were
found to have numerous digitations and onion-like struc-
tures, thus suggesting a link between dimerization/oligo-
merization of the ATP synthase and cristae morphology
[14,15].
The purpose of the present work was to provide
information on the involvement of subunit e in the
dimerization/oligomerization of yeast ATP synthases in
the inner mitochondrial membrane. Mutations were intro-
duced into a putative membranous dimerization motif
Correspondence to J. Velours, Institut de Biochimie et Ge
´
ne
´
tique
Cellulaires du CNRS, UMR 5095, Universite
´
Victor Segalen,
Bordeaux 2, 1, rue Camille Saint Sae
¨
ns,
33077 Bordeaux cedex, France.
Fax: + 33 5 56999051, Tel.: + 33 5 56999048,
E-mail:
Abbreviations: BN/PAGE, blue native polyacrylamide slab gel
electrophoresis; F
0
and F
1

, integral membrane and peripheral portions
of ATP synthase; NEM, N-ethylmaleimide.
(Received 3 February 2003, revised 3 March 2003,
accepted 5 March 2003)
Eur. J. Biochem. 270, 1875–1884 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03557.x
GxxxG of subunit e. We demonstrate that such a motif is
involved in both the edification of supramolecular ATP
synthase species and in correct mitochondrial morphology.
In addition, cross-linking experiments involving the endo-
genous Cys28 residue of subunit e provided data in favour
of the oligomerization of the yeast ATP synthase in the
mitochondrial membrane.
Experimental procedures
Materials
Digitonin was from Sigma. Oligonucleotides were pur-
chased from MWG-BIOTECH. All other reagents were of
reagent grade quality.
Yeast strains and nucleic acid techniques
The Saccharomyces cerevisiae strain D273–10B/A/H/U
(MATa, met6, ura3, his3) [22] was the wild-type strain.
The null mutant DTIM11 was constructed by a PCR-based
mutagenesis and the kan
r
gene was removed [23]. The
mutations 19A, G15L, G19L and C28S were introduced by
a PCR mutagenesis procedure [24] into a plasmid pRS313
bearing an insert encoding the wild TIM11 gene and the
kan
r
gene. The strains containing modified versions of

subunit e were obtained by integration of the mutated
versions of TIM11 gene at the chromosomic locus in the
deleted-disrupted yeast strain and were selected for their
resistance to Geneticin. The yeast mutants with a point
mutation were named as (name of the subunit)(wild-type
residue)(residue number)(mutant residue). The strain con-
taining the subunit e(His)
6
was constructed according to the
following strategy. Two partially complementary oligo-
nucleotides 5¢-CGCGGAATTCTTAGTGATGGTGATG
GTGATGTGTTGAAGCTTCCTTCAGGG-3¢ and 5¢-CAT
CACCATCACCATCACTAAGAATTCCGCGATAGAA
GCTTCAACATAAATAGGATACTA-3¢ were used to
introduce the (His)
6
sequence into the C-terminus of subunit
e by the PCR mutagenesis procedure.
Biochemical procedures
Cells were grown aerobically at 28 °C in a complete liquid
medium containing 2% lactate as carbon source [25] and
harvested in logarithmic growth phase. The rho
–
cell
production in cultures was measured on glycerol plates
supplemented with 0.1% glucose. Mitochondria were
prepared from protoplasts as previously described [26]
Protein amounts were determined according to Lowry et al.
[27] in the presence of 5% SDS using bovine serum albumin
as standard. Oxygen consumption rates were measured with

NADH as substrate [28]. Phosphorylation rate was mea-
sured in the respiratory buffer supplemented with 1 m
M
ADP by ATP formation measured by a bioluminescence
technique [29]. ATP synthesis rate and oxygen consumption
rate were measured at the same time in the oxygraph
chamber. All reactions were stopped by adding an aliquot of
the medium to perchloric acid. The ATP/O ratio stoichio-
metries were determined from the yield of ATP synthesis
rate vs. state 3 respiratory rate [30]. The ATPase activity was
measured at pH 8.4 [31].
Cross-linking experiments
Mitochondria isolated from wild-type and mutant cells were
washed by centrifugation in 0.6
M
mannitol, 50 m
M
Hepes
pH 7.4 containing 0.25 m
M
of phenylmethylsulfonyl fluo-
ride. The pellet was suspended at a protein concentration of
5mgÆmL
)1
in 0.1
M
mannitol, 50 m
M
Hepes pH 7.4
containing either 5 m

M
of EDTA and 5 m
M
of N-ethyl-
maleimide (NEM) for the control experiment or 2 m
M
CuCl
2
for the cross-linking experiment. Incubation was
perfomed at 4 °C for 30 min. The reaction was stopped
upon addition of 5 m
M
EDTA and 5 m
M
of NEM.
Mitochondrial membranes were then dissociated in the
presence of 20 m
M
of NEM for SDS/gel electrophoresis and
Western blot analysis. For BN/PAGE analyses of cross-
linked products, mitochondrial membranes were centri-
fuged at 10 000 g for 10 min at 4 °C after incubation with
either 5 m
M
of NEM or 2 m
M
of CuCl
2
, Then, the digitonin
solution containing 5 m

M
NEM was added to the mito-
chondrial pellet to extract the ATP synthases.
Electrophoretic and Western blot analyses
SDS-gel electrophoresis was performed as described in [32,]
Western blot analyses were described previously [33].
Nitrocellulose membranes (Membrane Protean BA83,
0.2 lm from Schleicher & Schuell) were used. Polyclonal
antibodies against subunits e and g were raised against
amino-acid residues 69–82 and 31–45, respectively. Anti-
bodies against subunits e, g and i were used with dilutions of
1 : 10 000. Membranes were incubated with peroxidase-
labeled antibodies and visualized with the ECL reagent of
Amersham Pharmacia Biotech. Molecular mass markers
(Benchmark Prestained Protein Ladder) were from Invitro-
gen. BN/PAGE experiments were performed as described
previously [34,35]. Mitochondria (1 mg of protein) were
incubated for 30 min at 4 °C with 0.1 mL of digitonin
solution with the indicated digitonin/protein ratio. The
extracts were centrifuged at 4 °C for 15 min at 40 000 g and
aliquots (40 lL) were loaded on the top of a 3–13%
polyacrylamide slab gel. After electrophoresis the gel was
incubated in a solution of 5 m
M
ATP, 5 m
M
MgCl
2
, 0.05%
lead acetate, 50 m

M
glycine/NaOH pH 8.4 to reveal the
ATPase activity [36,37].
Ultrastructural studies
Freezing and freeze-substitution of yeast cell pellets were
performed as previously described [14].
Results
Presence of a dimerization motif in the
membrane-spanning segment of subunit e
The supernumerary subunit e is a component of the
mitochondrial ATP synthase which is involved in the
dimerization of ATP synthase [11,12]. Subunit e has been
identified in many organisms. The multiple alignment of
subunits e of different sources shows that five amino-acid
residues are fully conserved (Fig. 1). These are Arg8, Ser10,
Leu12, Gly15 and Gly19. The five conserved amino-acid
1876 G. Arselin et al. (Eur. J. Biochem. 270) Ó FEBS 2003
residues lay in a domain predicted to be a membrane-
spanning segment beginning with Asn5 and ending at
Leu26. Subunit e has an N
in
–C
out
orientation [11,17] which
exposes the main part of the subunit to the intermembrane
space, with the unique cysteine residue (Cys28) at the
frontier between the membrane and the intermembrane
space. The predicted membrane-spanning segment of sub-
unit e displays the dimerization motif GxxxG of glyco-
phorin A [38,39] at position Gly-Leu-Phe-Phe-Gly(15–19).

The highly conserved Gly15 and Gly19 suggested their
involvement in a transmembrane helix–helix interaction. To
address whether the GxxxG motif and the two glycine
residues are critical in a dimerization process which could be
the basis of the dimerization/oligomerization of mito-
chondrial ATP synthases, three mutants were constructed.
An alanine residue was inserted after Phe18 in order to
disrupt a helix–helix packing interface involving the amino-
acid residues on both sides of the insertion [40]. In the other
two mutants, the small amino-acid residues Gly15 and
Gly19 were replaced by leucine residues.
Phenotypic analyses of mutant strains and oxidative
phosphorylation properties of isolated mitochondria are
reported in Table 1. The three mutants displayed a slight
increase in the doubling time with lactate as carbon source.
An interesting point was the low amount of rho
–
cells in
cultures in comparison with the null mutant DTIM11,
which is devoid of subunit e. From these data, there appears
to be a correlation between the increase in spontaneous rho
–
cell conversion (rho
–
cells are unable to grow with lactate as
carbon source) and the increase in the generation time of
yeast strains. The ATPase activity of mutant mitochondria
displayed a low sensitivity toward the F
0
inhibitor oligo-

mycin, thus showing a decreased stability of F
0
under the
experimental conditions of ATPase activity measurements
(pH 8.4 and Triton X-100). In contrast, under oxidative
phosphorylation conditions, the ATP/O ratio value of e19A
mitochondria indicated that the efficiency of the oxidative
phosphorylation machinery was not altered, as in mutants
devoid of either subunits e or g [14].
Loss of dimerization/oligomerization of e19A, eG15L
and eG19L ATP synthases
We next sought whether the mutations in the dimerization
motif of subunit e affected the dimerization/oligomerization
of the ATP synthases. Therefore, the presence of
Table 1. Phenotypic analysis of yeast strains used. Yeast cells were grown at 28 °C on complete medium containing lactate as carbon source. rho–
production was measured on glycerol plates supplemented with 0.1% glucose. Mitochondria were prepared from protoplasts. ATPase activities and
the sensitivity to oligomycin (6 lgÆmL
)1
) were measured at pH 8.4 in the presence of Triton X-100 to remove the F
1
inhibitor. ATP/O ratios were
determined with NADH as substrate. ND, not determined.
Strains
Doubling
time
(min)
Rho
–
cells in
cultures

(%)
ATPase activity
ATP/O
lmol PiÆmin
)1
Æmg protein
)1
Inhibition– Oligomycin + Oligomycin
Wild-type 161 0.9 5.26 ± 0.31 0.31 ± 0.05 94 1.09 ± 0.13
DTIM11 229 41.0 5.79 ± 0.29 2.99 ± 0.03 48 0.89 ± 0.03
e19A 190 1.6 4.05 ± 0.16 1.01 ± 0.6 75 1.05 ± 0.07
eG15L 210 11.2 4.68 ± 0.22 2.90 ± 0.23 38 ND
eG19L 192 7.5 4.66 ± 0.02 2.83 ± 0.24 39 ND
Fig. 1. Multiple alignment of subunits e from
different sources. The conserved amino-acid
residues between subunits e from human
(H. s.) (P56385, Swiss-Prot), pig (S. s.)
(Q06185, Swiss-Prot), bovine (B. t.) (Q00361,
Swiss-Prot), hamster (C. l.) (P12633, Swiss-
Prot), mouse (M. m.) (Q06185, Swiss-Prot),
rat (R. n.) (P29419, Swiss-Prot), Drosophila
(D. m.) (AY060656, GenBank), Neurospora
crassa (N. c., AW710731, GenBank), Botryo-
tinia fuckelians (B. f., AL111090, EMBL) and
Saccharomyces cerevisiae (P81449, Swiss-Prot)
are in bold. The numbering of the yeast sub-
unit e begins at the initiating methionine. The
star indicates the position of the unique cys-
teine residue of the yeast subunit e (position
28). The putative transmembrane segment of

subunit e (TM) is boxed.
Ó FEBS 2003 Supramolecular species of ATP synthase (Eur. J. Biochem. 270) 1877
supramolecular species of the ATP synthase in the mito-
chondrial digitonin extracts of mutant strains was examined
by BN/PAGE. The digitonin extracts were loaded on a 3–
13% acrylamide slab gel and the mitochondrial complexes
were separated under native conditions. The gel was
incubated with ATP-Mg
2+
and Pb
2+
to reveal the ATPase
activity (Fig. 2). The wild-type digitonin extracts contained
the dimeric and oligomeric forms of the enzyme that were
destabilized upon increasing the digitonin-to-protein ratio,
as shown previously [14]. The mitochondrial digitonin
extracts of mutant strains did not display any oligomeric
forms of the ATP synthase. Whatever the digitonin-to-
protein ratio used, the monomeric form of the enzyme was
predominant, although a small amount of dimeric form was
found, as already observed for null mutants devoid of either
subunit e or subunit g [14,15].
It was previously shown that in the absence of subunit e,
subunit g is not present in mitochondrial membranes [12].
As a consequence, the presence of both subunits in strains
mutated in subunit e was checked by Western blot analyses
of SDS-solubilized mitochondrial membranes. Despite the
presence of altered subunits e, the amount of subunit g was
highly decreased in e19A mitochondrial membranes and the
subunit was not detectable in eG15L and eG19L mito-

chondrial membranes (Fig. 3).
The e19A, eG15L and eG19L mutants are defective
in the mitochondrial morphology
It has been previously reported that the null mutants in
either TIM11 or ATP20 genes have anomalous mitochon-
drial morphologies [14,15]. Thus, transmission electron
microscopy of yeast cell sections was performed to examine
the effect of mutations in the dimerization motif of subunit e
on the ultrastructure of mitochondria. Figure 4 shows that
cells of e19A, eG15L and eG19L strains had abnormal
mitochondria such as onion-like structures similar to those
observed in mutant cells devoid of either subunits e or g.
The subunit e of the e19A mutant dimerizes
spontaneously via Cys28 in a form which is loosely
or not associated to the yeast ATP synthase
To gain more insight into the behaviour of mutant subunits e,
Western blot analyses of SDS-dissociated wild-type and
mutant mitochondria were performed. Figure 3 shows that
polyclonal antibodies against subunit e revealed the pre-
sence of subunit e and a 21.4-kDa band in e19A, eG15L and
eG19L mutant mitochondria. The 21.4-kDa band was
observed upon oxidation of wild-type mitochondria with
CuCl
2
(Fig. 5A) but it was absent in a mutant devoid of
Cys28 (not shown), thus indicating the involvement of
Cys28 in the formation of the adduct. The 21.4-kDa band
corresponded to a homodimer of subunit e resulting from
the formation of a disulfide bond between two subunits e.
This result was obtained upon incubation with CuCl

2
of
wild-type mitochondria complemented with a pRS313
shuttle vector bearing a gene encoding a subunit e having
a(His)
6
sequence at its C-terminus (wild-type + eHis
6
). In
this case, Western blot analysis of CuCl
2
-treated mitochon-
dria displayed three bands in the 21.4-kDa region which
could be attributed to e + e, e + eHis
6
and eHis
6
+eHis
6
dimers because of their respective apparent molecular
masses (Fig. 5A). This result is in full agreement with that
of Brunner et al.[41].
Despite the presence of NEM during solubilization of
mutant mitochondria by SDS, the amount of e + e dimer
was large in mutant mitochondria (Fig. 3), whereas wild-
type mitochondria did not display such a dimer, thus
showing that pre-existing e + e dimers were present in
mutant mitochondrial membranes. It was possible
to increase considerably the e + e dimer formation by
oxidation with CuCl

2
. As shown in Fig. 5B, incubation of
intact mutant mitochondria with CuCl
2
ledtonearlyfull
Fig. 2. Lack of dimerization/oligomerization of the yeast ATP synthase
upon alteration of the GxxxG dimerization motif of subunit e. Mito-
chondria were isolated from wild-type, e19A, eG15L and eG19L
strains. Digitonin extracts were obtained with the indicated digitonin/
protein ratios and analysed by BN/PAGE. The gels were incubated
with ATP-Mg
2+
and Pb
2+
to reveal ATPase activity.
Fig. 3. Mitochondria isolated from e19A, eG15L and eG19L strains are
deficient in subunit g. Mitochondria isolated from wild-type (lane 1),
e19A (line 2), eG15L (lane 3) and eG19L (lane 4) were treated with
NEM as described in the Material and methods section to prevent
disulfide bond formation during the dissociation with SDS. Aliquots
(30 lg of protein) were analysed by Western blot. The blots were
incubated either with antibodies raised against subunits e and i or with
antibodies raised against subunits g and i.
1878 G. Arselin et al. (Eur. J. Biochem. 270) Ó FEBS 2003
conversion of mutant subunits e into the dimeric form. This
was not the case with wild-type mitochondria, as densito-
metric analyses revealed that 45 ± 8% (mean of five
experiments) of wild-type subunit e led to the dimeric form
in the presence of CuCl
2

. This result reflected a different
behaviour of mutant and wild-type subunits e, thus
suggesting different relationships between subunit e and
the other F
0
components of wild-type and mutant ATP
synthases. To verify this point, BN/PAGE analyses were
performed with mitochondrial digitonin extracts obtained
with a digitonin-to-protein ratio of 0.75 gÆg
)1
(Fig. 6).
Under these conditions, the wild-type ATP synthase
displayed only dimeric and oligomeric forms in BN/PAGE
analysis [14]. After migration, the slices of gel were cut and
submitted to an SDS/gel electrophoresis in the second
dimension. The proteins were transferred onto a nitro-
cellulose membrane which was probed with polyclonal
antibodies directed against subunit e. Polyclonal antibodies
directed against subunit i were also used as control to detect
the position of the different forms of ATP synthases, as
subunit i is strongly associated to the yeast enzyme at a
digitonin-to-protein ratio of 0.75 gÆg
)1
.WhenNEM-treated
or copper-treated wild-type mitochondria were solubilized
with digitonin, subunits e and i comigrated with the dimeric
and oligomeric forms of the ATP synthase during native
electrophoresis (Figs 6A,B). However, the e + e dimer,
which resulted from the incubation of wild-type mitochon-
dria with CuCl

2
, was found in the oligomeric form of the
ATP synthase but not in the dimeric form. The subunit e
and the dimer of subunit e of NEM- and copper-treated
e19A mitochondria were observed mainly at a position
corresponding to the front of the native gel (right side of the
SDS-gel electrophoresis) (Fig. 6D). However, upon oxida-
tion of e19A mitochondria, a faint amount of e + e dimer
was also observed at molecular masses higher than that of
the remaining dimeric form of the ATP synthase (Fig. 6D).
Owing to the destabilization of supramolecular ATP
synthase forms of e19A mitochondria, a continuous band
of subunit i was observed stretching from the top of the
native gel to the position of the monomeric form of
the enzyme. From these data, it was concluded that the
mutation e19A altered the relationship between subunit e
and the other F
0
components of the ATP synthase and that
under the experimental conditions used, subunit e was
highly dissociated from the mutant enzyme.
Subunit e is involved in the oligomerization
of the yeast ATP synthase
An interesting result shown in Fig. 6 is the presence of
e + e dimers in the oligomeric forms of the wild-type ATP
synthase upon incubation of wild-type mitochondria with
CuCl
2
, thus suggesting that subunits e participate in an
interface allowing ATP synthase oligomers to exist. To test

this hypothesis, wild-type and eC28S mitochondria were
incubated either in the presence or absence of CuCl
2
.BN/
PAGE analyses of digitonin extracts (Fig. 7A) revealed the
presence of the oligomeric form of the CuCl
2
-treated wild-
type ATP synthase migrating at an acrylamide concentra-
tion of 4.8%, despite a digitonin-to-protein ratio of 2 gÆg
)1
,
i.e. conditions which highly destabilize the oligomeric forms
of wild-type mitochondria. With the same digitonin-
to-protein ratio of 2 gÆg
)1
, the eC28S extract did not display
this oligomeric form. This result indicates an increased
stabilization of the wild-type oligomeric form by the
disulfide bond formation between two subunits e. The
monomeric, dimeric and oligomeric forms of ATP synthase
Fig. 4. Mitochondria isolated from e19A, eG15L and eG19L strains are
defective in mitochondrial morphology. Transmission electron micro-
scopy of yeast cell sections of e19A (A), eG15L (B) and eG19L (C)
strains. m, mitochondria. The bar indicates 0.5 lm.
Ó FEBS 2003 Supramolecular species of ATP synthase (Eur. J. Biochem. 270) 1879
of CuCl
2
-treated wild-type mitochondria extracted with a
digitonin-to-protein ratio of 2 gÆg

)1
were cut from the BN/
PAGE slab and the proteins they contained were separated
by SDS-gel electrophoresis. The gel was transferred to a
nitrocellulose sheet which was probed with polyclonal
antibodies raised against subunits i and e (Fig. 7B). An
intense band corresponding to the e + e dimer was found
only in the oligomeric form of the ATP synthase as in
Fig. 6B, whereas the monomeric subunit e was present only
in the dimeric forms. As described in [12], subunit e was
absent from the monomeric form of the yeast ATP
synthase. In control experiments, incubation of wild-type
digitonin extracts (digitonin-to-protein ratio of 2 gÆg
)1
)with
CuCl
2
did not promote oligomer formation and in addition,
the CuCl
2
-treated eC28S mitochondria extracted with either
a digitonin-to-protein ratio of 0.75 or 2 gÆg
)1
displayed only
the monomer of subunit e in the oligomeric and dimeric
forms of the yeast ATP synthase (not shown).
Discussion
Yeast mutants altered in the dimerization motif
of subunit e are devoid of subunit g and ATP synthases
neither dimerize nor oligomerize

The subunits e, g and 4 are three components of the yeast
ATP synthase F
0
which are involved in the dimerization/
oligomerization of ATP synthases. The purpose of the
present paper was to provide information on the involve-
ment of a putative dimerization motif located in the
membranous domain of subunit e in the dimerization/
oligomerization of yeast ATP synthases. From the analysis
of yeast mutants altered in this motif, we show that this
conserved dimerization motif of subunit e has an essential
role in the cohesion of an interface between ATP synthases,
as shown by BN/PAGE analysis. However, subunit e was
still present in mutant mitochondria, as shown by Western
blot analysis of whole mitochondrial membranes, but
subunit e was loosely or not bound to the ATP synthase,
as observed by SDS/gel electrophoresis followed by Western
blot analysis of the mitochondrial digitonin extracts separ-
ated by electrophoresis under native conditions. This result
indicates an alteration of the relationships between subunit e
and other F
0
components. For instance, an interesting point
was the absence of subunit g, a small hydrophobic protein
of F
0
, which has been identified as a near neighbour of
subunit e in bovine submitochondrial particles [17]. It has
also been shown that in the absence of subunit e, subunit g is
not present in mitochondria whereas the absence of subunit

g in the null mutant DATP20 does not preclude the presence
of subunit e. The lack of subunit g has also been described in
a mutant devoid of the first membrane-spanning segment of
subunit 4, whereas subunit e was still present. On the basis
of cross-linking data, the absence of subunit g in the latter
mutant was attributed to the loss of interaction between
subunits 4 and g at their membranous levels [15]. Taken
together, these observations indicate (a) a close relationship
of subunits e, g and 4 in the membranous F
0
domain and (b)
that subunit g is a very unstable protein which disappears
from the ATP synthase upon alterations of either subunits e
Fig. 5. Oxidation of cysteine 28 promoted the
dimerization of subunit e of wild type and
mutant mitochondria. (A) Mitochondria iso-
lated from wild-type, eHis
6
cells and wild-
type cells complemented with the plasmid
pRS313 encoding eHis
6
(wild-type + eHis
6
)
were incubated in the presence or absence of
CuCl
2
as described in the experimental pro-
cedure. The control experiment (in the

absence of CuCl
2
) was performed in the
presence of NEM instead of CuCl
2
.(B)Mito-
chondria isolated from wild-type, e19A,
eG15L and eG19L strains were incubated in
the presence or absence of CuCl
2
. The control
experiment (in the absence of CuCl
2
)was
performed in the presence of NEM instead of
CuCl
2
. Cross-linking conditions are described
in the experimental procedure. After dissoci-
ation of samples with SDS in the presence of
20 m
M
of NEM, aliquots (30 lgofprotein)
were analysed by Western blot. The blots were
incubated with polyclonal antibodies raised
against subunit e.
1880 G. Arselin et al. (Eur. J. Biochem. 270) Ó FEBS 2003
or 4. This has two consequences; the loss of dimerization/
oligomerization of ATP synthases as revealed by BN/
PAGE analysis and the presence of anomalous mitochon-

dria with onion-like structures. This underlines the relation-
ship between the dimerization/oligomerization of the
mitochondrial ATP synthase and the yeast mitochondrial
morphology, a point which has been reported in previous
papers [14,15]. As the above phenotypes have a common
feature, i.e. the absence of subunit g, we propose that by its
presence, subunit g exerts a central role in the interfaces
allowing the dimerization/oligomerization of the yeast ATP
synthases. This role and these interfaces will be more
precisely studied by site-directed mutagenesis of the ATP20
gene encoding subunit g to identify the interaction domains
between subunit g and subunits e and 4.
The oligomeric forms of the yeast ATP synthase
in the inner mitochondrial membrane
The unique cysteine residue of the wild-type subunit e,
which is located in the intermembrane space, is an accessible
target to chemical reagents that allows the environmental
study of this subunit in the inner mitochondrial membrane.
Western blot analysis of proteins separated by SDS-gel
electrophoresis originating from native complexes separated
by BN/PAGE allowed us to examine the behaviour of
subunit e in the different forms of the yeast ATP synthase
extracted by digitonin (at a digitonin-to-protein ratio of
0.75 gÆg
)1
). The dimeric and oligomeric forms of ATP
synthase of NEM-treated wild-type mitochondria contained
only monomeric subunit e. In contrast, CuCl
2
incubation of

wild-type mitochondria led to the formation of the e + e
dimer that was found only in the oligomeric form of the
yeast ATP synthase migrating at an acrylamide concentra-
tion of 4.8%, i.e. at an apparent molecular mass which
corresponds to at least a tetrameric form of the enzyme [14].
In addition, while a digitonin-to-protein ratio of 2 gÆg
)1
destabilized the oligomeric forms of the enzyme, the
disulfide bond formation between two subunits e via the
Cys28 residues increased the stability of the oligomeric form
migrating at an acrylamide concentration of 4.8%. The
existence of supramolecular structures of the yeast ATP
synthase in Triton X-100 and digitonin extracts and in the
inner mitochondrial membrane has been well documented.
Biochemical evidence has shown that the dimeric forms of
the yeast ATP synthase are not due to the aggregation of the
monomeric form of the enzyme as (a) dimerization and
oligomerization of the ATP synthase are dependent on the
Fig. 6. Upon oxidation, the subunit e dimer of e19A mitochondria was loosely associated with the ATP synthase, whereas the subunit e dimer of wild-
type mitochondria was associated only with the oligomeric forms of the wild-type enzyme. Wild-type and e19A mitochondria were incubated either
with NEM or with CuCl
2
as described above. Mitochondrial digitonin extracts were obtained with a digitonin-to-protein ratio of 0.75 gÆg
)1
and
analysed by BN/PAGE. A part of the gel was revealed by the ATPase activity and slices of the BN/PAGE are shown on the top of each figure (first
dimension). Corresponding slices were cut, incubated with 1% SDS and submitted to SDS/gel electrophoresis (second dimension). The proteins of
the gel were transferred onto a nitrocellulose membrane, which was probed with polyclonal antibodies raised against subunits e and i. NEM-treated
wild-type (A) and NEM-treated e19A (C) mitochondria (control experiments). CuCl
2

-treated wild-type (B) and CuCl
2
-treated e19A (D) mito-
chondria.
Ó FEBS 2003 Supramolecular species of ATP synthase (Eur. J. Biochem. 270) 1881
presence of subunits e, g and the first membrane-spanning
segment of the b-subunit (subunit 4) and (b) inter-ATP
synthase cross-linking with a bis-maleimide reagent and
involving a cysteine residue introduced into the C-terminal
part of subunit i located in the intermembrane space has
been reported both in detergent extracts which preserve the
dimeric form of the ATP synthase and in intact mitochon-
dria, thus showing the existence of such dimers in the inner
mitochondrial membrane [16]. Whether oligomeric forms of
the ATP synthase exist in the inner mitochondrial mem-
brane is still a matter of discussion. Using freeze-fracturing,
deep-etching and replicates, Allen et al.[42]showedthe
presence of double rows of ATP synthases on cristae of
Paramecium multimicronucleatum mitochondria. Subse-
quently, Allen proposed a model that described the
association of ATP synthase dimers as generating the
tubular cristae [43]. In yeast, oligomeric forms of ATP
synthase have been found in mitochondrial digitonin
extracts obtained with digitonin-to-protein ratios of 0.75–
1gÆg
)1
, but they were absent at higher ratios. However, by
the formation of disulfide bonds between subunits e in intact
wild type mitochondria, we have now found that it is
possible to increase slightly the stability of an oligomeric

form of the ATP synthase in digitonin extracts. The
association of ATP synthases in supramolecular structures
higher than dimeric forms by oxidation could result from
the Brownian lateral diffusion of proteins in the inner
mitochondrial membrane. However (a) the experiments
were performed at 4 °C to decrease the diffusion, (b) no
other cross-links between the ATP synthase and other
mitochondrial complexes have been identified and (c) these
oligomeric structures exist without cross-linking in mito-
chondrial digitonin extracts. Therefore, we consider that
these data are in favour of the existence in the inner
mitochondrial membrane of oligomeric forms such as those
observed by Allen et al. [42]. Such oligomeric forms of ATP
synthase imply the existence of two different interfaces
between ATP synthase monomers. On the basis of cross-
linking data on mitochondrial membranes [44], it was
proposed that two subunits 4 belonging to two neighbour-
ing ATP synthases participate at one interface [14]. The
second interface involves subunits e and g [12] and it appears
from the above data that the dimerization motif in subunit e
is essential for the stability of this interface.
Subunits e have different environments
While oxidation of mutant mitochondria led to nearly full
conversion of altered subunit e under a dimeric form, only
50% of wild type subunit e was converted under its dimeric
form in the presence of CuCl
2
. On the other hand, whatever
the digitonin-to-protein ratio used, the e + e dimer was
only found in wild type ATP synthase oligomer upon

oxidation, whereas the monomeric form of subunit e was
associated with both oligomeric and dimeric forms of the
enzyme at a digitonin-to-protein ratio of 0.75 gÆg
)1
.Witha
digitonin-to-protein ratio of 2 gÆg
)1
, which destabilizes the
ATP synthase oligomers, the monomeric form of subunit e
was removed, while an e + e dimer was still present in the
CuCl
2
-induced ATP synthase oligomer. As a stoichiometry
of two subunits e has been established in rat ATP synthase,
it appears that the two subunits e of each wild type enzyme
react differently and thus likely have different environment
in F
0
. It has not yet been established whether the dimeri-
zation motif of subunit e mediates homodimer formation
between subunits e of each enzyme or between subunits e of
two interacting enzymes or heterodimer formation with
another component of F
0
in the wild type ATP synthase.
The combination of BN/PAGE, SDS-gel electrophoresis
of isolated supramolecular complexes and cross-linking
Fig. 7. The disulfide bond formation between two subunits e stabilizes an
oligomeric form of the yeast ATP synthase. Mitochondria isolated from
wild-type and eC28S cells were incubated in the absence or in the

presence of CuCl
2
. (A) Digitonin extracts obtained with the indicated
digitonin-to-protein ratios were submitted to BN/PAGE. The gel was
incubated with ATP-Mg
2+
and Pb
2+
to reveal the ATPase activity.
NEMwasaddedinthecontrolexperimentsinsteadofCuCl
2
.(B)
Mitochondria isolated from wild-type cells were incubated with CuCl
2
and solubilized with a digitonin-to-protein ratio of 2 gÆg
)1
. After BN/
PAGE analysis the bands were revealed by the ATPase activity. The
oligomeric form (lane 1), the high band (lane 2), the low band (lane 3)
of the dimeric forms and the monomeric form (lane 4) of the ATP
synthase were cut and submitted to SDS-gel electrophoresis. The slab
gel was transferred onto nitrocellulose which was probed with poly-
clonal antibodies against subunits i and e. T, acrylamide concentration.
1882 G. Arselin et al. (Eur. J. Biochem. 270) Ó FEBS 2003
experiments with engineered targets in subunits e, g and 4
will allow the identification of contact areas of the different
partners involved in the interfaces between ATP synthases.
Acknowledgements
We are grateful to Drs C. Napias and R. Cooke for their contribution to
the editing of the manuscript. This research was supported by the Centre

National de la Recherche Scientifique (Programme Dynamique et
Re
´
activite
´
des Assemblages Biologiques), the Universite
´
Victor Segalen,
Bordeaux 2 and the Etablissement Public Re
´
gional d’Aquitaine.
References
1. Fillingame, R.H. (1999) Molecular rotary motors. Science 286,
1687–1688.
2. Pedersen, P.L., Ko, Y.H. & Hong, S. (2000) ATP synthases in the
year 2000: evolving views about the structures of these remarkable
enzyme complexes. J. Bioenerg. Biomembr. 32, 325–332.
3. Stock, D., Gibbons, C., Arechaga, I., Leslie, A.G.W. & Walker,
J.E. (2000) The rotary mechanism of ATP synthase. Curr. Opin.
Struct. Biol. 10, 672–679.
4. Senior, A.E., Nadanaciva, S. & Weber, J. (2002) The molecular
mechanism of ATP synthesis by F(1)F(0)-ATP synthase. Biochim.
Biophys. Acta 1553, 188–211.
5. Abrahams, J.P., Leslie, A.G.W., Lutter, R. & Walker, J.E. (1994)
Structure at 2.8 angstrom resolution of F-1-ATPase from bovine
heart mitochondria. Nature 370, 621–628.
6. Bianchet, M.A., Hullihen, J., Pedersen, P.L. & Amzel, L.M. (1998)
The 2.8-angstrom structure of rat liver F-1-ATPase: configuration
of a critical intermediate in ATP synthesis/hydrolysis. Proc. Natl
Acad. Sci. USA 95, 11065–11070.

7. Hausrath, A.C., Gru
¨
ber, G., Matthews, B.W. & Capaldi, R.A.
(1999) Structural features of the gamma subunit of the Escherichia
coli F-1 ATPase revealed by a 4.4-angstrom resolution map
obtained by x-ray crystallography. Proc. Natl Acad. Sci. USA 96,
13697–13702.
8. Gibbons, C., Montgomery, M.G., Leslie, A.G.W. & Walker, J.E.
(2000) Thestructure of the central stalk in bovine F1-ATPase at
2.4 A
˚
resolution. Nat. Struct. Biol. 7, 1055–1061.
9. Stock, D., Leslie, A.G.W. & Walker, J.E. (1999) Molecular
architecture of the rotary motor in ATP synthase. Science 286,
1700–1705.
10. Collinson, I.R., Runswick, M.J., Buchanan, S.K., Fearnley, I.M.,
Skehel, J.M., van Raaij, M.J., Griffiths, D.E. & Walker, J.E.
(1994) Fo membrane domain of ATPsynthase from bovine heart
mitochondria: purification, subunit composition, andreconstitu-
tion with F1-ATPase. Biochemistry 33, 7971–7978.
11. Arnold, I., Bauer, M.F., Brunner, M., Neupert, W. & Stuart, R.A.
(1997) Yeastmitochondrial F1F0-ATPase: the novel subunit e is
identical to Tim11. FEBS Lett. 411, 195–200.
12. Arnold,I.,Pfieffer,K.,Neupert,W.,Stuart,R.A.&Scha
¨
gger, H.
(1998) Yeastmitochondrial F1F0-ATP synthase exists as a dimer:
identification of three dimer-specific subunits. EMBO J. 17, 7170–
7178.
13. Velours, J. & Arselin, G. (2000) The Saccharomyces cerevisiae

ATP synthase. J. Bioenerg. Biomembr. 32, 383–390.
14. Paumard, P., Vaillier, J., Coulary, B., Schaeffer, J., Soubannier, V.,
Mueller, D.M., Bre
`
thes, D., di Rago, J.P. & Velours, J. (2002) The
ATP synthase is involved in generating mitochondrial cristae
morphology. EMBO J. 21, 221–230.
15. Soubannier, V., Vaillier, J., Paumard, P., Coulary, B., Schaeffer, J.
& Velours, J. (2002) In the absence of the first membrane-spanning
segment of subunit 4(b), the yeast ATP synthase is functional but
does not dimerize or oligomerize. J. Biol. Chem. 277, 10739–10745.
16. Paumard, P., Arselin, G., Vaillier, J., Chaignepain, S., Bathany, K.,
Schmitter, J.M., Bre
`
thes, D. & Velours, J. (2002) Two ATP syn-
thases can be linked through subunits i in the inner mitochondrial
membrane of Saccharomyces cerevisiae. Biochemistry 41, 10390–
10396.
17. Belogrudov, G.I., Tomich, J.M. & Hatefi, Y. (1996) Membrane
topography andnear-neighbor relationships of the mitochondrial
ATP synthase subunits e, f, and g. J. Biol. Chem. 271, 20340–
20345.
18. Arakaki, N., Ueyama, Y., Hirose, M., Himeda, T., Shibata, H.,
Futaki, S., Kitagawa, K. & Higuti, T. (2001) Stoichiometry of
subunit e in rat liver mitochondrial H(+)-ATP synthase and
membrane topology of its putative Ca(2+)-dependent regulatory
region. Biochim. Biophys. Acta 1504, 220–228.
19. Higuti, T., Kuroiwa, K., Kawamura, Y. & Yoshihara, Y. (1992)
Complete amino acid sequence of subunit e of rat liver mito-
chondrial H(+)-ATP synthase. Biochemistry 31, 12451–12454.

20. Swartz, D.A., Park, E.I., Visek, W.J. & Kaput, J. (1996) The e
subunit gene of murine F1F0-ATP synthase – Genomic sequence,
chromosomal mapping and diet regulation. J. Biol. Chem. 271,
20942–20948.
21. Levy, F.H. & Kelly, D.P. (1997) Regulation of ATP synthase
subunit eexpression by hypoxia: cell differentiation stage-specific
control. Am. J. Physiol. 272, C457–C465.
22. Paul, M.F., Velours, J., Arselin de Chateaubodeau, G., Aigle, M.
&Gue
´
rin, B. (1989) The role of subunit, 4, a nuclear-encoded
protein of the F0 sector of yeast mitochondrial, ATP synthase, in
the assembly of the whole complex. Eur. J. Biochem. 185, 163–171.
23. Gu
¨
ldener, U., Heck, S., Fielder, T., Beinhauer, J. & Hegemann,
J.H. (1996) Anew efficient gene disruption cassette for repeated use
in budding yeast. Nucleic Acids Res. 24, 2519–2524.
24. Salleh, H.M., Patel, M.A. & Woodard, R.W. (1996) Essential
cysteines in 3-deoxy-D-manno-octulosonic acid 8-phosphate syn-
thase from Escherichia coli: analysis by chemical modification and
site-directed mutagenesis. Biochemistry 35, 8942–8947.
25. Arselin de Chateaubodeau, G., Gue
´
rin, M. & Gue
´
rin, B. (1976)
Perme
´
abilite

´
de la membrane interne des mitochondries de levure:
e
´
tude des relations entre structure et activite
´
. Biochimie (Paris) 58,
601–610.
26. Gue
´
rin, B., Labbe, P. & Somlo, M. (1979) Preparation of yeast
mitochondria (Saccharomyces cerevisiae)withgoodP/Oandres-
piratory control ratios. Methods Enzymol. 55, 149–159.
27. Lowry, O.H., Rosebrough, N.J., Farr, A.L. & Randall, R.J.
(1951) Protein measurement with the folin reagent. J. Biol. Chem.
193, 265–275.
28. Rigoulet, M. & Gue
´
rin, B. (1979) Phosphate transport and ATP
synthesis in yeast mitochondria: effect of a new inhibitor: the tri-
benzylphosphate. FEBS Lett. 102, 18–22.
29. Lundin, A., Richardsson, A. & Thore, A. (1976) Continuous
monitoring of ATP-converting reactions by purified firefly luci-
ferase. Anal. Biochem. 75, 611–620.
30. Devin, A., Gue
´
rin, B. & Rigoulet, M. (1997) Control of oxidative-
phosphorylation in rat liver mitochondria: effect of ionic media.
Biochim. Biophys. Acta 1319, 293–300.
31. Velours, J., Vaillier, J., Paumard, P., Soubannier, V., Lai-Zhang, J.

& Mueller, D.M. (2001) Bovine coupling factor 6, with just 14.5%
shared identity, replaces subunit h in the yeast ATP synthase.
J. Biol. Chem. 276, 8602–8607.
32. Scha
¨
gger, H. & von Jagow, G. (1987) Tricine-sodium dodecyl
sulfate-polyacrylamide gel electrophoresis for the separation of
proteins in the range from 1 to100 kDa. Anal. Biochem. 166, 368–
379.
33. Arselin, G., Vaillier, J., Graves, P.V. & Velours, J. (1996) ATP
synthase of yeast mitochondria. Isolation of the subunit h and
disruption of the ATP14 gene. J. Biol. Chem. 271, 20284–20290.
Ó FEBS 2003 Supramolecular species of ATP synthase (Eur. J. Biochem. 270) 1883
34. Scha
¨
gger, H. & von Jagow, G. (1991) Blue native electrophoresis
for isolation of membrane protein complexes in enzymatically
active form. Anal. Biochem. 199, 223–231.
35. Scha
¨
gger, H., Cramer, W.A. & von Jagow, G. (1994) Analysis of
molecular masses and oligomeric states of protein complexes by
blue native electrophoresis and isolation of membrane protein
complexes by two-dimensional native electrophoresis. Anal. Bio-
chem. 217, 220–230.
36. Yoshida, M., Sone, N., Hirata, H. & Kagawa, Y. (1975) A highly
stable adenosine Triphosphatase from a thermophillie bacterium.
Purification, properties, and reconstitution. J. Biol. Chem. 250,
7910–7916.
37. Grandier-Vazeille, X. & Gue

´
rin, M. (1996) Separation by blue
native and colorless native polyacrylamide gel electrophoresis of
the oxidative phosphorylation complexes of yeast mitochondria
solubilized by different detergents: specific staining of the different
complexes. Anal. Biochem. 242, 248–254.
38. Senes, A., Gerstein, M. & Engelman, D.M. (2000) Statistical
analysis of amino acid patterns in transmembrane helices: the
GxxxG motif occurs frequently and in association with b-bran-
ched residues at neighboring positions. J. Mol. Biol. 296, 921–936.
39. Russ, W.P. & Engelman, D.M. (2000) The GxxxG motif: a fra-
mework for transmembrane helix–helix association. J. Mol. Biol.
296, 911–919.
40. Mingarro, I., Whitley, P., Lemmon, M.A. & von Heijne, G. (1996)
Ala-insertion scanning mutagenesis of the glycophorin A trans-
membrane helix: a rapid way to map helix–helix interactions in
integral membrane proteins. Protein Sci. 7, 1339–1341.
41. Brunner, S., Everard-Gigot, V. & Stuart, R.A. (2002) Subunit e of
the yeast F1F0ATP synthase forms homodimers. J. Biol. Chem.
277, 48484–48489.
42. Allen, R.D., Schroeder, C.C. & Fok, A.K. (1989) An investigation
of mitochondrial inner membranes by rapid-freeze deep-etch
techniques. J. Cell. Biol. 108, 2233–2240.
43. Allen, R.D. (1995) Membrane tubulation and proton pumps.
Protoplasma 189, 1–8.
44. Spannagel, C., Vaillier, J., Arselin, G., Graves, P.V., Grandier-
Vazeille, X. & Velours, J. (1998) Evidence of a subunit 4 (subunit b)
dimer in favor of the proximity of ATP synthase complexes in
yeast inner mitochondrial membrane. Biochim. Biophys. Acta
1414, 260–264.

1884 G. Arselin et al. (Eur. J. Biochem. 270) Ó FEBS 2003