Báo cáo khoa học: Characterization of the 16S rRNA- and membrane-binding domains of Streptococcus pneumoniae Era GTPase Structural and functional implications docx

Characterization of the 16S rRNA- and membrane-binding domains
of
Streptococcus pneumoniae
Era GTPase
Structural and functional implications
Julie Q. Hang
1
and Genshi Zhao
2
1
Roche Palo Alto, LLC, Palo Alto, CA, USA;
2
Cancer Research, Lilly Research Laboratories, Eli Lilly and Company,
Indianapolis, IN, USA
Era is a highly conserved GTPase essential for bacterial
growth. The N-terminal part of Era contains a conserved
GTPase domain, whereas the C-terminal part of the protein
contains an RNA- and membrane-binding domain, the KH
domain. To investigate whether the binding of Era to 16S
rRNA and membrane requires its GTPase activity and
whether the GTPase domain is essential for these acti-
vities, the N- and C-terminal parts of the Streptococ-
cus pneumoniae Era – Era-N (amino acids 1–185) and Era-C
(amino acids 141–299), respectively – were expressed and
purified. Era-C, which had completely lost GTPase activity,
bound to the cytoplasmic membrane and 16S rRNA. In
contrast, Era-N, which retained GTPase activity, failed to
bind to RNA or membrane. These results therefore indicate
that the binding of Era to RNA and membrane does not
require the GTPase activity of the protein and that the
RNA-binding domain is an independent, functional

domain. The physiological effects of the overexpression of
Era-C were assessed. The Escherichia coli cells overexpress-
ing Era and Era-N exhibited the same growth rate as wild-
type E. coli cells. In contrast, the E. coli cells overexpressing
Era-C exhibited a reduced growth rate, indicating that the
overexpression of Era-C inhibits cell growth. Furthermore,
overexpression of era-N and era-C resulted in morphological
changes. Finally, purified Era and Era-C were able to bind to
poly(U) RNA, and the binding of Era to poly(U) RNA was
significantly inhibited by liposome, as the amount of Era
bound to the RNA decreased proportionally with the
increase of liposome in the assay. Therefore, this study
provides the first biochemical evidence that both binding
sites are overlapping. Together, these results indicate that the
RNA- and membrane-binding domain of Era is a separate,
functional entity and does not require the GTPase activity or
the GTPase domain of the protein for activity.
Keywords: GTPase activity; 16S rRNA-binding activity;
membrane association; KH domain; Streptococcus pneu-
moniae.
The Era GTPase is an RNA-binding protein essential for
bacterial growth. The sequences of Era homologues are
highly conserved in all bacteria sequenced to date [1–6]. Era
is also functionally conserved, as the homologues of Era
from different bacterial species are able to functionally
complement an Escherichia coli era mutant [6,7]. Owing to
its essentiality and widespread existence, Era represents an
attractive antibacterial target. Era has been implicated in a
wide array of cellular functions, including DNA replication,
protein translation, and cell cycle regulation. Mutations in

era have been shown to cause pleiotropic phenotypes in
E. coli, including a profoundly altered carbon metabolism
[8,9] and a lack of cell cycle progression [10,11]. Depletion of
the cellular concentration of Era at low temperatures
inhibited the growth of, and caused the elongation of,
E. coli cells that contained two or four segregated nucleoids
[11]. The exact function of Era, however, still remains to be
determined. Era homologues were also identified in human
and mouse [10,12]. The mammalian homologues of Era
appear to play a role in the regulation of apoptosis [13].
The crystal structure analysis of E. coli Era indicates a
two-domain structure [14]. The N-terminal part of Era
contains a conserved GTP-binding domain (Era) (Fig. 1)
[6,14–16], whereas the C-terminal part appears to contain a
motif similar to the KH domain, a conserved RNA-binding
domain present in the eukaryotic pre-mRNA-binding
proteins (Fig. 1) [6,14–16]. Purified Era proteins of Strepto-
coccus pneumoniae and E. coli were bound primarily with
16S rRNA [17,18]. In addition, purified E. coli Era was also
found to bind poly(U) RNA in vitro [19]. Truncation
analysis of the C-terminus of Era indicated that the KH
domain was required for 16S rRNA-binding activity [20].
Thus, Era is an RNA-binding protein that may play a
critical role in protein synthesis. The essentiality of the
RNA-binding activity of Era has also been established [20].
The GTPase activity of Era proteins has also been shown to
be essential for bacterial growth [10,20–24]. Interestingly,
some mutations in the GTPase domain of E. coli Era
Correspondence to G. Zhao, Lilly Research Laboratories, Cancer
Research, Drop code 0424, Lilly Corporate Center, Eli Lilly and

Company, Indianapolis, IN 46285-0424, USA.
Fax: +1 317 276 6510, Tel.: + 1 317 276 2040,
E-mail:
Abbreviations: GST, glutathione S-transferase; IPTG, isopropyl-
b-
D
-thiogalactopyranoside; PtdEtn, phosphatidylethanolamine;
PtdGro, phosphatidylglycerol.
(Received 13 June 2003, revised 20 August 2003,
accepted 1 September 2003)
Eur. J. Biochem. 270, 4164–4172 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03813.x
impeded the RNA-binding activity, as judged by its ability
to bind to polynucleotides in vitro [19], but some mutations
in this domain did not appear to affect the RNA-binding
activity [19]. Thus, it was not clear whether the binding of
Era to 16S rRNA requires the GTPase activity of the
protein and whether the RNA-binding domain can bind
RNA in the absence of the GTPase domain. Structurally, it
remained to be established whether the RNA-binding
domain is functional in the absence of the GTPase domain.
Era has been found to be associated with the inner
membrane of E. coli [25]. However, the exact component of
the membrane to which Era binds has yet to be identified.
Interestingly, the amount of SGP, an Era homologue in
Streptococcus mutans that was associated with the mem-
brane, was increased significantly under stress conditions
[26]. Therefore, the membrane-binding activity of Era may
play a role in cell signaling. We have also shown that part of
the KH domain responsible for RNA binding is also
required for membrane binding [20]. However, it was not

clear whether the membrane-binding domain of Era also
required the GTP-binding and GTPase activities of the
protein for function and whether, biochemically, the RNA-
and membrane-binding domains overlap.
To investigate whether the RNA- and membrane-binding
activities require the GTPase activity of Era, and whether
the RNA- and membrane-binding domain is a self-sufficient
functional entity, we constructed N- and C-terminally
truncated Era proteins of S. pneumoniae that contained
the GTPase domain, and the RNA- and membrane-binding
domain, respectively. We purified and analyzed these
proteins for their GTP hydrolysis, and RNA- and
membrane-binding activities. The results of this study
indicate that the RNA- and membrane-binding domain is
a self-sufficient, functional entity that does not require the
GTPase domain for activity. This study also provides the
first biochemical evidence that the RNA- and membrane-
binding domains are overlapping.
Materials and methods
Materials
GTP, GDP, ampicillin, tetracycline, sucrose, maltose,
isopropyl-b-
D
-thiogalactopyranoside (IPTG), BSA, alka-
line-phosphatase-conjugated goat anti-rabbit monoclonal
IgG, 5-bromo-4-chloroindol-2-yl phosphate and Nitro Blue
tetrazolium were purchased from Sigma Chemical Com-
pany. Prestained molecular mass standards for SDS/PAGE
(myosine, 209 kDa; b-galactosidase, 124 kDa; BSA,
80 kDa; ovalbumin, 49.1 kDa; carbonic anhydrase,

34.8 kDa; soybean trypsin inhibitor, 28.9 kDa; lysozyme,
20.6 kDa; aprotinin, 7.1 kDa) were purchased from Bio-
Rad. Glutathione and glutathione–Sepharose were
obtained from Amersham Pharmacia Biotech and New
England Biolabs, respectively. T4 DNA ligase, calf intestinal
alkaline phosphatase, Taq DNA polymerase, 1 kb DNA
molecular mass standard, and all restriction enzymes were
obtained from Gibco BRL and used according to the
supplier’s recommendations. Vent DNA polymerase was
obtained from New England Biolabs. The liposome
preparation used in this study, which contained phospha-
tidylethanolamine (PtdEtn) and phosphatidylglycerol (Ptd-
Gro) in a ratio of 70 : 30 (wt/wt) LUV, was obtained from
Northern Lipids Inc. (Vancouver, Canada). This prepar-
ation was of uniform size. Poly(U) and poly(A) homopoly-
meric RNA were purchased from Sigma. PtdEtn and
PtdGro were purchased from Aventi Polar Lipids, Inc.
(Alabaster, AL, USA).
Bacterial strains, plasmids, and culture conditions
The following E. coli strains were used in this study:
BL21(DE3) pLysS (Stratagene), XL1-Blue-mRF¢ (Strata-
gene), HT120 (W3110 rnc-40::Tn10,Tet
r
) [24], LY12 (E. coli
K12wild-type),LY41[E. coli XL1-Blue-mRF¢/pLY41
S. pneumoniae glutathione S-transferase (GST)–era
+
Amp
r
)] [27], and LY42 [E. coli BL21(DE3) plysS/pLY42

(S. pneumoniae era
+
Amp
r
) [24]. The following plasmids
were used in this study: pACYC184 (New England Biolabs),
pGEX-2T and pGEX-4T (Amersham Biotech), and
pET-11a (Novagene). Luria–Bertani (LB) medium was
purchased from Difco Laboratories. Ampicillin
(100 lgÆmL
)1
), tetracycline (15 lgÆmL
)1
), and IPTG were
addedtomediaasindicatedineachexperiment.
E. coli strains that express the S. pneumoniae Era, Era-N,
and Era-C were first grown overnight at 33 °Cwith
vigorous shaking in LB medium supplemented with
100 lgÆmL
)1
ampicillin. The overnight cultures (40 mL
each) were inoculated into 1.25 L (each) of fresh LB medium
containing ampicillin and then induced with 0.4 m
M
IPTG
at an A
600
of 0.5–0.7 for 3 h at 31 °C. Cells were harvested
by centrifugation at 4000 g for 10 min and washed with
NaCl/P

i
, pH 7.4 (Gibco BRL).
Fig. 1. Functional domains of Streptococcus pneumoniae Era. (A) The
structural motifs of S. pneumoniae Era are shown based on a computer
modeling analysis [14,20]. The GTP-binding domain is composed of
four functional modules: G1 or P-loop, responsible for the binding of
GDP/GTP; G2, a putative regulatory domain; G3, responsible for
binding of catalytic Mg
2+
through an intervening water molecule; and
G4, a second putative regulatory domain. The putative KH domain in
the C-terminal part of Era corresponds to IIGKGGAMLK, a con-
served sequence located between residues 246 and 255. The region
critical for the binding of Era to the cytoplasmic membrane corres-
ponds to an amino acid sequence of KGIIIGKGGAMLKKI (residues
240–254) [15]. (B) Era-N (corresponding to amino acids 1–185), which
contains the GTPase domain, and Era-C (corresponding to amino
acids 141–299), which contains the RNA-binding domain (KH
domain) and the region essential for the binding of Era to the cyto-
plasmic membrane [20,24].
Ó FEBS 2003 16S rRNA- and membrane-binding domains of Era (Eur. J. Biochem. 270) 4165
DNA manipulation
Plasmids were purified using a plasmid purification spin kit
(Qiagen Inc.). To isolate DNA fragments after restriction
digestion, reaction mixtures were subjected to agarose gel
electrophoresis. The bands containing the DNA fragments
of interest were cut out from the gel and the DNA fragments
were purified using an Ultrafree DA column, according to
the manufacturer’s instructions (Amicon Bioseparations).
Competent cells of E. coli XL1-Blue-mRF¢ and BL21(DE3)

LysS were purchased from Stratagene and Novagen, res-
pectively. The transformation of plasmids and the prepar-
ation of competent cells of E. coli HT120, LY12 (E. coli
K12 wild-type) were performed as described previously [24].
Construction of recombinant plasmids for expressing
C-terminally truncated Era proteins in GST fusion form
To express Era, Era-C, and Era-N of S. pneumoniae in
GST-fusion form, the pGEX vectors (Amersham Biotech)
were used. The era genes of S. pneumoniae that encode the
full-length protein (299 codons), the N-terminal domain
(1–185 codons), and the C-terminal domain (141–299
codons) are designated era, era-N, and era-C, respectively,
and their corresponding gene products are designated Era,
Era-N, and Era-C, respectively. To generate deletions of
era, a PCR method was used [24]. The full-length era gene
of S. pneumoniae, carried on plasmid pLY41, was used as
template for the amplification of era-N and era-C using the
primers designed as described below. The era-N gene was
cloned into pGEX-2T at the BamHI site. A 5¢-PCR primer
was designed, which contained a BamHI site followed by an
NdeI site. These two restriction sites contained an ATG start
codon. The 3¢-PCRprimerwasdesignedtocontainaTCA
stop codon followed by a BamHI site at the end of the gene.
The 5¢-and3¢-PCR primers used for the amplification of
era-N are 5¢-GTTCCGCGT
GGATCCCATATGAC-3¢
and 5¢-CATTTCTGAAACTAA
GGATCCTCATGGAT
GATCTGTGATTTGATCAGACG-3¢, respectively [dou-
ble underlined sequences are the NdeIsiteandthestop

codon (TCA)]. The orientation of the DNA insert was
determined by restriction digestion using StyIandEcoRI.
The era-C gene was cloned into pGEX-4T at BamHI and
NotIsites.The5¢-PCR primer was designed to contain a
BamHI site followed by a NdeI site with an ATG start
codon. The 3¢-PCR primer was designed to contain a TAA
stop codon followed by a NotI site at the end of the gene.
The 5¢-and3¢-PCR primers used for the amplification of
era-N are as follows:
5¢-GACATC
GGATCCCATATGCAAATGGACTTTAA
GGAAATTGTTCCA-3¢ and 5¢-GATGTCGGATCC
GC
GGCCGCTAAGTATTCTCTTTCATTATAGCCA-3¢,
respectively.
To amplify era, reaction mixtures (100 lL each) con-
tained 20 ng of pLY41 (era
+
) DNA, 1 · PCR buffer
(Gibco BRL), 2 m
M
MgCl
2
,0.2m
M
dNTPs, 10 pmol of
each primer, 1.25 U Taq DNA polymerase, and 0.25 U
Vent DNA polymerase. The PCR amplification conditions
used were as follows: denaturation at 94 °Cfor30s;
annealing at 55 °C for 30 s; and polymerization at 72 °Cfor

60 s. PCR products were digested with BamHI, purified
using a Qiaquick PCR purification kit (Qiagen), and cloned
into pGEX-2T at the BamHI site. The resulting plasmid was
designated pLY248 (era-N) and transformed into E. coli
XL1 Blue mRF¢ cells. The DNA sequences of the era-N and
era-C genes were confirmed by sequencing at the Sequen-
cing Facility of Eli Lilly and Company.
Construction of recombinant plasmids
for complementation studies
To test whether 3¢-terminally truncated era genes could
complement an E. coli mutant strain deficient in Era
production, the following genes were cloned into
pACYC184 at the BamHI site, as described above: era,
era-N, and era-C. The resulting plasmids were designated as
pLY344 (era), pLY353 (era-N), and pLY470 (era-C). The
DNA sequences and orientations of the genes cloned in
the expression vectors were confirmed by sequencing, as
described above.
Purification of Era, GST–Era, GST–Era-C,
and GST–Era-N proteins
For the purification of GST–Era, GST–Era-C, and GST–
Era-N proteins, E. coli cells were suspended in 20 m
M
Tris/
HCl, pH 8.0, containing 50 m
M
NaCl, and 5 m
M
MgCl
2

(buffer A). The resulting cell suspensions were disrupted by
passage through a French Press cell (Aminco Laboratories,
Inc., Rochester, NY, USA) and the resulting cell lysates
were centrifuged at 180 000 g for 45 min (Beckman Instru-
ments, Inc.). After centrifugation, the supernatant fraction
of each lysate was collected, passed through a filter (0.2 lm;
Gelman Laboratory, Ann Arbor, MI, USA), and loaded
onto a glutathione–Sepharose column (10 mL) that had
been equilibrated with buffer A. The column was washed
with 100 mL of buffer A and protein was eluted with 30 mL
of buffer A containing 10 m
M
glutathione. All fractions
were subjected to SDS/PAGE [24] and those containing
GST-fusion protein were collected and stored in small
aliquots in 15% glycerol at )80 °C.
For in vitro RNA-binding assays, these proteins were
purified, as described above, except that buffer A contained
300 m
M
NaCl because, at high concentrations, salt could
disrupt the association of Era with 16S rRNA during
purification [19].
The native Era protein of S. pneumoniae was purified
from LY42 [E. coli BL21(DE3) plysS/pLY42 (S. pneumo-
niae era
+
Amp
r
)] cells, as described previously [17,24].

Briefly, a three-step chromatographic method (Source Q,
hydroxyapitate, and heparin column chromatography) was
used. The purified proteins were dialyzed against 20 m
M
Tris/HCl, pH 8.0, 5 m
M
MgCl
2
, and stored at )80 °C.
Analysis of the association of RNA with the full-length
and truncated Era proteins of
S. pneumoniae
To determine the association of bacterial rRNA with Era,
the proteins were purified by one-step glutathione–Seph-
arose column chromatography and the RNA associated
with the proteins was extracted as described below. The
purified proteins (0.2 mg each) were mixed with an equal
volume of phenol/chlorofrom/isoamyl alcohol (25 : 24 : 1,
4166 J. Q. Hang and G. Zhao (Eur. J. Biochem. 270) Ó FEBS 2003
v/v/v) [28]. The extracted materials were precipitated with
ethanol [28]. The resulting pellet from each protein prepar-
ation was collected, air dried, and resuspended in 30 lL
of RNase-free water (Ambion, Austin, TX, USA). The
resulting preparations (15 lL each) were analyzed by
agarose gel electrophoresis (1.5%) and stained with 0.5%
ethidium bromide in Tris/borate/EDTA buffer [28]. Total
RNAs of E. coli were isolated from E. coli LY12, as
described above [28].
The intensity of each RNA band was quantified using
IMAGEQUANT

software (version 5.1; Molecular Dynamics)
after scanning agarose gels using a FluorImager 757
(Molecular Dynamics).
The in vitro RNA-binding assay, using the poly(U)
RNA immobilized onto Sepharose, was employed [19] and
modified as described below. Poly(U)–Sepharose resin
(Pharmacia) was washed four times with water and
resuspended as a 50% slurry. Purified proteins (150 pmol)
wereaddedto175lL of binding buffer (25 m
M
Tris/HCl,
pH 7.5, 150 m
M
NaCl, 2.5 m
M
MgCl
2
, 0.1% Triton-X100)
and 25 lL of slurry at 23 °C. The mixtures were incubated
for 40 min, washed five times with 1 mL of binding buffer,
and resuspended in 15 lLof2· SDS/PAGE loading
buffer (Invitrogen). The resulting preparations were boiled
for 4 min and subjected to SDS/PAGE (12% polyacryl-
amide) followed by Western blotting analysis, as described
previously [24]. Briefly, transfer (25 V, constant) was carried
out in 12 m
M
Tris/HCl, 96 m
M
glycine, and 20% methanol

at room temperature for 2 h by using a Blot Module
(Invitrogen). The poly(vinylidene difluoride) membrane was
blocked in NaCl/P
i
, pH 7.4 (Gibco BRL), containing 5%
dry milk (Bio-Rad) at 4 °C overnight, incubated with
primary antibodies (diluted 1 : 500) and secondary anti-
bodies (diluted 1 : 2000) for 2–3 h at room temperature,
and then washed three times with NaCl/P
i
. The poly(viny-
lidene difluoride) membranes were incubated in a solution
containing 5-bromo-4-chloroindol-2-yl phosphate and
Nitro Blue tetrazolium (Sigma) until the desired color
developed. Protein concentrations were determined using
the Bradford assay kit (Bio-Rad) with BSA as a standard.
To evaluate the potential inhibition of RNA binding by
liposome and phospholipids, the RNA-binding assay was
performed in the presence of liposome or phospholipids for
10 min before addition of the Era protein.
The intensity of each band was quantified by using an
Imaging Densitometer (Model GS-700; Bio-Rad) after
scanning the membrane.
GTPase activity assay and enzyme kinetics
GTP hydrolysis activities of S. pneumoniae Era, Era-N, and
Era-C proteins were assayed by using an HPLC method
[17,18]. Reaction mixtures (100 lL each) containing 50 m
M
Tris/HCl, pH 7.5, 5 m
M

MgCl
2
, and 3.45 l
M
of Era,
Era-N, and Era-C proteins, were incubated at room
temperature (23 °C). To initiate the reactions, GTP was
added at concentrations of 62.5–1000 l
M
. The reactions
were stopped by adding 5 lLof1
M
HCl at time zero or
after 30 min of incubation. Then, the reaction mixtures
(50 lL each) were injected into a Nov-Pak C-18 column
(3.9 mm · 150 mm, 4 lm; Waters) and separated under
isocratic conditions (79 m
M
potassium phosphate, pH 6.0,
4m
M
tetrabutyl ammonium hydrogen sulfate, and 21%
methanol). The GDP produced was quantified by compar-
ing its peak areas with those of GDP standards. As GDP
was bound to the protein when purified, the total amount of
GDP produced after 30 min of incubation was calculated
by subtracting the GDP present at the start of the reaction.
Complementation of an
E. coli
mutant strain, HT120,

defective in Era production, by truncated
era
genes
of
S. pneumoniae
pET-11a and pGEX plasmids carrying the S. pneumoniae
era, era-N, and era-C genes, were transformed into E. coli
HT120, as described above. The resulting transformants
were selected on LB plates containing appropriate anti-
biotics as indicated in each experiment. The LB plates were
incubated at 31 °C for 24 h and examined for growth.
Analysis of the association of the truncated Era proteins
of
S. pneumoniae
with the cytoplasmic membrane
To examine the association of Era, Era-N, and Era-C of
S. pneumoniae with the cytoplasmic membrane, E. coli
BL21 (DE3) pLysS cells were first grown in LB medium
containing 100 lgÆmL
)1
ampicillin overnight at 35 °C. The
overnight cultures (9 mL each) were inoculated into
300 mL of LB medium supplemented with ampicillin. The
cultures were grown for 1 h at 33 °C and then induced with
1m
M
IPTG for 2 h. The cells were collected, washed,
resuspended in 3 mL of buffer C (20 m
M
Tris/HCl, pH 7.0,

5m
M
MgCl
2
), and disrupted as described above. The
resulting crude extracts were diluted to 6 mL with buffer C
and centrifuged at 12 000 g for 12 min to remove unbroken
cells and potential inclusion bodies. The supernatant
fractions (2 mL each) were mixed with 0.5 mL of buffer C
and loaded onto a sucrose gradient (2 mL of 25% sucrose
solution) in a polyallomer tube (13 · 51 mm; Beckman)
and centrifuged at 120 000 g for 50 min (SW50.1 rotor;
Beckman). The supernatant fractions, designated as cyto-
plasmic preparations, were collected. The resulting pellets,
designated as membrane preparations, were washed with
5 mL of buffer C and then resuspended in 3 mL of buffer C.
The membrane preparations were collected by centrifuga-
tion at 140 000 g for 40 min (SW 50.1 rotor; Beckman) and
resuspended in buffer C containing 0.5% SDS. The protein
concentrations of the cytoplasmic and membrane prepara-
tions were determined using a Dc protein assay kit (Bio-
Rad). Both the cytoplasmic and membrane preparations
(40 lg of each) were subjected to SDS/PAGE followed by
Western blotting analysis, as described above.
Growth characteristics
The cells of LY12 (E. coli K12 wild-type strain) carrying the
genes on pGEX, which encoded GST–Era, GST–Era-N,
GST–Era-C, and GST, were cultured overnight. The
overnight cultures were washed once, using LB, and
transferred into 5 mL of LB containing 100 lgÆmL

)1
ampicillin. The density of all cultures was adjusted to an
A
600
of 0.04 before use. When the cultures reached an A
600
of 0.2, 1 m
M
IPTG was added to the growth medium. The
cultures were allowed to grow at 37 °C with vigorous
Ó FEBS 2003 16S rRNA- and membrane-binding domains of Era (Eur. J. Biochem. 270) 4167
shaking (225 r.p.m.) and the cell growth was monitored
hourly by measuring the cell density at A
600
(Spectronic 20
Genesys Spectrophotometer; Spectronic Instruments). Cell
viability was examined using a Nikon Eclipse E800
microscope. The nucleoids of the cells were stained with
4¢,6¢-diamidino-2-phenylindole (DAPI), as described by
Johnstone et al. [19].
Results
Effects of the deletion of the RNA- and membrane-
binding domains of
S. pneumoniae
Era on the GTPase
activity of the protein
To assess the potential effects of removal of the RNA- and
membrane-binding domains on the GTPase activity of Era,
we measured the GTPase activity of the purified Era
proteins. GST–Era-N, purified using one-step glutathione-

affinity column chromatography, exhibited a K
m
value
similar to that of GST-Era, but a lower V
max
value
(Table 1). These results indicate that removal of the KH
domain does not significantly affect the binding of GTP to
Era, but does reduce the GTP hydrolysis activity (by
approximately threefold). As expected, Era-C, whose
GTPase domain was removed, completely lost GTPase
activity. These results, consistent with those of previous
studies [20], demonstrate that the GTPase domain is a
separate functional entity.
Effects of deletion of the GTPase domain
on the 16S rRNA-binding activity of Era
Sequence comparison of the S. pneumoniae and E. coli Era
proteins showed that both proteins are similar (43% identity
and 63% similarity, respectively). On the basis of the
sequence similarities between the two Era proteins and the
X-ray crystal structure of the E. coli Era protein [14], a
computer-based modeling analysis of S. pneumoniae Era
indicated that this protein also contains a KH domain with
a similar baab folding structure (Fig. 1A,B). Removal of
this KH domain of S. pneumoniae Eraresultedinthelossof
16S rRNA-binding activity [20]. Thus, the KH domain is
required for 16S rRNA-binding activity. However, it is not
clear whether the binding of Era to 16S rRNA requires the
GTPase activity of the protein. Furthermore, it is not
known whether the KH domain of Era is a separate,

functional entity that structurally does not require the
GTPase domain for activity. To examine these aspects
further, we determined whether the KH domain of Era
could bind 16S rRNA in the absence of the GTPase
domain. First, we constructed expression systems that
produced GST–Era-N and GST–Era-C proteins. Then, we
purified these truncated proteins and compared their 16S
rRNA-binding activity with that of the full-length Era.
Surprisingly, Era-C, the C-terminal part of Era, which
corresponds to the KH domain, was able to bind to 16S
Fig. 2. Analysis of RNA association with Era, Era-C, and Era-N of Streptococcus pneumoniae. Era proteins were expressed, purified, and analyzed
for their association with RNA, as described in the Materials and methods. (A) Association of Era proteins with 16S rRNA. Lane 1, total rRNA
isolated from Escherichia coli; lanes 2–5, phenol/chloroform extracted materials from purified glutathione S-transferase (GST)–Era, GST–Era-N,
GST–Era-C, and GST alone, respectively; lane 6, DNA standards (1 kb increments). (B) Binding of Era to poly(U) homopolymeric RNA. In all
cases, 150 pmol of protein was used in the binding assays except for lane 6 in which 200 ng of GST–Era was directly loaded onto the gel without
being subjected to the poly(U) RNA-binding assay. Lane 1, molecular weight markers (Bio-Rad broad range); lanes 2–5, GST–Era, GST–Era-N,
GST–Era-C, or GST alone; and lane 6, GST–Era (200 ng) that was not subjected to the poly(U) RNA-binding assay.
Table 1. Kinetic properties of glutathione S-transferase (GST)–Era,
GST–Era-C, and GST–Era-N of Streptococcus pneumoniae. NA, not
applicable; ND, not detected.
Protein K
m
(l
M
) V
max
(mmolÆmin
)1
Æmol
)1

)
GST–Era (full length) 271 ± 130.6 170.0 ± 31.2
GST–Era-N
(amino acids 1–181)
276 ± 75.2 61.6 ± 1.0
GST–Era-C
(amino acids 141–299)
NA ND
4168 J. Q. Hang and G. Zhao (Eur. J. Biochem. 270) Ó FEBS 2003
rRNA (Fig. 2A, lane 4). The amount of 16S rRNA bound
to Era-C was similar to that of the full-length Era, as
demonstrated by fluorescent scanning analysis (Fig. 2A,
lanes 2 and 4, data not shown). In contrast, Era-N, which
did not contain the KH domain, failed to bind 16S rRNA
(Fig. 2A, lane 3). Together, these results show that the KH
domain of Era is a separate functional entity whose RNA-
binding activity does not require the presence of the GTPase
activity biochemically or the GTPase domain structurally.
To further confirm these results, we also constructed
expression systems producing similar truncated Era pro-
teins of E. coli and Mycoplasma pneumoniae and com-
pared their 16S rRNA-binding activity with that of the
full-length Era proteins. The C-terminal parts of both Era
proteins were able to bind to 16S rRNA in the absence of
the N-terminal GTPase domain and the amount of the
RNA bound to the proteins was similar to that of
the full-length proteins (data not shown). Furthermore,
the N-terminal parts of both Era proteins failed to bind
16S rRNA. Thus, the C-terminal KH domain of Era,
which alone can bind to 16S rRNA, appears to be a

highly conserved structural entity among Gram-negative
and Gram-positive bacteria, and Mycoplasma.
It has been reported that some of the mutations in the
GTPase domain of E. coli Era decreased the ability of the
protein to bind to homopolymeric poly(U) RNA in an
in vitro assay [19]. To further examine whether the GTPase
activity might biochemically, or the GTPase domain
structurally, influence the binding of Era to RNA, we
analyzed, using an in vitro binding assay, the ability of Era,
Era-N, and Era-C to bind to homopolymeric RNA
immobilized onto Sepharose. The Era protein preparations
used in this assay were purified, in the presence of 300 m
M
NaCl, to remove 16S rRNA associated with the protein
during purification. As shown in Fig. 2B (lanes 2 and 4),
both the full-length Era and Era-C were able to bind
poly(U), albeit with slightly different affinities. The molar
amount of Era-C bound with poly(U) was 60% of that for
the full-length Era. On the other hand, the amount of Era-N
associated with poly(U) was virtually undetectable and
similar results were obtained with the control GST protein
(Fig. 2B, lanes 3 and 5). Thus, removal of the GTPase
domain of Era did not significantly affect the binding of the
protein to RNA in vitro or in vivo.
Effects of the deletion of the GTPase domain
on the cytoplasmic membrane-binding activity of Era
To examine the effect of domain removal on the membrane-
binding activity of Era, we expressed Era, Era-C, and Era-N
in E. coli, isolated the cytoplasmic and membrane fractions
of E. coli that overexpressed the proteins, and measured

their membrane-binding activities, as described above in the
Materials and methods. The cytoplasmic and membrane
fractions prepared were subjected to Western blotting
analysis. Era and Era-C were found to be associated with
the membrane (Fig. 3, lanes 2 and 8). In addition, the
amounts of protein distributed between the cytoplasmic and
membrane fractions were the same for Era and Era-C
(Fig. 3, lanes 1–2, 7–8). In contrast, Era-N, although highly
expressed in the cells, was not significantly associated with
the membrane (Fig. 3, lanes 4–5). Previous studies have
shown that Era is distributed approximately equally
between the cytoplasm and the cytoplasmic membrane
[24–26,29]. However, the amount of Era-N remaining in
the membrane fraction was only 10–16% of that in the
cytoplasmic fraction. Together, these results indicated that
the C-terminus of Era retains the structural integrity for the
RNA- and membrane-binding activities. The results also
indicated that the GTPase activity of Era is not necessary
for the membrane-binding activity of Era.
Inhibition of Era binding to poly(U) RNA by liposome
As shown previously, the KH domain of Era is required for
the binding of the protein to 16S rRNA, and part of the
domain is also required for the binding of the protein to
membrane. Thus, the regions critical for the membrane- and
16S rRNA-binding activities of Era appear to overlap. As
shown above, Era from S. pneumoniae wasabletobindto
poly(U) (Fig. 4A, lane 2). To further examine this bio-
chemically, we performed the in vitro RNA-binding experi-
ments (see the Materials and methods) using poly(U) in the
presence or absence of liposome. In the absence of liposome,

Era was able to bind to poly(U), as shown above. In the
presence of liposome, the amount of Era bound to poly(U)
decreased significantly (Fig. 4A, lanes 3–5). Scanning ana-
lysis indicated that the amount of Era bound to poly(U)
decreased proportionally with an increase in the concentra-
tion of liposome (Fig. 4B). Further analysis indicated that
50% inhibition was achieved at a liposome concentration
of 0.86 ngÆlL
)1
. Therefore, this study provides direct
biochemical evidence that the membrane- and RNA-
binding sites of Era overlap.
To further understand the inhibition of liposome on the
binding of Era to poly(U), we analyzed the effects of
different component lipids of the liposome on the ability of
the protein to bind to poly(U). As shown in Fig. 4C, the
binding of Era to poly(U) was significantly inhibited in the
presence of a 10-fold excess of unbound cognate poly(U)
(lanes 1 and 3). Interestingly, the amount of Era bound to
Fig. 3. Analysis of the association with the C-terminal part (Era-C) of
Streptococcus pneumoniae ErawiththeEscherichia coli cytoplasmic
membrane. The cytoplasmic and membrane preparations of E. coli
cells expressing Era-C, Era and Era-N were prepared, subjected to
SDS/PAGE, and analysed by Western blotting. Arrows indicate the
position of each Era protein. Lanes 1, 4, and 7, the cytoplasmic
preparations ÔCÕ of E. coli cells expressing glutathione S-transferase
(GST)–Era, GST–Era-N, and GST–Era-C, respectively; lanes 2, 5, and
8, the membrane preparations ÔMÕ of E. coli cells expressing GST–Era,
GST–Era-N, and GST–Era-C, respectively; lanes 3, 6, and 9, the crude
lysates ÔRÕ collected before ultracentrifugation (at 120 000 g)ofE. coli

cells expressing GST–Era, GST–Era-N, and GST–Era-C, respectively.
Ó FEBS 2003 16S rRNA- and membrane-binding domains of Era (Eur. J. Biochem. 270) 4169
poly(U)–Sepharose in the presence of PtdGro was 41% of
that in the absence of PtdGro (Fig. 4C, lanes 1 and 4). The
inhibitory effect of PtdGro is comparable to that of poly(U)
(Fig. 4C, lanes 3 and 4). The amount of Era associated with
poly(U) in the presence of PtdEtn was 114% of that in the
absence of PtdEtn (Fig. 4C, lanes 1 and 5). Therefore,
PtdEtn did not appear to inhibit the binding of Era to
poly(U) RNA. The results indicate that the inhibition of the
binding of Era to RNA by liposome is specific and that
PtdGro, a major component of liposome, appears to be
mainly responsible for the inhibition. The physiological
implications of these findings are discussed below.
Effects of overexpression of Era-C and Era-N on cell
growth and morphology
To further understand the physiological role of Era, we
overexpressed the full-length and truncated proteins in
E. coli and compared their effects on bacterial growth. If
both the membrane- and 16S rRNA-binding activities of
Era are required for normal function, overexpression of the
C-terminal part of Era may interfere with cell growth
by directly competing with the wild-type Era to bind to 16S
rRNA or the cytoplasmic membrane. The pGEX plasmids,
carrying the full-length and truncated era genes, were
transformed into LY12 (a wild-type E. coli K-12 strain),
and the growth rates of these strains were analysed in the
presence of IPTG. As shown in Fig. 5, when Era and Era-N
were overexpressed in E. coli, these cells exhibited the same
growth rate (88 min) as the wild-type E. coli cells carrying

the pGEX plasmid. However, the overexpression of Era-C
in the cell resulted in a moderate reduction in growth rate
(112 min). The results suggest that the overexpression of
Era-C inhibited bacterial growth. The results also support
the notion [10] that the RNA- and membrane-binding
domain of Era may be involved in the regulation of cell cycle.
Fig. 4. Inhibition of the binding of Streptococcus pneumoniae Era to
poly(U) RNA by liposome. In each case, Era (5 lg or 150 pmol) was
used. (A) Inhibitory effect of liposome on the binding of Era to
Poly(U) RNA. Lane 1, protein molecular mass standards (Bio-Rad
broad-range); lanes 2–5, the binding of Era to poly(U) RNA in the
presence of 0, 0.1, 0.6, or 1.2 lgÆlL
)1
of liposome; lane 6, purified Era
(200 ng). (B) The amount of Era bound to poly(U) RNA in the
presence of different amounts of liposome. (C) The binding of Era to
poly(U)–Sepharose in the presence of liposome, free poly(U), phos-
phatidylethanolamine (PtdEtn), or phosphatidylglycerol (PtdGro).
The amount of Era to bound poly(U) in the absence of liposome
(lane 1), or in the presence of 1.2 lgÆlL
)1
liposome (lane 2), 10-fold
excess of poly(U) (lanes 3), 1.2 lgÆlL
)1
PG (lane 4), 1.2 lgÆlL
)1
PtdEtn (lane 5) or 200 ng of purified Era (lane 6).
Fig. 5. Effects of the overexpression of Streptococcus p neu monia e
Era-CaswellasEraandEra-NonEscherichia coli K-12 cells. The
E. coli cells containing era, era-N, or era-C carried on pGEX were

grown in Luria–Bertani (LB) medium containing 100 lgÆlL
)1
ampi-
cillin. The growth of bacterial cells was monitored by measurement at
A
600
. For the induction of protein expression, 1 m
M
isopropyl-
b-
D
-thiogalactopyranoside (IPTG) was added to the culture when it
reached an A
600
of 0.2.
4170 J. Q. Hang and G. Zhao (Eur. J. Biochem. 270) Ó FEBS 2003
Interestingly, the overexpression of Era-C and Era-N in
the cell resulted in morphological changes, i.e. elongation
and the formation of short rod-shaped cells (data not
shown). Staining analysis of the cells with DAPI showed
that these elongated cells contained between two and four
nucleoids (data not shown). The results suggest that the loss
of 16S rRNA- and membrane-binding activities, as well as
GTPase activity, significantly affected the physiology of
E. coli cells. It is not clear why the overexpression of Era-C
and Era-N in the cell resulted in similar abnormal
morphological changes.
Finally, we further confirmed that the GTPase activity,
and the RNA- and membrane-binding activities of Era are
essential for bacterial growth. When the era-N and era-C

genes carried on pACYC184 were transformed into an
E. coli strain defective in Era production, they failed to
restore cell growth. However, when the era gene carried on
the same plasmid was transformed into these cells, it
restored cell growth. Therefore, these results further confirm
the essentiality of the RNA- and membrane-binding
activities of the Era for growth.
Discussion
In this study, we examined the biochemical and structural
requirements of the RNA- and membrane-binding activities
of Era. We showed that the C-terminal part of Era, which
lacks the GTPase domain, retains 16S rRNA- and mem-
brane-binding activities. We also demonstrated that the
RNA-binding activity was inhibited by liposome, and
identified PtdGro as a major active component of liposome
that inhibits this RNA-binding activity. Finally, we showed
that the overexpression of Era-C inhibited bacterial growth
and resulted in morphological changes.
The KH domain has been found to exist in several RNA-
binding proteins, including hnRNPK [30], Sam68 [31,32],
yeast MER1 [33], and FMR1 [27,34]. It was not known
whether the prokaryotic KH domain, like the eukaryotic
KH domains, is a biochemically and structurally separate
entity that is self-sufficient in the binding of RNA. In this
study, we demonstrated, for the first time, that the
prokaryotic KH domain, when separated from the GTPase
domain, binds to 16S RNA as effectively as the wild-type
Era. These results indicate that the C-terminal part of Era,
which contains the RNA-binding domain, is a structural
entity independent of the GTPase domain and does not

require the GTPase domain for its activity (see below). The
results are also consistent with the observation that guanine
nucleotides do not have any apparent effect on the in vitro
RNA-binding activity of Era [19]. We could not, however,
exclude the possibility that interactions exist between the
RNA-binding domain and the GTPase domain which may
play a role in the regulation of the RNA-binding activity
and thereby the physiological function in the cell.
Previous studies have suggested that some mutations in
the GTPase domain of E. coli Era influence the binding of
the protein to RNA, but some do not [19]. The results of this
study demonstrated that the binding of Era to 16S rRNA
does not require the GTPase domain of Era. In addition, the
results of the in vitro RNA-binding experiments also
demonstrated that the KH domain of Era was able to
bind poly(U) RNA. Therefore, the mutational effects on
the RNA-binding activity are probably a result of their
effects on the structure of the Era KH domain, which
explains why some of the mutations affected the activity,
and others did not.
Membrane-associated GTPases are important signaling
regulators in eukaryotic cells where the GTP-bound form of
GTPase is required for pathway activation. For example,
ras and ras-like proteins represent a distinct class of the
membrane-associated GTPases that are ubiquitous in
eukaryotic cells and are essential for normal cell growth
and development [15,16]. It was thought that Era might be
involved in a GTPase receptor-coupled membrane-signaling
pathway [10,25]. In an in vitro experiment designed to test
the binding of purified Era to the cytoplasmic membrane,

Lin et al. [25] found that purified Era was able to bind to the
membrane and that this binding activity was stimulated by
the presence of guanine nucleotides in the assay mixture [25].
These results are in contrast to our finding, in this study,
that the binding of Era to the membrane does not require
GTPase activity of the protein. At present, we do not
understand the discrepancy between the findings of these
two studies.
We previously reported that the regions required for the
RNA- and membrane-binding activities of Era appeared
to overlap [20]. These results suggest that the binding of
Era to RNA may compete with the binding of Era to the
cytoplasmic membrane. Consistent with this contention, the
binding of Era to poly(U) RNA was inhibited by liposome
composed mainly of the two major components of lipids,
PtdEtn and PtdGro. Of the two, PtdGro exhibited an
inhibitory effect on the binding of Era to RNA. The results
appear to support our previous hypotheses that the RNA-
free form of Era may be sequestered by the membrane and
that the RNA- and membrane-binding activities of Era may
play a role in regulating the physiological function of the
protein. In addition, overexpression of Era-C inhibited the
growth of the organism. This is again consistent with our
hypothesis. It is possible that the large amount of Era-C
produced in the cell can bind to the membrane or 16S
rRNA, which, in turn, prevents the wild-type Era from
binding to the membrane or RNA. As a result, the function
of the wild-type Era is inhibited.
Acknowledgements
We thank Timothy I. Meier and Kelly A. McAllister for help, advice

and stimulating discussions during the course of this work. This work
was supported by a Lilly Postdoctoral Research Grant.
References
1. Ahnn,J.,March,P.E.,Takiff,H.E.&Inouye,M.(1986)AGTP-
binding protein of Escherichia coli has homology to yeast RAS
proteins. Proc. Natl Acad. Sci. USA 83, 8849–8853.
2. Fleischmann, R.D., Adams, M.D., White, O., Clayton, R.A.,
Kirkness, E.F., Kerlavage, A.R., Bult, C.J., Tomb, J.F.,
Dougherty, B.A., Merrick, J.M., et al. (1995) Whole-genome
random sequencing and assembly of Haemophilus influenzae Rd.
Science 269, 496–512.
3. Fraser, M., Gocayne, J.D., White, O., Adams, M.D.,
Clayton, R.A., Fleischmann, R.D., Bult, C.J., Kerlavage, A.R.,
Sutton, G., Kelley, J.M., et al. (1996) The minimal gene comple-
ment of Mycoplasma genitalium. Science 270, 397–403.
Ó FEBS 2003 16S rRNA- and membrane-binding domains of Era (Eur. J. Biochem. 270) 4171
4.Kawabata,S.,Terao,Y.,Andoh,T.&Hamada,S.(1997)
Nucleotide sequence and molecular characterization of a gene
encoding GTP-binding protein from Streptococcus gordonii.
FEMS Microbiol. Lett. 156, 211–216.
5. Zuber, M., Hoover, T.A., Dertzbaugh, M.T. & Court, D.L. (1997)
A Francisella tularensis DNA clone complements Escherichia coli
defective for the production of Era, an essential Ras-like GTP-
binding protein. Gene 189, 31–34.
6. Zuber, M., Hoover, T.A., Powell, B.S. & Court, D.L. (1990)
Analysis of the rnc locus of Coxiella burnetii. Mol. Microbiol. 14,
291–300.
7. Pillutla, C.R., Sharer, J.D., Gulati, P.S., Wu, E., Yamashita, Y.,
Lerner, C.G., Inouye, M. & March, P.E. (1995) Cross-species
complementation of the indispensable Escherichia coli era gene

highlights amino acid regions essential for activity. J. Bacteriol.
177, 2194–2196.
8. Pillutla, C.R., Ahnn, J. & Inouye, M. (1996) Deletion of the
putative effector region of Era, an essential GTP-binding protein
in Escherichia coli, causes a dominant-negative phenotype. FEMS
Microbiol. Lett. 143, 47–55.
9. Lerner, C.G. & March, P.E. (1991) Pleiotropic changes resulting
from depletion of Era, an essential GTP-binding protein in
Escherichia coli. Mol. Microbiol. 5, 951–957.
10. Britton, R.A., Powell, B.S., Dasgupta, S., Sun, Q., Margolin, W.,
Lupski, J.R. & Court, D.L. (1998) Cell cycle arrest in Era GTPase
mutants: a potential growth rate-regulated checkpoint in Escher-
ichia coli. Mol. Microbiol. 27, 739–750.
11. Gollop, N. & March, P.E. (1991) A GTP-binding protein (Era)
has an essential role in growth rate and cell cycle control in
Escherichia coli. J. Bacteriol. 173, 2265–2270.
12. Britton, R.A., Chen, S.M., Wallis, D., Koeuth, T., Powell, B.S.,
Shaffer, L.G., Largaespada, D., Jenkins, N.A., Copeland, N.G.,
Court, D.L. & Lupski, J.R. (2000) Isolation and preliminary
characterization of the human and mouse homologues of the
bacterial cell cycle gene, Era. Genomics 67, 78–82.
13. Akiyama,T.,Gohda,J.,Shibata,S.,Nomura,Y.,Azuma,S.,
Ohmori,Y.,Sugano,S.,Arai,H.,Yamamoto,T.&Inoue,J.
(2001) Mammalian homologue of E. coli Ras-likeGTPase(ERA)
is a possible apoptosis regulator with RNA binding activity. Genes
Cells 6, 987–1001.
14. Chen, X., Court, D.L. & Ji, X. (1999) Crystal structure of ERA: a
GTPase-dependent cell cycle regulator containing an RNA-bind-
ing motif. Proc. Natl Acad. Sci. USA 96, 8396–8401.
15. Bourne, H.R., Sanders, D.A. & McCormick, F. (1990) The

GTPase superfamily: a conserved switch for diverse cell functions.
Nature 348, 125–132.
16. Bourne, H.R., Sanders, D.A. & McCormick, F. (1991) The
GTPase superfamily: conserved structure and molecular
mechanism. Nature 349, 117–127.
17. Meier, T.I., Peery, R.B., Jaskunas, S.R. & Zhao, G. (1999) 16S
rRNA is bound to Era of Streptococcus pneumoniae. J. Bacteriol.
181, 5242–5249.
18. Meier, T.I., Peery, R.B., McAllister, K.A. & Zhao, G. (2000) Era
GTPase of Escherichia coli: binding to 16S rRNA and modulation
of GTPase activity by RNA and carbohydrates. Microbiology 146,
1071–1083.
19. Johnstone, B.H., Handler, A.A., Chao, D.K., Nguyen, V., Smith,
M., Ryu, S.Y., Simons, E.L., Anderson, P.E. & Simons, R.W.
(1999) The widely conserved Era G-protein contains an RNA-
binding domain required for Era function in vivo. Mol. Microbiol.
33, 1118–1131.
20. Hang, J.Q., Meier, T.I. & Zhao, G. (2001) Analysis of the inter-
action of 16S rRNA and cytoplasmic membrane with the
C-terminal part of the Streptococcus pneumoniae Era GTPase.
Eur. J. Biochem. 268, 5570–5577.
21. Britton, R.A., Powell, B.S., Court, D.L. & Lupski, J.R. (1997)
Characterization of mutations affecting the Escherichia coli
essential GTPase Era that suppress two temperature-sensitive
dnaG alleles. J. Bacteriol. 179, 4575–4582.
22. Inada, T., Kawakami, K., Chen, S., Takiff, H.E., Court, D.L. &
Nakamura, Y. (1989) Temperature-sensitive lethal mutant of Era,
a G protein in Escherichia coli. J. Bacteriol. 171, 5017–5024.
23. Nashimoto, H. (1993) Non-ribosomal proteins affecting the
assembly of ribosomes in Escherichia coli.InThe Translational

Apparatus. (Nierhaus, H.K., Franceschi, F., Subramanian, A.R.,
Erdmann, V.A. & Wittmann-Liebold, B., eds), pp. 185–195.
Plenum Press, New York.
24. Zhao, G., Meier, T.I., Peery, R.B. & Skatrud, P.L. (1999) Bio-
chemical and molecular analyses of the C-terminal domain of Era
GTPase from Streptococcus pneumoniae. Microbiology 145, 791–800.
25. Lin, Y.P., Sharer, J.D. & March, P.E. (1994) GTPase-dependent
signaling in bacteria: characterization of a membrane-binding site
for Era in Escherichia coli. J. Bacteriol. 176, 44–49.
26. Baev, D., England, R. & Kuramitsu, H.K. (1999) Stress-induced
membrane association of the Streptococcus mutans GTP-binding
protein, an essential G protein, and investigation of its physiolo-
gical role by utilizing an antisense RNA strategy. Infect. Immun.
67, 4510–4516.
27. Siomi, H., Siomi, M.K., Nussbaum, R.L. & Dreyfuss, G. (1993)
The protein product of the fragile X gene, FMR1, has char-
acteristics of an RNA-binding protein. Cell 74, 291–298.
28. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular
Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory,
Cold Spring Harbor, NY.
29. Gollop, N. & March, P.E. (1991) Localization of the membrane-
binding sites of Era in Escherichia coli. Res. Microbiol. 142,
301–307.
30. Siomi, H., Matunis, M.J., Michael, W.M. & Dreyfuss, G. (1993)
The pre-mRNA-binding K-protein contains a novel evolutionarily
conserved motif. Nucleic Acids Res. 21, 1193–1198.
31. Fumagalli, S., Totty, N.F., Hsuan, J.J. & Courtneidge, S.A. (1994)
A target for Src in mitosis. Nature 368, 871–874.
32. Lock, P., Fumagalli, S., Polakis, P., McCormick, F. & Court-
neidge, S.A. (1996) The human p62 cDNA encodes Sam68 and

not the RasGAP-associated p62 protein. Cell 84, 23–24.
33. Nandabalan, K. & Roeder, G.S. (1995) Binding of a cell-type-
specific RNA splicing factor to its target regulatory sequence. Mol.
Cell. Biol. 15, 1953–1960.
34. Siomi, H., Chol, M., Siomi, M.C., Nussbaum, R.L. & Dreyfuss,
G. (1994) Essential role for KH domains in RNA-binding:
impaired RNA-binding by a mutation in the KH domain of
FMR1 that causes fragile X syndrome. Cell 77, 33–39.
4172 J. Q. Hang and G. Zhao (Eur. J. Biochem. 270) Ó FEBS 2003