Báo cáo khoa học: Residues near the N-terminus of protein B control autocatalytic proteolysis and the activity of soluble methane mono-oxygenase doc

Residues near the N-terminus of protein B control autocatalytic
proteolysis and the activity of soluble methane mono-oxygenase
Anastasia J. Callaghan*, Thomas J. Smith†, Susan E. Slade and Howard Dalton
Department of Biological Sciences, University of Warwick, Coventry, UK
Soluble methane mono-oxygenase (sMMO) of Methylo-
coccus capsulatus (Bath) catalyses the O
2
-dependent and
NAD(P)H-dependent oxygenation o f methane and numer-
ous other substrates. During purification, the sMMO
enzyme complex, which comprises three components and
has a mole cular mass i n excess o f 300 kDa, becomes i nac-
tivated because o f cleavage of just 12 amino a cids f rom the
N-terminus of protein B , which is the smallest component of
sMMO and the only one without prosthetic groups. Here we
have shown that c leavage of protein B, to form the inactive
truncated p rotein B ¢, continued t o occur when intact protein
B was repeatedly separated from protein B¢ and all detec t-
able contaminants, giving compelling evidence that the
protein was cleaved autocatalytically. The rate of autocata-
lytic cleavage decreased when t he residues flanking the
cleavage site were mutated, but the position of cleavage was
unaltered. Analysis o f a series of incremental truncates
showed that residue(s) e ssential for the activity of sMMO,
and important in determining the stability of p rotein B, lay in
the r egion Ser4–Tyr7. Protein B was shown to possess
intrinsic nucleophilic activity, which we propose initiates the
cleavage react ion via a novel mechanism. Proteins B and B¢
were detected in approximately equal amounts in the cell,
showing th at truncation of protein B is biologically relevant.
Increasing the growth-medium copper concentration, which

inactivates sMMO, did not alter t he extent of in vivo cleav-
age, therefore the conditions under which cleavage of protein
B may fulfil its proposed role as a regulator of sMMO
remain to be id entified.
Keywords: autocatalytic inactivation; methane mono-oxy-
genase; methanotroph; N-terminal autoprocessing; regula-
tory protein.
Methane mono-oxygenase (MMO) catalyses the oxidation
of methane to methanol and is essential for the growth of
methanotrophic bacteria u sing methane a s the growth
substrate [1]. Methanotrophic bacteria such as Methy lococ-
cus capsulatus (Bath) possesses two forms of MMO, the
copper-requiring particulate form (pMMO) and the iron-
containing so luble form (sMMO), the expression of which is
regulated by the concentration of available copper in the
medium [2]. sMMO, which catalyses the NAD(P)H-depen-
dent and O
2
-dependent oxygenation of methane and
numerous adventitious substrates, is an enzyme complex
consisting of three components: a multisubunit hydroxylase,
a r eductase, a nd a regulatory component known as p rotein
B[3].
The hydroxylase (250.1 kDa) has an (abc)
2
quaternary
structure [4] in which each a subunit contains a l-(hydr)
oxo-bridged di-iron centre that is the presumed site of
substrate oxygenation [5,6]. The reductase (38.5 kDa)
contains FAD and Fe

2
S
2
centres and supplies electrons
from NADH to the hydroxylase [7]. Protein B (16 kDa) ,
which is devoid of p rosthetic groups and metal cofactors, is
essential for natural, O
2
-dependent substrate oxygenation
by the sMMO complex [3]. Owing to its diverse effects on
the catalytic pro perties of sMMO, protein B is potentially a
powerful regulator of sMMO activity. Protein B has been
shown to ( a) couple electron transfer to substrate oxygen-
ation thus converting sMMO from an oxidase into a n
oxygenase [8]; (b) reduce the redox potentials of t he di-iron
site [9,10] and hence inc rease the reactivity of the diferrous
di-iron site to oxygen; (c) accelerate formation of the high-
valent intermediate Q, which appears to be responsible for
oxygenation of m ethane [11–13]; (d) alter product distri-
bution with complex substrates [14,15]; and (e) inhibit
oxygenation reactions when the hydroxylase is artificially
activated by hydrogen peroxide v ia the p eroxide shunt
reaction [14].
Protein B binds to the hydroxylase [16] but not directly to
the reductase [17]. There are currently no high-resolution
structural data for the complex formed between protein B
and the hydroxylase; however, a cross-linking study using
the homologous sMMO of Methylosinus trichosporium
OB3b showed that protein B bound to th e a subunit [18]. A
variety of spectroscopic techniques have demonstrated that

protein B perturbs the environment of the di-iron s ite,
presumably by altering the conformation of the hydroxylase
[19–21]. Consistent with this, small-angle X-ray scattering
Correspondence to H. Dalton, Department of Biological Sciences,
University of Warwick, Coventry CV4 7AL, UK.
Fax: + 44 24 7652 3568, Tel.: + 4 4 2 4 7652 3552,
E-mail: hdalt
Abbreviations: ESI, electrospray ionization; GST, glutathione
S-transferase; SAXS, small angle X-ray scattering; s /pMMO, soluble/
particulate methane mono-oxygenase.
Enzyme: m ethane monooxygenase (EC 1.14.13.25).
*Present address: Department of Biochemistry, University of
Cambridge, Old Addenbrookes Site, Cambridge , UK.
Present address: Biomedical Research Centre, Sheffield H a llam
University, Howard Street, Sheffield, U K.
Note: a web page is available at />(Received 8 November 2001, revised 6 February 2002, accepted 8
February 2 002)
Eur. J. Biochem. 269, 1835–1843 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02829.x
(SAXS) has given direct, though low-resolution, structural
evidence for a large conformational change in the hydrox-
ylase that protein B and the reductase together ind uce [22].
Thus, current evidence suggests t hat protein B influences
sMMO activity through the conformational change that it
causes in the hydroxylase, although a direct role in
transferring electrons from the reductase to the hydroxylase
is also possible.
The NMR structure of protein B from Mc. capsulatus
(Bath) [23] shows that it has a folded central, two-
domain core region, while the N-terminal region until
Val31 and the C-terminus (Met130–Ala140) are mobile

and largely unstructured. NMR measurements in the
presence of the hydroyxlase showed exchange broadening
of specific nuclear Overhauser effect cross-peaks that
grouped around the so-called ÔnorthernÕ domain of the
core of protein B [23]. These results were interpreted as
showing that hydroxylase-bound and unbound protein
B were in dynamic equilibrium and that the hydrophobic
ÔnorthernÕ half of the c ore of protein B interacted w ith
the hydroxylase. Docking studies showed that protein
B could bind in the hydrophobic cleft formed by two
of the four iron-co-ordinating a h elices that lie in a
canyon formed betw een th e ab pairs of the hydroxylase
[6,23–25].
Protein B from Mc. capsulatus (Bath) is unusually
sensitive to inactivation because of truncation reactions.
During and after purification, protein B degrades by
cleavage, principally between Met12 and Gly13, to give
protein B¢, w hich is completely inac tive in the sMMO
whole-complex reaction [16,26]. Cleavage is also observed
between Gln29 and Val30, giving protein B¢¢,whichisalso
inactive [16]. Mutagenesis studies have shown that the
residues around the cleavage site influence the rate of
inactivation. Mutation of the Met12–Gly13 cleavage sit e in
protein B of the Mc. capsulatus (Bath) site to Met12–Gln13,
equivalent to the site f ound in Ms. trichosporium OB3b
protein B (in which truncation had not been reported),
enhanced the stability o f t he protein [16]. The triple m utant
G10A/G13Q/G16A was a lso resistant to truncation but had
diminished activity [27]. Protease inhibitors did not prevent
cleavage of protein B, a nd recombinant protein B expressed

in a protease-deficient strain of Escherichia c oli was cleaved
to protein B¢ [16] despite the absence of Mc. capsulatus-
specific proteases and the major intracellular proteases of
E. coli.
It is remarkable that the sMMO complex, the compo-
nents of which total  300 kDa, is exquisitely sensitive to
inactivation by removal of just 12 amino acids from the
unstructured terminus of its smallest component. The fact
that those 12 amino acids are lost spontaneously under a
range o f conditions raises important questions about the
mechanism of cleavage and suggests that cleavage may
occur in vivo.Ifitisanin vivo phenomenon, truncation o f
protein B offers a possible mechanism to control the
amount of active protein B within the cell and thus regulate
the rates of methane oxidation and NADH consumption by
sMMO, e.g. in response to i ntracellular or extracellular
conditions. To address these q uestions, we conducted a
detailed characterization o f the mechanism of cleavage, the
roles of specific amino acids near to the N-terminus in
catalytic activity, and the significance of the cleavage
reaction in vivo.
MATERIALS AND METHODS
Bacterial growth
sMMO-expre ssing Mc. capsulatus (Bath) cells were grown
in nitrate minimal salts medium using methane as the
growth substrate, as described previously [7]. The switch
from sMMO to pMMO expression was e ffected in fermen-
tor cultures by increasing t he CuSO
4
.5H

2
O concentration of
themediumfrom0.1to1.0mgÆL
)1
. E. coli strains were
grown a t 37 °C i n L uria–Bertani broth [28], with ampicillin
(100 lgÆmL
)1
) added for selection of plasmids a s required.
Purification of the sMMO components
from
Mc. capsulatus
The hydroxylase, reductase and protein B components of
sMMO were purified from Mc. capsulatus (Bath) as
described previously [22,29]. As protein B underwent
truncation during purification, protein prepared b y this
method contained a mixture of proteins B and B¢.The
relative abundance of p roteins B and B¢ was assessed b y
using SDS/PAGE and electrospray ionization (ESI)-MS.
Incubation of the purified protein B /B¢ mix at 20 °Cfor
1–2 d ays enabled complete conversion of protein B to B¢.
Separation of proteins B and B¢ by chromatofocusing
chromatography
Chromatofocusing chromatography was achieved using a
Mono P FPLC column (HR 5/20) (Amersham Ph armacia).
The column was equilibrated with buffer A (25 m
M
methylpiperizine, p H 5.64 or 5.7) before loading of the
protein in the same buffer. Elution using buffer B [1 : 10
dilution of PolyBuffer 74

TM
(Amersham P harmacia)] at
either pH 3.5 or 4, with a flow rate of 0.3–1.0 mLÆmin
)1
over 15 col. vol., separated proteins B and B ¢ according t o
the difference in their isoele ctric pH.
Genetic manipulations
The construct for expression of the M12A/G13Q double
mutant of protein B was made by amplification of mmoB
(which encodes protein B) from pGEX-WTB [16] by PCR
with primers mmoB-M12A/G13Q-1 (5¢-CGCGGATCC
ACGATGAGCGTAAACAGCAACGCATACGACGCC
GGCATC GCGCAGCTGAAAGGCAAG-3¢;M12Aand
G13Q mutations shown in bold, start codon in italics and
BamHI site underlined) a nd primer mmo B-2 (5¢-GGCGAA
TTCTAAGCGTGATAGTCTTCGAG-3¢; EcoRI site
underlined) and cloning into the glutathione S-transferase
(GST)-fusion expression vector pGEX-2T (Amersham-
Pharmacia) using BamHI and EcoRI.
The plasmids for expression of the C-terminally 6-His-
tagged G13Q mutant of protein B and N-terminal trunca-
tions thereof were c onstructed b y PCR amplification of the
appropriate section of mmoB using pGEX-mtB [16] a s the
template and cloning into pET3a (Novagen) using NdeIand
BamHI. The truncated constructs and the proteins they
encoded were numbered according to the fi rst amino a cid
after the start codon. The forward PCR primers for the
various constructs were as follows: G13Q-tag (full-length
construct), 5¢-GGGAATTCCATATGAGCGTAAACAG
1836 A. J. Callaghan et al.(Eur. J. Biochem. 269) Ó FEBS 2002

CAACGCATAC-3¢;truncate4,5¢-GGGAATTCCATAT
GAGCAACGCATACGACGCCGGCATC-3¢; truncate 5,
5¢-GGGAATCCATATGAACGCATACGACGCCGGCA
TCATGCAGCTGAAA-3¢;truncate6,5¢-GGGAATTCC
ATATGGCATACGACGCCGGCATCATGCAGCTGAA
A-3¢;truncate7,5¢-GGGAATTCCATATGTACGACGC
CGGCATCATGCAGCTGAAA-3¢;truncate8,5¢-GGGA
ATTCCATATGGACGCCGGCATCATGCAGCTGAA
A-3¢; truncate 9, 5¢-GGGAATTCCATATGGCCGGCAT
CATGCAGCTGAAAGGCAAG-3¢; truncate 10, 5 ¢-GGG
AATTCCATATGGGCATCATGCAGCTGAAAGGCA
AG-3¢; truncate 13, 5¢-GGGAATTCCATATGCAGCTG
AAAGGCAAGGACTTC-3¢ (Nd eI sites underlined and
start codons italicized). The PCR reverse primer was the
same in each case (5¢-TGTATAGGATCCTCAGTGATGG
TGATGGTGATGAGCGTGATAGTCTTCGAG-3¢;His
6
tag shown in bold, stop codon italicized, and BamHI
restriction site underlined). The absence of unwanted
mutations from all cloned PCR products was confirmed
by DNA sequencing.
Purification of recombinant protein B derivatives
The GST-tagged wild-type, G13Q and M12A/G13Q deriv-
atives of protein B were purified from strains of E. col i
AD
202 containing the appropriate plasmids by affinity
chromatography [16]. The GST affinity tag was removed by
the addition of thrombin [2 ng thrombinÆ(lgfusion
protein)
)1

] for 5–10 min at room temperature, after which
the recombinant protein B derivative was separated by gel
filtration with a Superdex 75 FPLC column (2.6 cm
· 61 cm; Amersham Pharmacia), eluted with 25 m
M
Mops
buffer, pH 7.
Plasmids for expression of t he His
6
-tagged p rotein B
derivatives were transformed into E. coli BL21(DE3)
(Novagen). Cells were grown, induced with isopropyl thio-
b-
D
-galactopyranoside, and soluble extracts were prepared
as described previously [16], except that the cells were
broken in 20 m
M
sodium phosphate buffer, pH 7.4–7.6,
containing 0.5
M
NaCl a nd 10 m
M
imidazole. Purification
of the His
6
-tagged protein B derivative was accomplished
using t he HisTrap
TM
kit ( Amersham Pharma cia) according

to the manufacturer’s instructions. The purified fusion
protein was then exchanged into 25 m
M
Mops buffer, pH 7,
by gel filtration as described above.
Determination of protein concentration
Concentrations of protein B and protein B¢ samples
were determined spectrophotometrically at 280 nm
using the absorption coefficients 16 839
M
)1
Æcm
)1
and
16 032
M
)1
Æcm
)1
, respectively, which were determined
experimentally by established methods [30,31]. Concentra-
tions of the h ydroxylase and reductase were determ ined by
the method of Bradford [32] using B SA as the protein
standard and commercially available reagent (Bio-Rad).
Enzyme assays
The semiquantitative naphthalene oxidation test to detect
sMMO activity in liquid c ulture samples w as performed as
previously described [ 33]. Quantitative propylene oxidation
assays using the whole sMMO complex (hydroxylase,
reductase and protein B) were performed by the method

of Pilkington & Dalton [29]. The effect of protein B
derivatives on the propylene oxidation activity of the
hydroxylase via the peroxide shunt reaction was measured
in the presence of 24 l
M
hydroxylase a nd 100 m
M
hydrogen
peroxide as published [ 14], except that the epoxypropane
product was quantified by GC of 0.5-mL gas-phase
samples.
Circular dichroism
Protein samples in 25 m
M
sodium phosphate buffer were
scanned 10 t imes in a Jasco J715 spectropolarimeter in a
1-mm path-length quartz cuvette between 190 nm and
250 nm (for far-UV CD analysis) or in a 1-cm path-length
quartz cuvette between 260 nm and 300 nm (for near-UV
CD). In all cases the response t ime w as 0.25 s and the scan
speed was 100 nmÆmin
)1
. Scans were blanked a gainst fresh
buffer recorded under the same conditions.
Fluorescence
Protein samples in 25 m
M
sodium phosphate buffer, pH 7,
were placed in a 3-mL quartz cuvette with a 10-mm path
length. Fluorescence measurements were made using a

PerkinElmer L S-50 fluorimeter at room temperature with a
scan speed of 500 nmÆmin
)1
and a n excitation wavelength of
280 nm, and scanned over the range 300–450 nm. An
accumulation of eight scans w as taken for each sample, and
scans were blanked against buffer data collected under the
same conditions.
Other methods
Protein B-associated nucleophile activity was measured at
20 °C by the protein B -dependent conversion of p-nitro-
phenylacetate to p-nitrophenol, monitored spectrophoto-
metrically at 400 nm [34]. SDS/PAGE [35] was performed
using 12% (w/v) polyacrylamide gels. SDS cell e xtracts of
Mc. c apsulatus cells were prepared from cells harvested by
centrifugation (14 000 g, 5 min, room temperature), which
were immediately resuspended in SDS/PAGE loading
buffer [65 m
M
Tris/HCl (pH 8.8), 1 m
M
EDTA, 1% (w/v)
SDS, 5% (v/v) 2-mercaptoethanol, 0.0025% (w/v) brom-
ophenol blue, 10% (v/v) glycerol] and boiled (100 °C,
5 m in) b efore c entrifugation ( 10 000 g,10min)toremove
particulate material. Preparation o f anti-(protein B) serum,
Western blotting, and E SI-MS were as described previously
[16].
RESULTS
Cleavage of protein B did not require detectable

extrinsic proteases
To determine whether the proteolytic activity responsible
for cleavage w as intrinsic or extrinsic to protein B, proteins
BandB¢ were separated from one another by chomatofo-
cusing chromatography on a Mono P column. The p rotein
B used for this separation was a highly purified sample
[prepared from Mc. capsulatus (Bath), with a specific
activity of 3500 nmolÆmin
)1
Æmg
)1
] that had undergone
partial cleavage. SDS/PAGE analysis of this sample s howed
Ó FEBS 2002 Regulation of sMMO activity (Eur. J. Biochem. 269) 1837
that it contained proteins B, B¢ and B¢¢ in the proportions
10 : 6 : 1, and MS analysis confirmed the presence of
proteins with masses of 15 852, 14 629 and 12 718 Da,
which corresponded to the calculated masses of proteins B,
B¢ and B¢¢. On chromatofocusing the sample could be
readily resolved into proteins B, B¢ and B¢¢. Immediate SDS/
PAGE analysis of the protein B fraction at this stage
showed it to be pure by Coomassie Blue s taining, and it was
active (6380 nmolÆmin
)1
Æmg
)1
) by the propene oxidation
assay. In contrast, no activity could be detected from the
fraction elu ted as protein B¢. The active protein B was then
subjected to further rounds of chromatofocusing, and on

each occasion the protein was resolved into B and B¢.
During these operations, the highly purified protein B was
observed to degrade by 50% to B¢ over a 3-h period at
20 °C. This spontaneous truncation o f highly purified
samples of protein B upon repeated repurification, despite
the absence of detectable contaminating proteins, strongly
suggested that truncation was autocatalytic.
Effect of the structure of the cleavage site
on protein B activity and the cleavage reaction
We were interested to investigate the roles of the residues
near to the cleavage site in the r ate and position of cleavage
because it seemed likely that the side chains near to the
cleavage site were important in the autocatalytic cleavage
process. We had already shown that the G13Q mutation,
which changed the amino acid immediately C-terminal to
thecleavagesite,reducedtherateoftruncationofproteinB
[16], but the precise position of cleavage in this mutant had
not been determined. A fter a preparation of the G13Q
mutant protein h ad been incubated at 20 °C for 48 h, ESI-
MS analysis revealed the presence o f two major molecular
ions, o f 1 6 300 Da (corresponding to the mass of the intact
G13Q mutant) and 14 700 Da (corresponding to the mass
of a truncate beginning at Gln13). This illustrated t hat
replacement of the small Gly13 with the bulkier, hydrophilic
Gln did not affect the principal site of cleavage of protein B,
which remained immediately N-terminal to residue 13.
To investigate the role of the residue immediately
N-terminal to the c leavage site and to see whether the
G13Q mutant could be further stabilized by removal of side-
chain functionality at this position, the M12A/G13Q

mutant was constructed. The activity of this double mutant
was indistinguishable from that of the w ild-type ( data not
shown), and ESI-MS analysis of the freshly prepared
mutant protein confirmed the predicted molecular mass of
16 240 Da. Analysis of a sample that had been incubated at
20 °C for 48 h showed that the major new molecular ion
had a mass of 14 701 Da, which corresponded to the mass
of the truncate p roduced by cleavage between amino a cids
12 and 1 3. Thus, despite radically ch anging the a mino acids
on both sides of the cleavage site, the position of c leavage
was unchanged and the protein remained active.
A surprising difference between the wild-type and mutant
forms o f p rotein B was observed during the peroxide shunt
reaction. The peroxide s hunt, which allows the hydroxylase
to be activated by hydrogen peroxide to perform oxygen-
ation reactions in the a bsence of the reductase and NADH,
is inhibited by intact wild-type protein B [14]. Just as the
stimulatory effect of protein B¢ in the whole-complex
sMMO reaction was much lower than that of intact protein
B, the inhibitory e ffect of protein B¢ during the peroxide
shunt was markedly lower than that of protein B (Fig. 1).
However, the intact G 13Q and M12A /G13Q mutant forms
of protein B, both of which had wild-type activity in the
whole-complex reaction, were significantly poorer inhibitors
of the peroxide shunt reaction than wild-type protein B
(Fig. 1 ). Thus the inhibitory effect of protein B was more
sensitive to structural changes near to the N -terminus than
its better-documented stimula tory effec t.
As previous SAXS studies had indicated t hat protein B
elongated on truncation [22], we studied the effect of

truncation on the overall conformation of protein B so as to
assess whether the inactivity of protein B ¢ is associated w ith
a conformational change. However, far-UV CD spectra of
proteins B and B ¢ were identical (data not shown), showing
that truncation caused no detectable change in the second-
ary-structure content of the protein. Likewise, near-UV CD
and fluorescence spec tra were s carcely different for proteins
BandB¢, showing little difference in the environments of
aromatic side chains between the full-length and truncated
proteins (data not shown). These data, t aken together with
the SAXS study, are consistent with a relatively minor
change in conformation on truncation of free protein B.
Similar structural studies were performed with the two
mutant forms of protein B and their respective truncates,
and the results were indistinguishable from those obtained
with the wild-type protein B/B¢ system (data not shown).
Incremental truncation of protein B
To investigate more thoroughly the role of the N-terminal
region in the t runcation reaction and in the activity o f
protein B, a series of N-terminal truncates was constructed
genetically. These all contained the stability-enhancing
G13Q mutation to minimize loss of additional amino acids
by spontaneous cleavage and h ad a C-terminal 6-His t ag to
Fig. 1. Inhibition of the p eroxide s hunt reaction by protein B and its
derivatives. Oxygenation of propylene was measured i n the presence of
the hydroxylase and hydrogen peroxide as described in Materials a nd
methods at various concentrations of intact wild -type protein B (solid
line), intact G13Q (b roken line) or M12A/G13Q (dashed line) mutan t
protein B or protein B ¢ derived from wild-type protein B (dotted
line). Enzyme activity is shown as a percentage of the activity

[9.2 nm olÆmin
)1
Æ(mg of hydroxylase)
)1
] with no added protein B. The
activities presented are the mean of three or four separate experiments.
Standard error bars a re shown.
1838 A. J. Callaghan et al.(Eur. J. Biochem. 269) Ó FEBS 2002
permit affinity purification while allowing free manipulation
of the N-terminus. ESI-MS of the full-length and truncated
proteins confirmed their integrity and showed whether the
initial methionine residue was preserved (Fig. 2). The
C-terminal His
6
tag had no effect on activity because the
activity of the full-length fusion (G13Q–His
6
)wasapprox-
imately the same as that observed f or the original G13Q
mutant with no C-terminal tag. Full activity was retained on
truncation as far as Asn5 (truncate 5), but truncation
beyond this led to progressive loss of activity until truncate
Asp8 (truncate 8), when activity was lost completely
(Fig. 3).
The c leavage of the t runcates was analysed t o investigate
the role of the N-terminal region in the cleavage process.
ESI-MS analysis was performed at 24-h intervals during
incubation at 20 °C over 6 days. The full-length construct
G13Q-tag was detectable for 3 days. Truncate 4 was less
stable, having completely degraded to truncates within 24 h,

whereas the shorter truncates 5, 6 and 7 w ere still observed
in uncleaved form after 6 days. Further truncation beyond
this, to t runcates 8 and 9, which abolished activity, also
enhanced the cleavage reaction, which was complete within
24 h. General d estabilization or reorganization of the
secondary structure of the truncated forms was unlikely to
be the cause of their destabilization o f the truncates because
the far-UV CD spectra for truncates 7 (stable) and 8
(rapidly cleaving) w ere indistinguishable a nd very similar to
that of native, intact protein B ( data not shown). Truncates
10 and 13, both of w hich retained the scissile Met12–Gln13
peptide bond (Fig. 2), were as stable for a t least 6 days,
showing t hat at least four of the amino acids N-terminal t o
the cleavage site are required for rapid autocatalytic
cleavage.
Mechanism of autocatalytic cleavage
The probable autocatalytic mechanism of cleavage of
protein B posed the question o f which intrinsic groups on
protein B were responsible for the reaction. Recent r esearch
has identified autoprocessing reactions in other systems,
such as aminohydrolase and aspartate decarboxylase, which
rely on the formation and r esolution of internal (thio) e sters
[36,37]. In these examples, a nucleophilic amino a cid
(cysteine, serine or threonine) rearranges within th e protein,
thus replacing the amide peptide bond between itself and t he
preceding amino acid with a more reactive thioester or ester
linkage. Such bonds then hydrolyse spontaneously and thus
effect cleavage [38–40].
In wild-type protein B, the a mino acid on the C-terminal
side of the c leavage site is g lycine and so n ucleophilic attack

from this site is impossible. Nevertheless, it was possible that
cleavage of protein B occured v ia a similar chemical
mechanism, initiated by attack from a nucleophile elsewhere
in the p rotein. This w ould transfer t he N-terminal region of
the protein on to a (thio)ester linkage on the nucleophile,
which would t hen spontaneously hydrolyse to yield the
truncated protein (Fig. 4).
To investigate the feasibility of such a mechanism, the
protein was tested for the presence of accessible nucleo-
phile(s) by reac tion with p-nitrophenylacetate, which reacts
with nucleophilic groups to form p-nitrophenol [34]. The
results (Fig. 5) indicated that a nucleophilic group was
indeed present, because an increased reaction rate of
p-nitrophenol formation was observed in the presence of
increasing concentrations of protein B. Control reactions
(Fig. 5 ) confirmed that the rate of p-nitrophenol production
was significantly higher than the background rate that was
observed in the absen ce of p rotein or when denatured
(boiled) protein B or the hydroxylase were used.
Detection of protein B¢
in vivo
To investigate the in vivo significance of truncation of
protein B, sMMO-expressing Mc. capsulatus (Bath) whole
cells were analysed for the presence of proteins B and B¢.
Mc. c apsulatus (Bath) was cultivated under low-copper,
oxygen-limiting conditions as described in Materials and
methods. A positive naphthalene oxidation t est confirmed
the expression of s MMO because pMMO is inactive with
this substrate [33]. The cells were rapidly harvested and
Fig. 2. Deduced N-terminal sequences o f the incremental truncates of

protein B , each o f which was constructed in the G13Q background and
had the C-terminal 6-His tag. The presence of the initial m ethion ine
residues (sh own in bold) was determined experimentally by ESI-MS.
The site o f cleavage f or formation of protein B ¢ is indic at ed.
Fig. 3. Effect of incremental truncation on the activity of protein B.
Activity was measured as the rate of propene oxygenation in the
presence o f e x cess h ydroxylase a nd reductase and is shown as a per-
centage o f th e ac tivity [1 956 n m olÆmin
)1
Æ(mg p rotein B)
)1
]observed
with the G13Q mutant prepared using the GST-tag system (G13Q).
The activities presented are the mean of t hree or four s eparate exper-
iments. Standard error bars are shown.
Ó FEBS 2002 Regulation of sMMO activity (Eur. J. Biochem. 269) 1839
immediately boiled in SDS-containing sample-loading buf-
fer, thus capturing the cellular proteins with minimal
opportunity for degradation before exposure to the dena-
turant. SDS/PAGE and Western-blotting analysis, using
anti-(protein B) sera (that cross-reacted with protein B¢),
clearly s howed that protein B¢ was present in vivo in
sMMO-expressing cells of Mc. capsulatus (Bath) (Fig. 6).
Control samples from pMMO-expressing cells (grown
Fig. 4. Proposed m echanism for autocatalytic
cleavage o f protein B . A n ucleophilic side
chain, probably on t he surface of the folded
core region of protein B, is proposed to attack
the carbonyl g rou p of the s cissile peptide
bond. Cleavage then follows via cyclic zwitte-

rion and e ster intermediates as i ndicated.
Fig. 5. Nucleophilic activity of p rotein B. Formation of p-nitropheno l
from p-nitrophenyl acetate was m onitored spec trophot ometrically as
described in Mate rials and M ethods. T he reac tion mixtures c ontained
protein B at 1 mgÆmL
)1
(dotted line), protein B at 0.5 mg ÆmL
)1
(broken line), boiled protein B at 1 mgÆmL
)1
(dashed line), h ydroxy-
lase at 1 mg ÆmL
)1
(broken/dotted line) and no p rotein (solid line).
Fig. 6. Detection o f protein B in vi vo. Western b lot probed with a nti-
(protein B) sera showing SDS cell extracts of Mc. capsulatus (Bath)
from fermentor cultures expressing (lane 1) sMMO and (lane 2)
pMMO (negative control containing no protein B or B¢). Molecular
masses of standards are indicated in kDa.
1840 A. J. Callaghan et al.(Eur. J. Biochem. 269) Ó FEBS 2002
under high-copper conditions), which did not exhibit
sMMO activity, confirmed t hat the proteins that reacted
with the antisera corresponded to proteins B and B¢.
These results strongly suggested that protein B degraded
to B¢ in viv o and were consistent with the hypothesis t hat th e
cleavage reaction may serve to control the in vivo activity of
sMMO. One possibility w as that conversion of protein B to
B¢ may a ccount, at least in part, for the observed inactiva-
tion of sMMO when the growth-medium copper concen-
tration was increased, which also causes cessation of sMMO

expression and i nduces the copper-dependent pMMO, via
the so-called c opper switch [2,41]. Experiments were there-
fore conducted to determine whether addition of copper to a
Mc. c apsulatus (Bath) culture altered the cellular levels of
proteins B and B¢ during the switch from sMMO to pMMO
expression. The a bundances of proteins B and B¢ remained
constant throughout the t ime course, even until the cells
began to express pMMO, and so formation of protein B¢
did not appear to control the activity of sMMO during t he
copper switch.
DISCUSSION
Mechanism of truncation
Previous o bservations that protein B underwent cleavage
during purification re gardless of whether it had been
expressed in Mc. capsulatus or E. coli,evenwhenthe
protein h ad been purified to apparent homogeneity [16], had
shown that either truncation w as autocatalytic o r the
peptide bond between amino acids 12 a nd 13 was unusually
susceptible t o digestion by very small amounts of extrinsic
proteases. Here, by demonstrating that repeatedly repurified
protein B con tinued to undergo cleavage, we have provided
strong evidence that the cleavage reaction is independent of
the presence of contaminating proteins and so is almost
certainly autocatalytic.
The insensitivity of the position o f cleavage to the amino-
acid sequence a round the c leavage site implies t he involve-
ment of other parts of the structure in determining the
sensitivity of the scissile peptide bond to cleavage. Intrinsic
nucleophilic activity within protein B is consistent with a
cleavage mechanism that proceeds via an intramolecular

rearrangement b eginning with attack on the scissile peptid e
bond by a n ucleophilic amino-acid side chain elsewhere in
the protein (Fig. 4 ). Thus we are able to p ropose the first
credible mechanism for autocatalytic cleavage of protein B .
This could explain both t he occurrence o f cleavage and its
position, determined by distance constraints when t he
flexible N-terminal region approaches the nucleophile,
which we suspect resides on the core of the p rotein. The
core of protein B [23] has 12 exposed potential nucleophiles
(serines 34, 44, 92, 109, 110, 126; t hreonines 36, 49, 57, 68,
111, 117, 123, 125 ; cysteine 88), all of which are exposed to
the solvent, and so the precise residue(s) involved cannot
currently be assign ed. The residues flanking the cleavage site
do affect t he rate o f cleavage, perhaps by altering the steric
accessibility of the scissile peptide linkage to the nucleophile.
It was also interesting to note that, as the protein was
progressively shortened from the N-terminus, a marked
decrease in stability w as observed conco mitant with loss of
activity, but stability was re stored after removal of a further
two amino acids. If binding of protein B to the hydroxylase
prevented the N-terminal region from approaching the
nucleophilic group (e.g. by the nucleophile being occluded
by binding to the hydroxylase) the presence of the
hydroxylase may also serve to stabilize protein B.
Role of the N-terminus in catalysis
By constructing a series of incremental truncates, we have
shown that the amino acids from the N-terminus to Ser4 are
not required for catalysis. As truncation beyond Ser4 led to
progressive loss of activity until the truncate that began with
Asp8 (truncate 8), which w as inactive, the critically impor-

tant N-terminal region appears to correspond to Ser4-Asn5-
Ala6-Tyr7. We presume t herefore that the p resence of these
residues is essential for protein B to induce the conforma-
tional change in t he hydroxylase w hereby it exer ts its e ffect
on catalysis. It is also possible that one or more of these
residues is directly involved in the pathway for electron
transfer between the reductase and the hydroxylase. Precise
assignment of the essential N-terminal residues is problem-
atic because not all the truncates retained the initiating
methionine. For instance, i t is difficult to assess the role of
Tyr7 because truncate 7 h ad the initial methionine but
truncate 8 did n ot.
NMR a nalysis of protein B from Mc. capsulatus (Bath)
in the presence of the hydroxylase indicated that t he
structured co re region of protein B interacted with the
hydroxylase but gave no indication of the involvement of
the N-terminus [23]. This was difficult to reconcile with the
observed critical importance o f the N-terminal region in the
functional [26] and physical [16] interaction o f protein B
with the hydroxylase. O ne possibility was that the structure
of the c ore r egion was different in proteins B and B¢.The
available structural data, however, lend litt le weight to this
theory. SAXS data suggested elongation o f the overall
structure of protein B on truncation [22], but CD and
fluorescence spectroscopy showed that any change in
conformation on truncation must be extremely slight.
Recent NMR results with the sMMO system from
Ms. t richosporium OB3b [42], however, have shown that
the N-terminal region of protein B does i ndeed interact with
the hydroxylase. In the presence o f the hydroxylase, NMR

signals due to His4 (equivalent to Ser4 in the Mc. capsulatus
system) and Tyr7 (which is conserved in both Ms. trichos-
porium and Mc. capsulatus) broadened, indicating interac-
tion with the hydroxylase. T hese assignments a re consistent
with our incremental truncation studies, w hich showed that
the f unctionally important residues lay in the region Ser4–
Tyr7. Signals due to His32, which is toward the inner end of
the flexible N-terminal region, were also perturbed by the
presence of the hydroxylase, again indicative of binding [42],
although analysis o f the function of this residue is not
accessible v ia the incremental truncation m ethod u sed here.
The NMR study indicated that the isolated 29 N-terminal
residues of protein B bound to the hydroxylase in a
manner that was competitive w ith the full-length protein B
[42]. C onversely, an artificially synthesized dodecapeptide
corresponding to amino acids 1–12 of protein B
(SVNSNAYDAGIM, which was purified to homogeneity
and confirmed b y ESI-MS to have a molecular mass of
1241.3 D a), did not restore function to protein B¢ [43]. Thus
it is possible that t he N-terminus and core of protein B can
bind independently to the hydroxylase, but the covalent
Ó FEBS 2002 Regulation of sMMO activity (Eur. J. Biochem. 269) 1841
connection between them is needed to induce the required
conformational change in the hydroxylase.
It is also intriguing that the capacity of protein B to
activate the h ydroxylase d uring the whole-complex sMMO
reaction was not affected by changes to the amino acids
flanking the site of cleavage for protein B¢ formation, b ut
the inhibitory effect of intact protein B in th e p eroxide shunt
reaction was diminished by s uch mutations. This suggests a

fundamental difference in the nature of the interactions
required for the stimulatory and inhibitory effects o f protein
B. Either the two types of effect result from binding at
different sites on the hydroxylase, or the conformational
change that the mutant forms elicit in the hydroxylase is
different from that elicited by the wild-type such that the
inhibitory effect alone is diminished.
Biological significance of truncation
All known s MMOs require a protein B component for f ull
activity, a nd o ther homologous binuclear iron active-centre
mono-oxygenases also have an essential regulatory protein
that is, like protein B of sMMO, a small protein without
prosthetic groups [44]. The susceptibility of protein B and
other regulatory p roteins (such as the regulatory protein o f
alkene monooxygenase from Rhodococcus rhodochrous
B-276 (S. C. Gallagher & H. Dalton, unpublished observa-
tions) to inactivation by proteolytic degradation offers a
mechanism by which their activity, and hence the activity of
the whole enzyme complex, could be controlled. It also
offers an explanation for the persistence of the regulatory
components during evolution.
In t he c ase o f sMMO, autocatalytic cleav age may ensure
that the half-life of active protein B is s hort, and so the
activity of protein B could be controlled at the transcrip-
tional or translational levels with minimal lag time.
Alternatively, other factors in the cell may control the rate
of autoproteolysis of protein B, in response to environ-
mental factors or the metabolic state of the cell. It is
interesting to note that the protein B of Ms. trichosporium
OB3b is much less susceptible to cleavage tha n that of

Mc. capsulatus (Bath) and that the truncated form of the
Ms. trichosporium protein is not observed in vivo during
growth using sMMO (A. J. Callaghan, S. E. Slade & H.
Dalton, unp ublished observations). Also, although protein
BfromMethylocystis sp. strain M does undergo N-terminal
truncation, this is prevented b y protease inhibitors [45].
Thus, it may be that the importance o f truncation of protein
B in determining sMMO activity differs among the sMMO-
expressing methanotrophs.
As proteins B and B¢ were observed in vivo at comparable
levels during steady-state g rowth of Mc. capsulatus (Bath),
truncation of protein B is evidently a significant factor in
determining the amount of active protein B in the cell. It was
suspected that t runcation of p rotein B p layed a role in the
observed rapid inactivation of sMMO when the copper
concentration of the medium was increased, i n advance of
the induction of the copper-dependent pMMO via the
copper switch. However, the abundance of proteins B and
B¢ was unchanged even after d etectable sMMO activity had
been lost and pMMO induced (data not shown), so it
appears t hat truncation of protein B does not play a role in
controlling sMMO activity during the copper switch. It
remains to b e demonstrated whether regulation of sMMO
by other factors, such as starvation and other metabolic
stresses, is effected in vivo via t runcation of protein B.
ACKNOWLEDGEMENT
This work was funded through a Biotechno logy and Biological Sciences
Research Council (BBSRC) Studentship to A. J. C.
REFERENCES
1. Hanson, R.S. & Hanson, T.E. (1996) Methanotrophic bacteria.

Microbiol. Rev. 60, 439–471.
2. Stanley, S.H., Prior, S.D., Leak, D.J. & Dalton, H. (1983) Copper
stress underlies the fundamental change in intracellular location of
methane monooxygenase in methane-oxidizing organisms: studies
in batch and continuous cultures. Biotechnol. Lett. 5, 487 –492.
3. Green, J . & Dalton, H . (1985) Protein B of soluble methane
monooxygenase from Methylococcus capsulatus (Bath): a novel
regulatory protein of enzyme activity. J. Biol. Chem. 260, 15795–
15801.
4. Dalton, H., Smith, D.D.S. & Pilkington, S.J. (1990) Towards a
unified mechanism of biological methane oxidation. FEMS
Microbiol. Rev. 87, 201–208.
5. Woodland, M.P., Patil, D.S., Cammack, R. & Dalton, H. (1 986)
Electron-spin-resonance studies of protein A of the soluble
methane monooxygenase from Methylococcus capsulatus (Bath).
Biochim. Bioph ys. Acta 873, 237–242.
6. Rosenzweig, A.C., Frederick, C.A., Lippard, S.J. & Nordlund, P.
(1993) Cry stal structure of a b acterial nonheme iron hydroxylase
that catalyzes t he biologic al oxidation of methane. Nature 36 6 ,
537–543.
7. Colby, J. & D alton, H. (1978) Resolution of the m ethane mono-
oxygenase of Methylococcus capsulatus (Bath ) into three c ompo-
nents. Biochem. J. 171, 461–468.
8. Lund, J ., Woodland, M.P. & Dalton, H. (1 985) Electron-transfer
reactions in the soluble m ethane monooxygenase of Methylo-
coccus ca psulatus (Bath). Eur. J. Biochem. 147, 297–305.
9. Liu, K.E. & Lipp ard, S.J. (1991) Redox properties of the hydro-
xylase component of methane monooxygenase from Methylo-
coccus capsu lat us (Bath): effects of protein B, reductase, and
substrate. J. Biol. Chem. 266 , 12836–12839.

10. Kazlauskaite, H ., Hill, H.A.O., Wilkins, P.C. & Dalton, H. (1996)
Direct electrochemistry of the hydroxylase of soluble methane
monooxygenase from Methylococcus capsulatus (Bath). Eur. J.
Biochem. 241, 552– 556.
11. Liu, Y., Nesheim, J.C., Lee, S K. & Lipscomb, J.D. (1995) Gating
effects of component B on oxygen activation by the methane
monooxygenase hydroxylase component. J. Biol. C hem. 270,
24662–24665.
12. Liu, K.E., Valentine, A.M., Wang, D.L., Huynh, B.H.,
Edmondson, D.E., Salifoglou, A. & Lippard, S.J. (1995) Ki netic
and spectroscopic characterization of intermediates a nd compo-
nent inte ractions in reactions o f m ethan e m onooxygenase from
Methylococ cus capsulatus (Bath). J. Am. Chem. Soc. 117, 10174–
10185.
13. Valentine, A.M., S tahl, S.S. & Lippard, S.J. (1999) Mechanistic
studies of the reaction of reduced methane monooxygenase
hydroxylase with dioxygen and substrates. J. Am . Chem. Soc. 121,
3876–3887.
14. Jiang, Y., Wilkins, P.C. & Dalton, H. (1993) Activation of the
hydroxylase o f s MMO from Methylococcus capsulatus (Bath) by
hydrogen peroxide. Biochim. Biophys. Acta 116 3, 105–112.
15. Froland, W.A., Andersson, K.K., Lee, S K ., Liu, Y. & L ipscom b,
J.D. (1992) Methane m onooxygenase component B and reductase
alter the r egioselectivity of the hydroxylase component-catalyzed
reactions: a novel role for protein–protein interactions in an
oxygenase mechanism. J. Biol. Chem. 267, 17588–17597.
1842 A. J. Callaghan et al.(Eur. J. Biochem. 269) Ó FEBS 2002
16. Lloyd, J.S., Bhambra, A., Murrell, J.C. & Dalton, H. (1997)
Inactivation of the regulatory protein B of soluble methane
monooxygenase from Methylococcus capsulatus (Bath) by pro-

teolysis can be overcome by a G ly to Gin modification. Eur. J.
Biochem. 248, 72–79.
17. Gassner, G .T. & L ippard, S.J. (1999) Component interactions in
the s oluble m ethane m onooxygenase system from Methylococcus
capsulatus (Bath). Biochemistry 38, 12768–12785.
18. Fox, B.G., Liu, Y., Dege, J.E. & Lipscomb, J.D. (1991)
Complex formation between the protein components of methane
monooxygenase from Methylosinus trichosporium OB3b: i dentifi-
cation of sites of component interaction. J . Biol. Chem. 266, 540–
550.
19. Davydov, A ., Davydov, R., Gra
¨
slund, A., Lipscomb, J.D. &
Andersson, K.K . (1997) Radiolytic re duction of methane mon o-
oxygenase dinuclear iron cluster at 77 K: EPR evidence for con-
formational change upon reduction or binding of component B to
the diferric s tate. J. Biol. Chem. 272, 7022–7026.
20. Davydov, R., Valentine, A.M., Konar-Panicucci, S., Hoffman,
B.M. & Lippard, S.J. (1999) An EPR study of the dinuclear iron
site in the soluble methane monooxygenase from Methylococcus
capsulatus (Bath) re duced by one electron at 77 K: the effe cts o f
component i nteraction s and the binding of small m olecules to the
diiron ( III) center. Biochemist ry 38, 4188–4197.
21. Coates-Pulver, S., Froland, W.A., L ipscomb, J.D. & Solomon,
E.I. (1997) Ligand fi eld c ircular d ichroism and m agnetic c ircular
dichroism studies of component B and substrate binding to the
hydroxylase component of m ethane monooxygenase. J. Am.
Chem. Soc. 119, 387–395.
22. Gallagher, S.C., Callaghan,A.J., Zhao, J., Dalton, H. & Trewhella,
J. (1999) Global conformational changes control the reactivity

of methane monooxygenase. Biochemistry 38, 6 752–6760.
23. Walters, K .J., Gassner, G.T., Lippard, S.J . & W agner, G. ( 1999)
Structure of t he soluble m ethane monooxygenase regulatory
protein B. Proc. N atl Acad. Sci. USA 96, 7877–7882.
24.Rosenzweig,A.C.,Brandstetter,H.,Whittington,D.A.,
Nordlund, P., Lippard, S.J. & Frederick, C.A. (1997) Crystal
structures of the methane monooxygenase h ydroxylase from
Methylococcus capsulatus (Bath): implications for substrate gating
and component interactions. Proteins 29 , 141–152.
25. Elango, N., Radhakrishnan, R., Froland, W.A., Wallar, B.J.,
Earhart, C.A., Lipscomb, J.D. & Ohlendorf, D.H. (1997) Crystal
structure of the hydroxylase component of methane mono-
oxygenase from Methylosinus trichosporium OB3b. Prot. Sci. 6,
556–568.
26. Pilkington, S.J., Salmond, G.P.C., Murrell, J.C. & Dalton, H.
(1990) Identification of the gene encoding the regulatory protein B
of soluble methane m onooxyge nase. FEMS Microbiol. Lett. 72,
345–348.
27. Brandstetter, H., W hittington , D.A., Lippard, S.J. & Frederick,
C.A. (1999) Mutational and structural analyses o f the regu latory
protein B of soluble methane monooxygenase from Methylococcus
capsulatus (Bath). Chem. Biol. 6, 441–449.
28.Maniatis,T.,Fritsch,E.F.&Sambrook,J.(1982)Molecular
Cloning: a Laboratory Manual. Cold Spring Harbor Labora tory
Press, New York.
29. Pilkington, S.J. & Dalton, H. (1990) Soluble methane mono-
oxygenase from Methylococcus capsulatus Bath. Methods
Enzymol. 188 , 181–190.
30. Whittaker, J.R. & Granum, P.E. (1980) An absolute method for
protein d etermination b ased o n d iffe rences o f a bsorbance at 235

and 280nm. Anal. Biochem. 109 , 156–159.
31. Scopes, R.K. (1974) Measure ment of protein by sp ectrophoto m-
etry at 205 nm. Anal. Biochem. 59 , 277–282.
32. Bradford, M.M. (1976) A r apid and sensitive method for t he
quantitation of microgram quantities of protein utilizing the
principle of dye bin ding. Anal. Biochem. 72 , 248–254.
33.Bodrossy,L.,Murrell,J.C.,Dalton,H.,Kalman,M.,Puskas,
L.G. & Kovacs, K.L. (1995) Heat-tolerant methanotrophic bac-
teria f rom the hot-wat er effluent of a natural-gas field. Appl.
Environ. Mi crobiol. 61, 3549–3555.
34. Balls, A.K. & Wood, H.N. (1956) Acetyl chymotrypsin and its
reaction with ethan ol. J. Biol. Chem. 219, 2 45–256.
35. Laemmli, U.K. (1970) Cleavage of structural proteins during
the assembly o f th e h ead o f b acteriophage T4. Nature 227, 680–
685.
36. Perler, F.B. (1998) Breaking up is easy with esters. Nat. Struct.
Biol. 5, 249–252.
37. Stoddard, B.L. & Pietrokovski, S. (1998 ) B reaking up i s h ard t o
do. Nat. Struct. Biol. 5, 3–5.
38. Duggleby, H.J., T olley, S.P., H ill, C.P., Dodson, E.J., D odson, G.
& Moody, P .C. (1995) Penicillin acylase has a single-amino-acid
catalytic center. Nature 373, 264–268.
39. Guan,C.D.,Cui,T.,Rao,V.,Liao,W.,Benner,J.,Line,C.L.&
Comb, D. (1996) Activation of glycosylasparaginase: formation of
active N-terminal threonine by intramolecular autoproteolysis.
J. Biol. Chem. 27 1, 1732–1737.
40. Ramjee, M.K., Genschel, U., Abell, C. & Smith, A.G. (1997)
Escherichia coli
L
-aspartate-a-decarboxylase: preprotein process-

ing and observation of r eaction i ntermediates by e lectro spray mass
spectrometry. Biochem. J. 323 , 661–669.
41. Nielsen, A.K., Gerdes, K., Dega, H. & Murrell, J.C. (1996)
Regulation of bacterial methane oxid ation: transcription of the
soluble methane monooxygenase operon of Methylococcus
capsulatus (Bath) is repressed by copper ions. Microbiology 142,
1289–1296.
42. Chang, S L., Wallar, B.L., Lipscomb, J.D. & Mayo, K.H. (2001)
Residues in Methylosinus trichosporium OB3b methane mono-
oxygenase component B involved in molecular interactions with
reduced- and oxidized-hydroxylase com ponent: a role for t he
N-terminus. Biochemistry 40, 9539–9551.
43. Bhambra, A. (1996) The regulatory protein of methane mo no-
oxygenase. PhD Thesis, U niversity of Warwick.
44. Zhou, N.Y., Jenkins, A., Chion, C.K.N.C.K. & Leak, D.J. (1999)
The alkene monooxygenase from Xanthobacter strain Py2 is
closely related to aromatic monooxygenases and ca talyzes
aromatic monohydroxylation of benzene, toluene, and phenol.
Appl. Environ. Microbiol. 65 , 1589–1595.
45. Shinohara, Y., Uchiyama, H., Yagi, O . & Kusakabe, I. (1998)
Purification and characterization of component B of a soluble
methane monooxygenase from Methylocystis sp. M. J. Ferment.
Bioeng. 85 , 37–42.
Ó FEBS 2002 Regulation of sMMO activity (Eur. J. Biochem. 269) 1843