Báo cáo khoa học: Purification, characterization and biosynthesis of parabutoxin 3, a component of Parabuthus transvaalicus venom pptx

Purification, characterization and biosynthesis of parabutoxin 3,
a component of
Parabuthus transvaalicus
venom
Isabelle Huys
1
, Karin Dyason
2
, Etienne Waelkens
3
, Fons Verdonck
4
, Johann van Zyl
5
, Johan du Plessis
2
,
Gert J. Mu¨ ller
5
, Jurg van der Walt
2
, Elke Clynen
6
, Liliane Schoofs
6
and Jan Tytgat
1
1
Laboratory of Toxicology, University of Leuven, Leuven, Belgium;
2
Department of Physiology, University of Potchefstroom,

Potchefstroom, South Africa;
3
Laboratory of Biochemistry, University of Leuven, Leuven, Belgium;
4
Interdisciplinary Research
Centre, University of Leuven Campus Kortrijk, Kortrijk, Belgium;
5
Department of Pharmacology, University of Stellenbosch,
Tygerberg, South Africa;
6
Laboratory for Developmental Physiology and Molecular Biology, University of Leuven, Belgium
A novel peptidyl inhibitor of voltage-gated K
+
channels,
named p arabutoxin 3 (PBTx3), has been purified to homo-
geneity from the venom of Parabuthus transvaalicus. This
scorpion toxin contains 37 residues, has a mass of 4274 Da
and displays 41% identity with charybdotoxin (ChTx, also
called Ôa-KTx1.1Õ). PBTx3 is the tenth member (called
Ôa-KTx1.10Õ)ofsubfamily1ofK
+
channel-blocking pep-
tides known thus far. Electrophysiological experiments using
Xenopus laevis oocytes indicate that PBTx3 is an inhibitor of
Kv1 c hannels (Kv1.1, Kv1.2, Kv1.3), but has no detectable
effects on Kir-type and ERG-type channels. The dissoci-
ation constants ( K
d
) for Kv1.1, Kv1.2 and Kv1.3 channels
are, respectively, 79 l

M
,547n
M
and 492 n
M
. A synthetic
gene encoding a PBTx3 homologue was designed and
expressed a s a fusion protein with the maltose-binding pro-
tein ( MBP) in Escherichia coli. T he recombinant p rotein was
purified from the b acterial p eriplasm compartment using an
amylose affinity resin column, followed by a gel filtration
purification step and cleavage by factor X
a
(fX
a
) to release
the recombinant toxin peptide (rPBTx3). After final purifi-
cation and refolding, rPBTx3 was shown to be identical to
the native P BTx3 with respect to HPLC retention time, mass
spectrometric analysis and functional properties. The three-
dimensional structure of PBTx3 is proposed by homology
modelling to contain a double -stranded antiparallel b sheet
and a single a-helix, connected by three disulfide bridges.
The scaffold of PBTx3 i s homologous to most other a-KTx
scorpion toxins.
Keywords: Parabuthus; purification; synthesis; scorpion;
toxin.
The southern African scorpion Parabuthus tr ansvaalicus
Purcell, 1 899, is one of the largest scorpions belonging t o t he
Buthidae family [1], subphylum C helicerata, order S cor-

pionis. Severe envenomation with P. transvaalicus causes
primarily neuromuscular effects with involvement of the
heart and parasympathetic nervous system [2], illustrating
that this scorpion can be potentially lethal, especially for
children. P. g ranulatus scorpionism has been described by
Mu
¨
ller [3]. P. transvaalicus scorpionism is clinically similar,
but appear s to p roduce s lightly more m otor and fewer
sensory symptoms [4]. Crude, diluted venom of P. t rans-
vaalicus was already tested on isolated cardiomyocytes and
induced an increase in the sodium current an d a retardation
of the time c ourse of inactivation, implicating t he presence
of an a-toxin [5]. Verdonck et al. [6] reported the occurrence
of pore-forming activity in the venom of P. transvaalicus,
but th e variability was rather high and i n s ome s pecimens
this activity was absent .
A study was undertaken to find compounds or toxins in
the venom of P. transvaa licus that modulate physiological
processes a t the cellular level; t his w as done for the following
reasons: (a) very little is known about the bioactive
substances present in the venom of this scorpion [7,8]; (b)
the discovery of new toxins can be the key to gain insight
into the molecular mechanisms of scorpionism; (c) selective
toxins can be u sed f or purifying channels from native tissue,
determining their subunit composition [9] and for e lucida-
ting the pharmacology and physiological roles of voltage-
dependent Na
+
,Ca

2+
and K
+
channels [10–12] i n target
tissues. Voltage-dependent K
+
channels in particular serve
important functions in many signal-transduction pathways
in the nervous system: they are involved in neuron
excitability; they influence the resting membrane potential,
the waveforms and frequencies of action potentials; and
they determine the thresholds of excitation [13]. Moreover,
they are the putative target sites in t he design of therapeutic
drugs [14].
In our work, a new short-chain toxin acting on Kv1
channels, called p arabutoxin 3 (PBTx3), has been purified
to homogeneity from the venom of P. transvaalicus and its
specific function on different channels has been analysed
electrophysiologically. Using a recombinant expression
system, t he toxin was produced in high quantity to confirm
our data and to facilitate t he screening of the active peptide
Correspondence to J. Tytgat, Laboratory o f Toxicology, University
of Leuven, E. Van Evenstraat 4, 3000 Leuv en, Belgium.
Fax: + 32 16 3 2 34 05, Tel.: + 32 16 32 34 03,
E-mail:
Abbreviations: PBTx3, toxin from th e venom of th e scorpion
Parabuthus transvaalicus;AgTx2,toxinfromthevenom
of the scorpion Leiurus quinquestriatus var. Hebraeus; MBP,
maltose-binding protein; fXa, factor Xa.
Note: a website is available at

(Received 3 1 December 2001, accepted 12 February 2002)
Eur. J. Biochem. 269, 1854–1865 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.02833.x
PBTx3. In this way, a study of the structure–function
relationship of PBTx3 to different ion channels and
receptors could be performed and a structural model for
this novel toxin has been proposed.
MATERIALS AND METHODS
Venom collection and purification
P. transvaalicus scorpions were captured in South Africa.
Venoms were c ollected by electrical s timulation and lyophi-
lized after dilution in a saline buffer or distilled w ater. The
lyophilized venom was dissolved in 100 m
M
ammonium
acetate, pH 7 (Merck, Germany). After vortexing, the
sample was clarified by centrifugation at 12 000 g for
15 min and its supernatant was submitted t o gel filtr ation
(Fig. 1 A) using a Superdex 30 prep grade HiLoad 16/60
FPLC column (Pharmacia LKB Biotech, Sweden) equili-
brated with 100 m
M
ammonium acetate, pH 7. The mate-
rial was eluted w ith t he same buffer at a flow r ate of
0.2 m LÆmin
)1
. A bsorbance of the eluate was monitored at
280 nm and 4-mL fractions were collected automatically.
The fraction c ontaining the toxin was recovered, lyophilized
andappliedonaPepRPCHR5/5C
2

/C
18
reversed-phase
FPLC column (Pharmacia, Sweden) equilibrated w ith 0 .1%
trifluoroacetic acid (TFA, Merck Eurolab, Belgium) in
distilled w ater (Fig. 1B). Separation w as perform ed by u sing
a linear gradient o f 0–50% UV-grade acetonitrile (LiChro-
SolvÒ gradient grade, Merck Eurolab), supplemented w ith
0.1% TFA, for 30 min. The flow rate was 0.5 mLÆmin
)1
and the absorbance was measured at 214 nm. Fractions
between 17 and 23 min with potential short-chain toxins
were r ecovered, dried (Speed Vac Ò Plus, S avant, U SA), and
applied t o a monomeric 238TP54 C
18
reversed-phase HPL C
column (Vydac, USA) equilibrated with 0 .1% trifluoroacetic
acid in distilled w ater (Fig. 1C). Separation was performed
as follows: after 4 min a linear gradient to 30% acetonitrile,
for 2 min, followed by a linear gradient to 42% for the final
8 m in (total run, 14 min). The flow rate was 0.75 mLÆmin
)1
and the absorbance was measured simultaneously at 214,
254 and 280 nm. The toxin-containing fraction (see Fig. 1C)
was recovered and dried (Speed Vac Ò Plus).
Sequence determination
The first 3 6 residues of the primary s tructure of the peptide
were resolved by direct sequencing (Edman degradation)
(Fig. 2A). A glass fibre disk was coated with Biobrene
(Applied Biosystems) and p recycled for four cycles. Subse-

quently, the sample (18 pmol) was loaded onto the glass
fibre disk and subjected to N-terminal amino-acid sequenc-
ing o n a Perkin Elmer/Applied Biosystems Procise 492
microsequencer (PE Biosystems) running in pulsed liquid
mode. T o identify the las t C-terminal residue, a sample of
peptide was also cleaved by cyanogen bromide. By this
reaction, three fragments were produced (E
1
–M
4
,R
5
–M
28
and N
29
–R
37
), separated by HPLC by using the s ame C
18
analytical column as described above, and then sequenced.
The last amino acid (arginine) was elucidated.
Construction of the recombinant genes
A cDNA fragment encoding a 36 amino-acid peptide,
corresponding to PBTx3 without the C-terminal arginine,
was designed as follows (Fig. 3A). Two overlapping
oligonucleotide pairs 5¢-GAGGTCGACATGCGCTGCA
AGTCGTCGAAGGAGTGCCTGGTCAAGTGCAAG
CAG-3¢,3¢-CTCCAGCTGTACGCGACGTTCAGCAG
CTTCCTCACGGACCAGTTCACGTTCGTCCGCTG

CCCGGCC-5¢,and5¢-GCGACGGGCCGGCCGAACG
GCAAGTGCATGAACCGGAAGTGCAAGTGCTAC
CCGTGAG-3¢,3¢-GGCTTGCCGTTCACGTACTTGGC
CTTCACGTTCACGATGGGCACTCCTAG-5¢,respect-
ively, ranging in length from 49 to 66 base p airs, were
synthesized chemically on an Applied Biosystem d evice
(Amersham Pharmacia Biotech, The Netherlands), purified
by PAGE and phosphorylated at the 5¢ end. The c omple-
mentary oligomers (100 pmol of each) were annealed to
generate two duplexes that were ligated using T4 DNA ligase
(NEB). The synthetic PBTx3 gene was inserted into the
vector pMAL-p2X (NEB) downstream from the ma lE gene
of Escherichia coli and also d irectly downstr eam of a fX
a
site
Fig. 1. Purification of native PBTx3 from the venom of P. transvaali-
cus. (A) Crude ven om was first fractionated by FPLC gel filtration,
yielding four peaks. The labelled fraction (*) was recovered and lyo-
philized. B ased on a constructed gel filtration calibration curve, the
molecular mass of the material in this fraction ranged fr om 3 to 6 kDa.
(B) T he second p urificat ion step was carried out usin g a FPLC C
2
/C
18
reversed-phase column. Fractions eluting at 17–23 min (*) contain
ÔpotentialÕ short-chain toxins an d were rec overed an d dried. (C) Th e
third step involved a H PLC C
18
reversed-phase purification.
Ó FEBS 2002 Novel K

+
channel blocker parabutoxin 3 (Eur. J. Biochem. 269) 1855
into a XmnI site. The gene possessed an overhang at the
3¢ end ( BamHI) t o d irect the orientation of the i nsert into
pMAL-p2X. The transformants c ontaining the correctly
constructed DNA fragments for PBTx 3 were analysed by
digestion with two different restriction enzymes NaeIand
XmnI (NEB). Because insertio n of the s ynthetic gene disrupts
the XmnI recognition site, this enzyme cannot cleave the
recombinant plasmid. To c leave the gene in the seco nd part
of its sequence, NaeI was used as a double c ontrol of the
original duplexes. In both cases, E. coli JM109 (P romega,
The Netherlands) was used for p lasmid propagation. A
translation termination codon was i nserted at t he end o f the
PBTx3 coding sequence. The vector possesses malEtrans-
lation initiation signals to direct the toxin-fusion proteins to
the periplasm, thus allowing folding and disulfide bond
formation to t ake place in E. coli [15,16]. T he method for t he
expression of our toxins used the strong P
tac
promoter, which
gave a h igh-level expression of thecloned sequences encoding
the fusion. For c omparison with PBTx3, the h igh affinity K
+
channel blocker AgTx2 [17], which is structurally related to
PBTx3, was produced by a similar strategy.
Expression, purification and cleavage
of fusion proteins
Rich Luria–Bertani medium containing bactotryptone
(Sigma, Belgium), yeast (Remel, BioTrading, Belgium),

NaCl (Merck Eurolab, Belgium), g lucose (Merck Eurolab)
and ampicillin (1 lgÆmL
)1
) was inoculated with an over-
night c ulture of E. coli DH5a cells, c arrying the gene fusions
encoding either rAgTx2 or rPBTx3, in a culture shaker
incubator (Innova 4 000, New Brunswick Scientific). In b oth
situations, the cells were grown a t 37 °C and when the cell
density had reached A
600
¼ 0.5, expression of the fusion
proteins was i nduced by adding isopropyl thio-b-
D
-galacto-
side (Sigma) to a final concentration of 0 .2 m
M
. Cells were
harvested by centrifugation at 2660 g at 4 °Cfor20min
and subjected to osmotic s hock according to the following
procedures. The cells were resuspended in 400 mL 30 m
M
Tris/HCl (Sigma) w ith 20% sucrose (Sigma) pH 8.0 at
25 °C. The suspension was treated with Na
2
EDTA (Sigma)
to give a concentra tion of 1 m
M
and incubated at room
temperature with shaking. After 10 min, the mixture was
centrifuged f or 20 min at 2660 g at 4 °C. The s upernatant

was removed and t he well drai ned pellet w as resuspend ed in
400 m L ice-cold 5 m
M
MgSO
4
(Sigma) in an ice bath for
10 min and centrifuged at 2660 g at 4 °C. The supernatant
is the c old o smotic shock fluid which contains the periplas-
mic e xtracts. The periplasmic extracts (400 mL) were loaded
Fig. 2. Sequence determination of native PBTx3. (A) The first 36
amino acid residue s of PBTx3 w ere identified b y direct seq uenci ng
a
.
Sequencing the last f ragment, produced af ter cyanogen b romide
cleavage, identified the C-te rminal re sidue arginine
b
. (B) Alignment of
the amino acid se quences of t he members o f subfamily 1 o f short-chain
a-KTx toxins isolated from scorp ion venom. Dashes represent gaps
that were introduced to improve the align ment. Identical amino acids
are indicated with a black background. Homologous residues are
indicated w ith a grey background. The p e rcentage id ent ity w ith ChTx
is shown. ChTx (c harybdo toxin [24]), charybdotoxin-Lq-2 [10], Lqh
15–1 [25] and AgTx2 (agitoxin 2 [15]), were purified from Leiurus
quinquestriatus var. Hebraeus; B mTx1–2 [26] was purified from Buthus
martensi Karsch; HgTx2 (h ongotoxin 2 [27]), and LbTx (lim batotoxin
[34]), were purified from Centruroides lim batus; IbTx ( iberiotoxin [28]),
and TmTx (tamulotoxin [56]), were purified from Buthus tamulus;
PBTx3 (parabutoxin 3, this study) was purified from Parabuthus
transvaalicus.

Fig. 3. Schematic diagram of the pMAL-p2X vector containing the
synthetic gene for the PBTx3 homologue. (A) Two ligations were
performed u sing a 6706-bp p MAL-p XmnI/BamHI fr agment and a
111-bp fragment encoding the PBTx3 homologue, immediately
downstream of t he fX
a
cleavage site in the v ector. Amp
R
, ampicillin
resistance gene; ori, origin. (B–D) Chromatographic profiles after
purification of the fusion p rotein (B) and reco mbinant toxin (C,D)
rPBTx3. Fractions containing the MBP-fusion proteins wer e co llected
and prepared for cleavage with fX
a
. The restriction digests were
applied on the same HPLC C
18
column as in Fig. 1 and material
eluting between 8 and 15 min was purified further on a H PLC C
2
/C
18
column and tested on Kv1 channels expressed in Xenopus oocytes.
1856 I. Huys et al. (Eur. J. Biochem. 269) Ó FEBS 2002
to an amylose affinity resin (1.5 · 23 cm column, Biolabs,
NEB) at a flow rate of 1 mLÆmin
)1
in column buffer
containing 20 m
M

Tris/HCl, 200 m
M
NaCl (Merck Eur-
olabs, Be lgium), a nd 1 m
M
Na
2
EDTA buffer, pH 7.4. After
washing of the unbound proteins, the bound maltose-
binding protein (MBP)-fusion products were eluted from
the amylose resin using the same column buffer containing
10 m
M
maltose ( Merck E urolabs). T wenty 3 -mL f ractions
were collected and the fusion protein was easily detected by
the UV absorbance spectrophotometer (UV/VIS Spectro-
photometer lambda 16, PerkinElmer) at 280 nm. The
protein-containing fractions were pooled and purified
further using a Superdex Peptide gel filtration column on
the SMART System (Pharmacia Biotech). The elution was
performed with a buffer containing 20 m
M
Tris/HCl and
100 m
M
NaCl, pH 8 .0 (Fig. 3B). C ontrols were performed
with cells containing no vector or cells containing the vector
without insert.
The synthetic gene encodin g the PBTx3 homologue was
designed such that an fX

a
cleavage site (Ile-Glu-Gly-Arg-)
immediately preceded the N-terminal Glu of the toxin
(Fig. 3 A). The enzymatic cleavage of the pooled fusion
proteins was carried out at various conditions by fX
a
(different sources: Boehringer, Sigma, NEB). Optimal
cleavage could be performed in the following conditions:
72 h incubation at room temperature a nd a concentration
of 0.5 UÆlg
)1
fusion protein in a buffer c ontaining 20 m
M
Tris/HCl, 100 m
M
NaCl and 2 m
M
CaCl
2
,pH8.0.After
cleavage with this enzyme, the recombinant toxin was
generated without vector-related fragments. In a parallel
experiment with AgTx2, chromatographic profiles of
rAgTx2 and commercially available rAgTx2 (Alomone
Laboratories) under the same conditions were compared
and were identical.
HPLC
Separations of the recombinant proteins were fir st per-
formed with a 218TP104 C
18

reversed-phase HPLC column
(Vydac) a nd equilibrated with 0 .1% trifluoroacetic acid
(Sigma)at25°C (Fig. 3C ). A fter 4 min an immediate ste p
to 5% aceton itrile (with 0.1% trifluoroacetic a cid) was
followed by a linear gradient to 30% acetonitrile for 5 min
and then by a linear gradient to 60% for the last 12 min.
The flow rate was 0.75 mLÆmin
)1
and t he absorbance was
measured simultaneously a t 214, 254 and 2 80 nm. The
fraction containing the recombinant toxin (arrow) was
recoveredandappliedtoalRPC C
2
/C
18
SC 2.1/10
reversed-phase HPLC column (Vydac). A linear gradient,
starting after 6 min and ranging from 0% to 30% up to
100 min with a flow rate of 200 lLÆmin
)1
(Fig. 3 D), was
applied and the toxin was collected, dried (Speed VacÒ
Plus) and prepared for functional analysis.
Mass spectroscopy
For e xamination of mass, 1 pmol o f the venom was dried
and redissolved in acetonitrile (+ 0.1% trifluoroacetic
acid). The molecular mass of the compounds in the venom
and the masses of rAgTx2 (used as a control toxin) and
rPBTx3 were determined with M ALDI-TOF MS on a V G
Tofspec (Micromass, UK) operating in the linear a nd in th e

reflectron mode.
Electrophysiological recording
Oocyte expression – Kv1.1. For in vitro transcription,
plasmids were first linearized with PstI (New England
Biolabs) 3 ¢ to the 3¢ nontranslated b-globin sequence i n our
custom-made h igh expression vector for oocytes, pGEMHE
[18–20] and then t ranscribed us ing T7 RNA polymerase and
a cap analogue diguanosine triphosphate (Promega). Kv1.2.
The cDNA encoding Kv1.2 (originally termed RCK5) in its
original vector, pAKS2, was first subcloned into pGEM-
HE [19]. The insert was released by a double restriction
digest with BglII and EcoRI. N ext, the cDNA was loaded
onto an a garose gel, fr agments of interest were cut out, g ene
cleaned (QIAGEN) and ligated into the BamHI and EcoRI
sites of pGEM-HE. For in vitro transcription, the cDNA
was linearized with SphI and transcribed using the large-
scale T7 mMESSAGE mMACHINE transcription kit
(Ambion). Kv1.3. Plasmid pCI.neo containing the gene for
Kv1.3 was linearized with NotI (New England Biolabs) and
transcribed as for Kv1.2 [21]. Stage V–VI Xenopus laevis
oocytes were isolated by partial ovariectomy under anaes-
thesia (tricaine, 1 gÆL
)1
). Anaesthetized animals were kept
on ice during dissection. The oocytes were defolliculated by
treatment with 2 mgÆmL
)1
collagenase (Sigma) in zero
calcium ND-96 solution (see below). Between 2 and 24 h
after defolliculation, ooc ytes were injec ted with 50 nL of 1–

100 ng ÆlL
)1
cRNA. The oocytes were then incubated in
ND-96 solution at 18 °C for 1–4 days . The animals were
handled in conformity with the ‘Guide f or the Care and Use
of Laboratory Animals’, published by the US National
Institutes of Health (NIH Publication No. 85-23, revised
1996).
Electrophysiology. Whole-cell c urrents from oocytes were
recorded using the two-microelectrode voltage clamp
technique. Voltage and current electrodes (0.4–2 mega-
ohms) were filled with 3
M
KCl. Current records were
sampled at 0.5-ms intervals after low pass filtering at
0.1 k Hz. Off-line analysis was performed on a Pentium(r)
III processor computer. Linear components o f capacity and
leak currents were not subtracted. All experiments were
performed at room temperature (19–23 °C). Fitted K
d
values were obtained after calculating the fraction current
left over after a pplication of several toxin concentrations in
different oocyte experiments (mean ± SD, n).
Solutions. The ND-96 solution (pH 7.5) c ontained 96 m
M
NaCl, 2 m
M
KCl, 1.8 m
M
CaCl

2
,1m
M
MgCl
2
,5m
M
Hepes, supplemented with 50 mgÆL
)1
gentamycin sulphate
(only for incubation).
Modeling
A model was generated by an automated homology
modelling server (Expert Protein Analysis System proteo-
mics server using SWISS-MODEL-ProModII) running at
the Swiss Institute of Bioinformatics ( Geneva). Target
(PBTx3) and template (hongotoxin 2) sequences were
automatically aligned by Multiple Sequence Alignment
Software (
CLUSTALW
), which subsequently generated
the coordinates of both models. Energy minimization
(
GROMOS
96) and simulated annealing cycles were run.
SWISS
-
MODEL
computes a confidence factor for each atom
Ó FEBS 2002 Novel K

+
channel blocker parabutoxin 3 (Eur. J. Biochem. 269) 1857
in the model structure, taking i nto account the deviation of
the model from the template structure and the distance t rap
value used for framework building.
RESULTS
Kv1 K
+
channels were expressed in X. laevis oocytes and
studied using a two-microelectrode voltage clamp. Crude
venom of P. transvaalicus (340 lg) produces a reversible
inhibition of the Kv1.1 K
+
current elicited by depolariza-
tion up to 0 mV (data not shown). In our quest to find novel
short-chain scorpion toxins in t he venom of P. transvaali-
cus, acting on voltage-dependent K
+
channels, we fraction-
ated the crude venom of this scorpion as detailed in
Materials and methods (Fig. 1). As described by Debont
et al . [22], gel filtration shows three typical groups of
components (Fig. 1A), the largest of which (group I) was
shown to block Kv1.1 channels. Based on a constructed
calibration curve (see Debont et al. 199 8), t he active fra ction
corresponded to a molecular mass between 3 and 6 kDa,
which probably represents the family of short-chain scor-
pion toxins. After HPLC purification of this active fraction
(Fig. 1 C), that representing native PBTx3 (85 l
M

)caused
an inhibition of Kv1.1 channels of 50%, whereas 550 n
M
native PBTx3 produces 54% and 51% block of t he Kv1.2
and K v1 .3 ch annels, respectively ( Fig. 4A–C). We have
undertaken the recombinant synthesis of this toxin in o rder
to facilitate the characterization of its biological properties.
The yields of affinity-purified proteins were 40–60 mg ÆL
)1
culture, estimated by absorbance at 280 nm, which after
cleavage resulted in the production of 2–4 m g of r ecombin-
ant toxin per litre culture. The r ecombinant synthesis
resulted in the production of a recombinant toxin with an
expected molecular mass of 4118 Da, with respect to the
three disulfide bridges present in the secondary structure of
the PBTx3 homologue. T he mass of rAgTx2 (ÔcontrolÕ tox in
for comparison) was also consistent with the theoretical
mass. Functional effects of recombinant toxins on Kv.1
channels were investigated by electrophysiological experi-
ments. No block was obtained when MBP-rPBTx3 was
applied to expressed K
+
channels in Xenopus oocytes
(n ¼ 3) (data not shown). Recombinant PBTx3 inhibits
both Kv1.2 and Kv1.3 channels with weak affinities and
similar potencies, whereas it is a very weak inhibitor of
Kv1.1 channels: application of 550 n
M
rPBTx3 produced
no blocking effect on Kv1.1 channels (Fig. 4D), whereas the

Kv1.2 and Kv1.3 curre nts were reversibly b locked to 52%
and 49%, respectively (Fig. 4E,F). As part of a control,
rAgTx2 was a pplied to the same oocytes expressing Kv1.1
channels. A ddition o f 1 n
M
rAgTx2 blocked the K
+
current
almost completely (Fig. 4 G) and this effect was reversible
upon washout. A fter equilibration of the c hannels and
application of the same concentration of commercially
available rAgTx2, quantitatively the same effect was
observed as with our laboratory prepared rAgTx2. This
observation, together with the fact that co-injection of
equimolar amounts of both A gTx2 on reverse-phase HPLC
resulted in a single peak (data not shown), demonstrates
that our rAgTx2 b ehaved similarly t o the commercially
available recombinant toxin.
Blockage of the Kv1 channels induced by rAgTx2 or
rPBTx3 (tested at different concentrations) was shown n ot
to be voltage-dependent, as the degree of block was not
different in the range of test potentials from )30 to
+20 mV. Recombinant PBTx3 (500 n
M
) blocked the
Kv1.2 and Kv1.3 peak currents by 54% and 53% at
)30 mV (n ¼ 3), and by 53% and 54% (n ¼ 3) at
20 mV . In the presence of 70 l
M
rPBTx3, t he Kv1.1 peak

current was blocke d by 45% (n ¼ 3) at )30 mV and by
42% at 2 0 mV (n ¼ 3).
Blocking of the Kv1 channels by rPBTx3 is reversible a nd
has no influence on the gating characteristics of the
channels. Therefore, the time constants for relaxation to
equilibrium block o f t he different Kv1 channels in the
presence of the toxin reflect only t he progress of the b inding
reaction. To determine the time constants s
on
and s
off
for
blockade and recovery, current t races were repeated every
2 s before, during and after rPBTx3 application. The time-
courses of blockade and recovery were fitted t o mono-
exponential curves, in agreement w ith the results obtained
for other scorpion toxins [23]. In the presence of 10 l
M
rPBTx3 on Kv1.1 and 3 .3 l
M
rPBTx3onKv1.2andKv1.3
channels, b lockade o ccurred with a mean time constant s
on
of 8.3 ms, 2.1 m s a nd 1.7 ms, respectively, for Kv1.1, Kv1.2
and Kv1.3 channels. The recovery from blockade
Fig. 4. Effects of native (A–C) and recombinant (D–F) PBTx3 on
Kv1.1, Kv1.2 and Kv1.3 channels. Whole-cell K
+
currents through
Kv1.1, Kv1.2 and Kv1.3 channels, respectively, expressed in Xenopus

oocytes, a re evoked by depolarizing t he oocyte f rom a h olding
potential of )90 mV to 0 mV. The oocytes were clamped back to
)90 mV (A), or to )50 m V (B–G). Application of 85 l
M
native PBTx3
(active fraction in Fig. 1C indicated by *) on Kv1.1 channels or 550 n
M
on Kv1.2 and Kv1.3 channels, produced 50%, 54% and 51% inhibi-
tion, respectively, of the Kv1.1, Kv1.2 and Kv1.3 currents. (D–F)
Current through Kv1.1, Kv1.2 a nd Kv1.3 channels, respectively, in
control conditions (s) and in the presence ( d)of550n
M
rPBTx3. (G)
Inhibition of Kv1.1 current, produced by 1 n
M
of rAgTx2.
1858 I. Huys et al. (Eur. J. Biochem. 269) Ó FEBS 2002
occurred with a mean s
off
of 9.2 ms, 23.9 ms and 10.8 ms.
Corresponding k
on
values were therefore 1.3 · 10
3
M
)1
Æs
)1
,
12.7 · 10

4
M
)1
Æs
)1
and 1.4 · 10
5
M
)1
Æs
)1
and k
off
values
were 0.108 s
)1
, 0.041 Æs
)1
and 0.092 Æs
)1
, respectively, for
Kv1.1, Kv1.2 and Kv1.3. The K
d
calculated from the ratio
k
off
/k
on
was in all cases in g ood agreement with the value
obtained in the dose–response experiments (see further):

80 l
M
for Kv1.1 (K
d
¼ 79 l
M
), 322 n
M
for Kv1.2
(K
d
¼ 547 n
M
)and657n
M
for Kv1.3 (K
d
¼ 492 n
M
).
The fraction of unblocked current at equilibrium (f
u
)is
readily measured and is related to the rate constants
according to f
u
¼ k
off
/(k
on

[rPBTx3] + k
off
). The Hill
coefficients were not significantly different from 1. From
the constructed current/voltage relationship (I
test
/V
test
), it
can be seen that 70 p
M
rAgTx2 produced a marked
inhibition (45%) of the K
+
current of Kv1.1 channels at
all V
test
(Fig. 5 , 1b) as measured at the end of each 100 ms
test pulse. Recombinant PBTx3 produced almost the same
effect by applying 550 n
M
toxin on Kv1.2 (Fig. 5, 1c) and
500 n
M
toxin on Kv1.3 (Fig. 5, 1d) channels, whereas the
same degree of inhibition was o bserved with 7 0 l
M
toxin o n
Kv1.1 channels (Fig. 5 , 1a). This was in close agreement
with the inhibition seen with native PBTx3 ( Fig. 4A).

The r eversal potential for Kv1.1 currents was evaluated
from the kinetics of the tail currents upon repolarization. A
tail current/voltage curve (I
tail
/V
test
) was constructed by
fitting the data with a single Boltzmann distribution
function of the form I
tail
¼ I
tail,max
/{1 + exp[(V
1/2
–V)/ s]}
where I
tail
is the tail c urrent, I
max
is the maximal t ail current,
and s the slope factor of the voltage dependence. The peak
amplitudes of t he tails were measured at )50 mV a nd
plotted as a function of the preceding V
test
(Fig. 5 , 2a,b).
This resulted in a typical fraction open channels/membrane
voltage relationship. In the study with rAgTx2 (Fig. 5, 2a),
the function in the control situation (n ¼ 4) was charac-
terized by a half-maximal potential (V
1/2

) and slope ( s)of
)19.7 ± 0.7 mV and 10.0 ± 0.7 mV, respectively. With
10 p
M
rAgTx2 (n ¼ 4), V
1/2
was )20.3 ± 1.3 mV and s
was 10.5 ± 1.3 mV, demonstrating that there was no
significant shift o f V
1/2
and of t he s-value, showing n o
effect on the c hannel gating. For t he control situation
(n ¼ 4) in the e xperiment w ith r PBTx3 ( Fig. 5, 2b), the V
1/
2
and s were )19.5 ± 2.7 mV and 10.9 ± 2.7 mV, respec-
tively. I n t he presence of rPBTx3 (n ¼ 4), V
1/2
and s were
)19.9 ± 1.7 mV and 9.3 ± 1.6 mV, respectively, s uggest-
ing that this n ew toxin did not change the midpoint of the
open channel/voltage curve of K v1.1 channels. Steady-state
Kv1.2 and Kv1.3 currents were converted to conductances
using a reversal potential of )80mVandfittedtosingle,
first-order Boltzmann distributions. Conductances were
normalized to the maximum estimated from the Boltzmann
fit. In control, the function was characterized by a half-
maximal potential (V
1/2
)of)19.6 ± 3.3 mV and

–22.0 ± 6.0 mV ( n ¼ 4) with a slope factor of
7.5 ± 0.3 mV and 9.3 ± 4.7 mV, for Kv1.2 and Kv1.3
channels, respectively. With 500 n
M
rPBTx3, there was no
shift: V
1/2
, )19.5 ± 1.7 mV and –21.6 ± 4.3 mV and s
9.6±3.3mVand8.5±6.3mV(n ¼ 4) for Kv1.2 and
Kv1.3 channels, respectively (Fig. 5, 2c,d).
The induced inhibition by rPBTx3 was concentration-
dependent. F ig. 6A and B show the dose–response c urves o f
Kv1 c hannels to the recombinant toxins. The half-maximal
effect on Kv1.2 a nd Kv1.3 c hannels was obtained with
547 n
M
and 492 n
M
, respectively. However, the affinity of
rPBTx3 for Kv1.1 channels was very l ow, w ith
K
d
¼ 79 l
M
, showing t hat rAgTx2 ( K
d
¼ 59 p
M
)hasa
1 · 10

6
times higher affinity toward these channels. The
Fig. 5. (1a–d) T he current/voltage ( I
test
/V
test
) relationship i n control (s)
and in the presence (d) of d ifferent concentrations of rPBTx3 (a, c, d ) on
Kv1.1, Kv1.2 and Kv1.3, respectively, and r AgTx2 (B) on Kv1. 1 channels
expressed in Xenopus oocytes. Currents were measured at the end of
each 500 ms test pulse. In all cases, the effect was reversible. (2a, b)
Corresponding fraction open ch annels/membrane voltage curve ( I
tail
/
V
test
) relationship, fitted with a Boltzmann function (n ¼ 4). (2a) In
the absence of toxin ( s), the midpo int (V
1/2
) and slope factor for Kv1.1
channels were )19.7 ± 0.7 mV and 10.0 ± 0.7 mV, respectively. In
the presence o f rAgTx2 (d), V
1/2
and s were )20.3 ± 1.3 mV a nd
10.5 ± 1.3 mV (2b). In the control experiment (s) f or rPBTx3 on
Kv1.1 channels, V
1/2
and s wer e )19.5 ± 2.7 and 10.9 ± 2.7,
respectively, whereas after addition of rPBTx3 (d), they were
)19.9 ± 1.7 mV and 9.3 ± 1 .6 mV, respectively. The residual in

maximal fraction open channels induced by application of 10 p
M
rAgTx2 was 75 ± 1.47% a nd by a p plication of 7 0 l
M
rPBTx3 it was
53.6 ± 9.4%. (2c,d) M aximal membrane conductances (G
max
)were
calculated. The steady-state activation curves for th e control (s)andin
thepresenceof500n
M
PBTx3 ( d) w ere obtained after fitting with a
Boltzmann fun ction I ¼ I
c
/[1 + exp(–V
test
–V
1/2
)/s]
)1
.Inbothcases,
for Kv1.2 and Kv1.3, V
1/2
is not shifted by rPBTx3 a s illustrated by the
dashed lines. Slope values (s) for the c ontrol and t he toxin c urve s are,
respectively, 7.5 and 9.6 for Kv1.2, and 9.3 and 8.5 for Kv1.3 channels.
In all cases, there was no significant shift of V
1/2
.
Ó FEBS 2002 Novel K

+
channel blocker parabutoxin 3 (Eur. J. Biochem. 269) 1859
obtained K
d
of rAgTx2 for Kv1.1 w as in accordance with
the value reported by Garcia et al. [15].
Block was rever sible upon washing-out. A s the toxin
binding was r eversible and did not alter channel gating, we
investigated rPBTx3 binding to the channel. As has been
explained earlier, blockade is assumed to o ccur by a simple
bimolecular reaction. If the toxin binding to the channel
indeed re flects a bimolecular reaction scheme, the a pparent
first-order association rate increases linearly with toxin
concentration and the first-order dissociation r ate remains
constant. This was indeed the case as shown in Fig. 6 C,
where the effects of increasing rPBTx3 concentrations on
the kinetics of block on Kv1.2 are illustrated. The time
course of activation was fitted using a Hodgkin–Huxley
type model with a 4th power function of the form:
I
t
¼ A {1–exp[+ (t/s)]
4
+C}, with I
t
the macroscopic
and t ime-dependent current, A the c urrent predicted at
steady-state, s the time constant, and C a constant. For a
depolarizing pulse from )90 to 0 m V, the activation kinetics
of Kv1.3 could be fitted with a time constant of

11.2 ± 0.7 ms and 10.94 ± 1.1 ms in the control and in
the pre sen ce o f 5 00 n
M
rPBTx3, respectively (Fig. 6D).
Recombinant rPBTx3 did not alter the activation or
inactivation time c onstants of Kv1.3 channels expressed in
oocytes.
Other channels
Finally, we i nvestigated the effect of our new toxin on
different cloned channels, included in the screening p rocess,
in order to study its s electivity profile. Recombinant PBTx3
has n o e ffect on Kir2.1 channels, hERG-type channels, hH1
Na
+
channels (plant) KAT channels, cardiac two-pore
background K
+
channels (cTBAK) and the calcium
channel p2X expressed in Xenopus oocytes (data not
shown).
DISCUSSION
The number of peptides isolated from distinct phyla, like
scorpions [23], sea anemones [24,25], marine cone snails [26]
and snakes has increased c onsiderably. They have a three-
dimensional structure with some conserved motifs [27] b ut
their affinity and specificity towards different targets may
vary. Those t argets include ion channels, p resent in different
tissues. In order to increase our knowledge o f the structure–
function relationship between toxins and ion channels, it is
necessary to isolate peptides in scorpion venoms and

characterize them as much as possible. In this study, we
present the purification, primary structure and functional
characterization of PBTx3, a novel peptide inhibitor from
the venom of the P. transvaalicus scorpion. PBTx3 was
isolated from the venom on the basis of its ability to inh ibit
the K
+
current through cloned voltage-dependent K
+
channels (Kv1) expressed in Xenopus oocytes. Separation
procedures leading to the identification of this novel
neurotoxin were performed by gel filtration and reversed-
phase HPLC, by using different types of columns, as
described previously [28].
The n ew toxin PBTx3 has a peptidic chain of 37 amino
acids and shows similarities with members of the first
subfamily of a-K
+
scorpion toxins [8], with a fully
conserved stretch of residues G25-K26-C27-M28-N29
residing in one of the b sheets, like ChTx. The sequence
Lys-Cys-XXX-Lys-Cys (X being any amino acid), with the
Lys–Cys i n antiparallel b sheets and XXX b eing a tight turn,
is also conserved, as in all other small scorpion toxins that
areactiveonK
+
channels. In order to find structurally
significant feat ures in t he sequence of P BTx3 (Fig. 2B),
sequence alignments were per formed using the program
CLUSTAL

1.8 (:9331/mul-
tialign/multialign.html). PBTx3 shows similarities with
ChTx (41%) [ 29], Lqh 15-1 (44%) [ 30] and ChTx-Lq-2
(38%) [11] from Leiurus quinquestriatus var. Hebraeus,
BmTx 1 (55%) and 2 (41%) [31] f rom Buthus martensi
Karsch, HgTx 2 (55%) [32] and LbTx (50%) [33] from
Centruroides limbatus, IbTx (47%) [34] and TmTx (52%)
[35] from But hus ta mulus. Alignment of the cysteine residues
(C
6
–C
27
,C
12
–C
32
,C
16
–C
34
) s howed that it was a novel toxin
and t hat the cystein e motif was highly conserved. This
cysteine pattern w as also found in long-chain scorpion
toxins [36] and other defence proteins s uch as the antibac-
terial insect defensin A [37], as well as in plant thionins [38]
and potent antifungal plant defensins [39]. Disulfide bridges
are important in stabilizing the three-dimensional structure
of the toxin, a s d emonstrated by NMR studies of ChTx [40],
iberiotoxin [41] and Lq2 [ 42]. Definitive assignment of the
disulfide linkages in PBTx3 is currently unknown but is

assumedtomimicthatofChTxandothera-KTx. S pecific
Fig. 6. Dose–response curves o f rAgTx2 (A) and rPBTx3 (B) with a K
d
value f or rAgTx2 of 59 p
M
(Hill coefficien t o f 0 .9). Each point repre-
sents the mean ± SD from four oocytes. The expected K
d
values for
rPBTx3 on Kv1.1, Kv1.2 and Kv1.3 are, respectively, 79 l
M
, 547 n
M
and 492 n
M
(Hill coefficients 0.89, 1.41 and 1.16, respectively). (C)
Bimolecular k inetics of PBTx3 interaction. Rate constants of b locking
[k
on
(rPBTx3), d] and dissociation (k
off
, s) were measured from volt-
age-clamp rec ords as a function of external r PBTx3 c oncen tration.
Each point represe nts the mean ± SD of three individual de termin-
ations. ( D) Effect of rPBTx3 on activation a nd inactivation kinetics of
Kv1.3 channels. After depolarizing up to 0 mV from a V
hold
of
)90 mV for 500 ms, the activation and inactivation process in the
presence of rPBTx3 is not c hanged. Both current traces, control a nd in

the presence of toxin, have been superimposed after scaling of the trace
in presence of rPBTx3.
1860 I. Huys et al. (Eur. J. Biochem. 269) Ó FEBS 2002
residues i n C hTx, responsible for s pecific properties, are a lso
present in PBTx3. For example K26 (using PBTx3
numbering), the crucial residue in the interaction with the
pore of voltage-gated K
+
channels [43], is located in the
centre of the molecule. Furthermore G26 (corresponding to
G25 in PBTx3) has been suggested to be important for
appropriate formation of the disulfide pairing [44] and is
also conserved throughout these sequences of all the
members of subfamily 1 of a-KTx, including PBTx3.
Because of these similarities and conservation of the
consensus sequence, proposed for a-KTx subfamily 1, this
new t oxin is supposed to be the tenth member of the a-K
toxin 1 subfamily. Although this novel toxin maintains a
number of expected features, present also i n ChTx and
known to be important for the activity, it is unique in some
aspects. In contrast with other members of the Ch Tx-
subfamily, PBTx3 lacks F2 an d W 14. The latter plays a role
in the interaction of the other members of this subfamily
with residue G380 in the outer vestibule o f t he Kv1.3
channel [45]. The mutation W13L could w ell be responsible
for the lower affinity of PBTx3 for Kv1 channels, as a
similar decrease in affinity was demonstrated previously for
the W14A mutant of ChTx [45]. However, those two
residues are seen only in the toxins known to block BK
channels (large-conductance Ca

2+
-activated K
+
channels).
PBTx3 conserves a lso a higher content of proline residues
(two), but the importance of this is not really clear. PBTx3
possesses no N -terminal pyroglutamate, a residue classified
as influential in the functional map of ChTx [46]. These
structural differences in PBTx3 together with differences in
the sequence a t crucial or influential places (one N-terminal
residue fewer, R22, P23, N24, R30, K33 and P36 versus the
N-terminus, T23, S24, R25, K31, R34 and S37 in ChTx)
may explain why the affinity of rPBTx3 is much lower for
Kv1 channels. The toxin is composed of 37 amino-acid
residues, with 11 positively charged groups and three
negatively charged residues, dispersed all over the molecular
surface. Groups of strong hydrophobicity (M4, M28, Y35)
and H-binding capacity (S8, S9 N24 and N29) would
suggest that the s pecific block of t he toxin relies upon
hydrophobic as well as polar interactions. The three-
dimensional structure of PBTx3 is also related to the
a-KTx1 subfamily. Its three-dimensional conformation is
determined by homology modelling (Fig. 7) with hongo-
toxin 2 (a-KTx 1.9) as a t emplate f or modelling because t his
latter toxin shares 55% homology with PBTx3.
The a/b scaffold consists of a short a helix (residues
S9–A19) and a b sheet, which is not triple- but double-
stranded in PBTx3. Rather than forming a third b strand as
found for other a-K toxins, the N terminal region of
PBTx3, based in our model, adopts an extended confor-

mation. This can be explained by the presence of the
N-terminal end of PBTx3, which i s one residue shorter t han
that of ChTx. It has been shown that toxins acting o n SK
channels mostly contain a two-stranded antiparallel b sheet
(leiurotoxin I and PO5), whereas toxins active on Kv
channels mostly have a triple-stranded bsheet. Whether
PBTx3 blocks SK channels remains to be investigated. The
key feature of ChTx block of the Kv1 channels, a 1 : 1
stochiometry for toxin block o f the channel, is also observed
with PBTx3. Although those two toxins could s hare a
common mechanism for blocking, there are some quanti-
tative differences in the blocking kinetics. For instance, t he
on rate of rPBTx3 binding to Kv1 channels is 10–100 times
slower than that of ChTx for which, depending on the
conditions, channels are blocked with an on rate of 0.2–
20 · 10
7
M
)1
Æs
)1
. This is not very surprising as ChTx and
PBTx3 share only 41% sequence homology. Only three
positively charged residues are conserved between the two
toxins, and two arginine residues and lysine residues are
exchanged b etween the two toxins, located in the a-sheet. Of
the t hree residues in C hTx (R25, K27 and R34) crucial t o
toxin binding and blockade [46], only the K27 is conserved.
The R34 is mutated to a lysine residue. Because of the
difference in the l ength of their side chains, lysine a nd

arginine could have a d ifferent effect as also described for
other t oxins [ 47]. H owever, structural s imilarities in this part
of the toxins may underlie the functional similarities
observed for the toxins. ChTx is a highly b asic toxin, with
a n et charge of +5 at neutral pH, whereas PBTx3 ( still more
basic), carries a net charge of +9 (pH range 5–9). For
PBTx3, an additional n egatively charged D3 is present, and
could b e an explanation for some of the differences in the
association rate constants of the two t oxins.
Several binding sites of K
+
channel blocking peptides
have been characterized a nd most of these blockers possess
at least a common d iad composed of two functionally
important residues, separated by 6.6 ± 1.0 A
˚
: a positively
charged r esidue and a hydrophobic residue [48,49]. Residues
in AgTx2 and ChTx at positions equivalent to Y36 and K27
of PBTx3 have been shown to be critical for channel
blocking [50,51]. These two residues are also found in
anemone K
+
channel toxins, despite the fact that the three-
dimensional folding of scorpion and anemone toxins are
quite different [48]. Regarding this hypothesis and in
correspondence with the diad in ChTx, K26 and t he Y35
in PBTx3 are most probably involved in this diad. The
distance that s eparates the C a of the lysine f rom the centre of
the b enzene ring of the t yrosine i s 6 .805 ± 0.406 A

˚
.Wecan
imagine that the toxin in teracts with t he channel like a moon
lander s ystem and that those t wo residues p lay an i mportant
role in the interaction with the pore of the channel.
Our control toxin in the recombinant expression, AgTx2,
Fig. 7. A t hree-dimensional model f or PBTx3, co nstructed by homology
modelling. Th e backbone o f the m olecule is sh own in ribb on. Residues
forming the functional diad (K26 and Y35) are in yellow.
Ó FEBS 2002 Novel K
+
channel blocker parabutoxin 3 (Eur. J. Biochem. 269) 1861
represents a very potent blocker of K v1 type c hannels.
Mutagenesis studies on AgTx2 i dentified a set of residues a s
functionally important f or blocking the Shaker K
+
channels
(N30, K27, R24, S11, F25, T36, M29 and less important
R31) [52]. Three residues are mutated in PBTx3, namely
R27P, F25N and T36Y (AgTx2 numbering). The T36Y
mutation is unlikely to affect drastically the affinity toward
Kv1.3 channels, as i t also o ccurs in o ther members o f the
first group. The effect of the R27P and F25N mutations
could be m ore important, considering t he diad hypothesis.
Most of the other mutations are located far f rom the inter-
action surface, upstream from the a helix or within this helix.
The sequence of rPBTx3 includes some similarities with
subfamily three, seven and eight of the a-KTx toxins. These
toxins all e nd with a positively charged residue at the
C-terminus, preceded b y a proline. Functionally, the recom-

binant toxin, lacking the arginine, demonstrates the same
properties as the native toxin (with an additional arginine),
illustrating that t his r esidue is not important f or function. In
the first b sheet, PBTx3 represents a fully conserve d stretch
referred to as the kaliotoxin group: C18-K19-A21-G22.
Comparing the S5-P-S6 regions of the three channels, we
can l ook for specific residues in the pore-forming r egion that
are different between Kv1.1 c hannels and Kv1.2 or Kv1.3,
that can possibly explain the selectivity toward t hese latter
channels. T he only residue, present in both Kv1.2 a nd
Kv1.3 and mutated in K v1.1 is D 372 (Kv1.3 numbering) .
This residue is probably involved directly in the intimate
interaction with the toxin right at the binding site. Mac-
Kinnon et al. ( 1989) observed a substantial r eduction on the
binding affinity when the s tructure of this site was altered by
shortening the side chain (E–D) [13]. H owever, some studies
have shown that the same mutations in highly homologous
K
+
channels can produce different effects. Therefore the
extrapolation of the structural and f unctional importance of
residues should be done with caution, even with ion
channels belonging to the same family [53].
It is well known that l ong-chain scorpion neurotoxic
polypeptides from t he Buth idae family generally account for
about 10–50% of the crude venom and that short-chain
scorpion peptides appear only in very low quan tities in the
venom [ 54]. D uring the past decade, a number of approa-
ches have been developed t o produce toxins. For example
PBTx3 is assessed to be only about 0.06% of the venom.

Expression of scorpion toxins in Cos-7 cells [55], in insect
cells by means of the Baculovirus system [56], in plants [57],
in NIH/3T3 mouse cells [58] and in y east [57] led to rather
low yields. The first recombinant toxin was described about
10 years ago [59] and different toxins followed. We
produced rPBTx3 in order to verify that this peptide was
indeed the inhibitory component in the scorpion venom,
excluding the possibility of t he contamination with a peptide
of higher affinity to K
+
channels. The system chosen to
express PBTx3 in E. coli had previously been shown to be
suitable for the production of soluble, correctly folded
spider [60] or scorpion toxins [61]. F ollowing the procedures
described in this study, it is feasible to p roduce 2 –4 mg of
homogeneous and biologically active toxin from 1 L E. coli
culture. The production of fully active rAgTx2 and rPBTx3
requires some in vitro post-translational modifications that
are difficult to control: proteolytic release of the toxin from
the fusion protein and correct forming of the three disulfide
bonds by the six cysteines. Based on the chromatographic
profile of a mixture of rAgTx2 and native AgTx2
(AlomoneÒ), which r esulted in a single elution peak without
additional components, and based on the identical func-
tional activity on K v1, we can assume that the folding
process in rAgTx2 was correctly performed. In the case of
rPBTx3, the e lution time of the native and the recombinant
toxins were identical and the effect on Kv1 channels was
also comparable. Therefore, we could also conclude that
PBTx3 is not amidated, because peptides o f t his size with a

free or with an amidated residue in the C-terminal position
exhibit different retention times on HPLC [62]. The reduced
peptide could b e air oxidized in a concentration-independ-
ent manner. This was observed previously for other short
scorpion toxins acting on Ca
2+
-activated K
+
channels (e.g.
leiurotoxin I and PO5) [63,64]. The lack of activity of the
fusion proteins is not unexpected as the 44 kDa additional
mass could affect s ignificantly t he folding and accessibility
of the toxin portion.
As mentioned b efore, just a few studies were performed
based on the native venom of P. transvaalicus. Crude
venom of P. transvaalicus has been shown to modulate t he
ChTx binding to aortic sarcolemmal vesicles, in a w ay that it
was able to inhibit ChTx binding in the preparation [34].
Inhibitors from scorpions, snakes and bees appear to target
primarily either the Shaker-related subfamily of Kv chan-
nels or the Ca
2+
-activated K
+
channels [15,65,66]. In our
study, we used a heterologous expression in oocytes of
cloned Kv channel proteins. To determine which type of
voltage-gated K
+
channel c ould be sensitive to r ecombinant

PBTx3, electrophysiological experiments were performed
on Kv1.1, Kv1.2 and Kv1.3 channels expressed in Xenopus
oocytes. Kv1.3 channels have been found in several types of
cells, in neurons, and in T lymphocytes and have proven to
be highly sensitive t o scorpion toxins [ 67]. Analysis of the
effects of rPBTx3 on Kv1 channels showed that rPBTx3
mimicked the effects of ChTx. ChTx blocks Kv1.2 and
Kv1.3 with dissociation c onstants in the nanomolar range,
but does not block Kv1.1, even at 1 l
M
[68]. In parallel,
rPBTx3 blocks Kv1.2 and Kv1.3 channels, but with lower
channel affinities than those of ChTx. The half-maximal
blockage of Kv1.2 a nd Kv1.3 occurred a t 547 n
M
and
592 n
M
,comparedwith6n
M
and 1 n
M
for ChTx [ 68].
Although there is a considerable amount of seq uence
identity between PBTx3 and other members of subfamily 1
of the a-KTx, t he values for the a ssociation r ates and
dissociation rate constants differed from those determined
previously for A gTx 2 and ChTx [46,69]. We examined the
inhibitory effects of rPBTx3 at different membrane voltages.
Block induced by rPBTx3 w as voltage-independent over the

range )30 to +20 mV, indicating that t his toxin is not very
sensitive t o the gating state of the channel. Channel block by
AgTx2 i s performed by physical occlusion of the conduction
pore [23]. The overall channel conductance, measured from
the slope of the current–voltage relationship, is not changed
in all cases in the presence of toxin. Fig. 5 shows activation
curves obtained in the absence and presence of extracellular
rPBTx3 on Kv1, channels. R ecombinant PBTx3 does not
shift the voltage at which the channels open. Also, a s
demonstrated for Kv1.3, there was n o shift in the a ctivation
or inactivation kinetics of t hose three ch annels, as demon-
strated for Kv1.3 (Fig. 6D). For Kv1.1, both the onset and
recovery from inhibition were slow. Because the t oxin does
not alter ch annel K v1.2 gating and the binding to this
1862 I. Huys et al. (Eur. J. Biochem. 269) Ó FEBS 2002
channel is reversible, the time constants for relaxation to
equilibrium block upon toxin exposure reflect only the
process of the binding reaction. Therefore, the kinetics of
rPBTx3-induced inhibition were consistent with a bimolec-
ular reaction between PBTx3 an d Kv1.2. The forward rate
constant for onset of inhibition varied linearly with PBTx3
concentration, while backward rate constant for recovery
from inhibition was independent of PBTx3 concentration
(Fig. 6 C). The dissociation constants (k
off
) d ecreased f rom
Kv1.1 to Kv1.2 a nd Kv1.3, in an order that correlates with
the increase o f t he affinity of rPBTx3 for these channels. We
screened a variety of other channels to investigate the
selectivity of rPBTx3, but no modulation was observed.

In the future, additional functional characterization
of rPBTx3 on other types of channels is planned where,
for example, Ca
2+
-activated K
+
channels and other Kv1
channels (e.g. Kv1.6) are good candidates.
ACKNOWLEDGEMENTS
We thank O. Pongs for providing t he cDNA for the Kv1.2 c hannel and
C. Ulens f or the subcloning of the g ene e ncoding the Kv1.2 channel. The
Kv1.3clonewaskindlyprovidedbyM.L.Garcia.WearegratefultoH.
Sentenac to provide the KAT1 clone. The hK1 clone was kindly
provided by R. G. Kallen. We also thank E. Toth Zsamboki for
providing the P2X clone and Y. Kurachi for p roviding the TBAK clone.
I. H. and E. C. are R esearch As sistants of the Flemish Fund for S cientific
Research (F.W.O Vlaanderen). This work was supported by a bilateral
collaboration b etween Flanders and South Africa (BIL00/36).
REFERENCES
1. Newlands, G. (1974) The venom-squirting ability of Parabuthus
scorpions (arachnida: buthidae). S. Afr. J. M ed. Sci. 39, 175–178.
2. Bergman, N.J. (1997) Clinical description of Parabuthus trans-
vaalicus scorpionism in Zimbabwe. Toxicon 35, 759–771.
3. Muller, G.J. (1993) Scorpionism in South Africa. A report of 42
serious scorpion envenomations. S. Afr. Med. J. 83, 405–411.
4. Bergman, N.J. (1997) Scorpion sting in Zimbabwe. S. Afr. Med. J.
87, 163–167.
5. Van Aarde, M.N., Van Rooyen, J.M. & Van Aswegen, G.
(1996) Screening of the venoms of two Pa rabuthus scorpion species
on isolated cardiomyocytes. Onderstepoort J. Vet. Res. 63,

127–130.
6. Verdonck,F.,Bosteels,S.,Desmet,J.,Moerman,L.,Noppe,W.,
Willems, J., Tytgat, J. & van d er Walt, J. (2000) A novel class of
pore-forming peptides in the venom of Parabuthus schlechteri
Purcell. Cimbebasia 16, 247–260.
7. Tytgat, J., Debont, T., Rostoll, K., Muller, G.J., Verdonck, F .,
Daenens, P., van der Walt, J .J. & P ossani, L.D. (1998) Purifica-
tion and partial characterization of a ÔshortÕ insectotoxin - like
peptide from the venom of the scorpion Parabuthus s chlechteri.
FEBS Lett. 441, 387–391.
8. Tytgat, J., Chandy, K.G., Garcia, M.L., Gut man, G.A., Martin-
Eauclaire, M.F., van der Walt, J.J. & Possani, L.D. (1999) A
unified nomenclature for short-chain peptides isolated from
scorpion venoms: alpha-KTx molecular subfamilies. Trends
Pharmacol. S ci. 20, 444–447.
9. Garcia-Calvo, M., Knaus, H.G., McManus, O.B., Giangiacomo,
K.M.,Kaczorowski,G.J.&Garcia,M.L.(1994)Purificationand
reconstitution of the high-conductance, calcium-activated
potassium channel from trac heal smooth mu scle. J. B i ol. Che m.
269, 676–682.
10. Wu, C.H. & Narahashi, T. (1988) Mechanism of action of n ovel
marine ne urotoxins on i on channels. Annu . Rev. Pharmaco l.
Toxicol. 28, 141–161.
11. Lucches i, K., Ravindran, A., Young, H. & Moczydlowski, E.
(1989) Analysis of th e blocking act ivity of charybdoto xin homo-
logs and iodinated derivatives against Ca
2+
-activated K
+
chan-

nels. J. Membr. Biol. 109, 269–281.
12. Castle, N .A., H aylett, D .G. & Jenkinson, D.H . (1989) Toxins in the
characterization o f potassium c hannels. Tren ds Neurosci. 12, 59–65.
13. MacKinnon, R . & Miller, C. (1989) Mutant p otassium channels
with alte red b inding of charybdotoxin, a pore-blocking p eptide
inhibitor. Science 245, 1382–1385.
14. Ackerman , M.J. & C laph am, D.E. (1997) Mechanisms o f d ise ase:
ion channels – basic science and clinical disease. NewEngl.J.Med.
336, 1575–1586.
15. Missiakas, D . & Raina, S. (1997) Protein f olding in the bacterial
periplasm. J. Bacteriol. 179, 2465–2471.
16. Bessette, P.H., Cotto, J.J., Gilbert, H.F. & Georgiou, G. (1999 )
In vivo and in vitro f unction of the Escherichia coli pe riplasmic
cysteine oxidoreductase DsbG. J. Biol. Chem. 274, 7784–7792.
17. Garcia, M.L., Garcia-Calvo, M., Hidalgo, P ., Lee, A. & Mac-
Kinnon, R. (1994) Purification and characterization of three
inhibitors of voltage- dependent K
+
channels from Leiurus quin-
questriatus var. hebraeus venom. Biochemistry 33, 6834–6839.
18. Baumann, A., Grupe, A., Ackermann, A. & Pongs, O. (1988)
Structure of the voltage-dependent potassium channel is highly
conserved from Drosophila to vertebrate central nervous systems.
EMBO J. 7, 2457–2463.
19. Stuhmer, W., Stoc ker, M., Sakma nn, B., Seeburg, P., Baumann ,
A., Grupe, A. & Pongs, O. (1988) Potassium channels expressed
from rat brain cDNA have delayed rectifier properties. FEBS Lett.
242, 199–206.
20. Liman, E.R., Tytgat, J. & Hess, P. (199 2) Subunit stoichiometry of
a mammalian K+ c hannel determined by construction of mu lti-

meric cDNAs. Neuron 9, 861–871.
21. Swanson, R., Marshall, J., Smith, J.S., Williams, J.B., Boyle,
M.B., Folander, K., Luneau, C.J., Antanavage, J., Oliva, C.,
Buhrow, S.A. et al. (1990) Clon ing and expression of cDNA and
genomic clones encoding three delayed rectifier potassium chan-
nels in rat b rain. Neuron 4, 929–939.
22. Debont, T., Swerts, A., Van der Walt, J.J., Muller, G.J.,
Verdonck, F., Daenens, P. & Tytgat, J. (1998) Comparison and
characterization of the venoms of three Parabuthus scorpion
species occurring in southern Africa. Toxicon 36, 341–352.
23. Miller, C. (1995) The charybdotoxin family of K
+
channel-
blocking peptides. Neuron 15, 5–10.
24. Aneiros, A., Garcia, I., Martinez, J.R., Harvey, A.L., Anderson,
A.J.,Marshall,D.L.,Engstrom,A.,Hellman,U.&Karlsson,E.
(1993) A p otassium channel toxin from th e secretion of the sea
anemone Bunodosoma granulifera.Isolation,aminoacidsequence
and biological activity. Biochim. Biophys. Acta. 1157, 86–92.
25. Castaneda, O., Sotolongo, V., Amor, A.M., Stocklin, R.,
Anderson, A.J., Harvey, A.L., Engstrom, A., Werstedt, C. &
Karlsson, E. (1995) Ch aracterization of a potassium channel toxin
from the Caribbean Sea anemone Stichodactyla H elianthus. Tox-
icon 33, 603–613.
26. Terlau, H., Stocker, M., Shon, K.J., McIntosh, J.M. & Olivera,
B.M. (1996) MicroO-conotoxin MrVIA inhibits mammalian
sodium channels, but not through site I. J. Neurophysiol. 76,
1423–1429.
27. Kobayashi, Y., Takashima, H., Tamaoki, H., Kyogoku, Y.,
Lambert, P., Kuroda, H., Chino, N., Watanabe, T.X., Kimura,

T., Sakakibara, S. et al. (1991) The cystine-stabilized alpha-helix: a
common structural mo tif of ion-channel blocking neurotoxic
peptides. Biopolymers 31, 1213–1220.
28. Debont, T., Daenens, P. & Tytgat, J. (1996) An improved frac-
tionation and fast scre ening method for the iden tificat ion of new
and selective neurotoxins. Neurosci. Res. 24, 201–206.
29. Gimenez-Gallego, G., Navia, M.A., Reuben, J.P., Katz, G.M.,
Kaczorowski, G.J. & Garcia, M.L. (1988) Purific ation, sequ ence,
Ó FEBS 2002 Novel K
+
channel blocker parabutoxin 3 (Eur. J. Biochem. 269) 1863
and m od el structure of charybdotoxin, a potent s ele ctive inhib itor
of calcium-ac tivated p otass ium ch anne ls. Proc. Natl Acad. Sci.
USA 85, 3329–3333.
30. Marshall, D.L., Vatanpour, H., Harvey, A.L., Boyot, P.,
Pinkasfeld, S., Doljansky, Y., Bouet, F. & Menez, A. (1994)
Neuromuscular effects of some potassium channel blocking toxins
from the venom of the scorpion Leiurus quinquestriatus hebreus.
Toxicon 32, 1433–1443.
31. Romi-Lebrun, R., Lebrun, B., Martin-Eauclaire, M.F., Ishiguro,
M., Escoubas, P., Wu, F.Q., Hisada, M., Pongs, O. & Nakajima, T.
(1997) Purification, characterization, and synthesis of three nove l
toxins from the Chinese scorpion Buthus martensi,whichacton
K
+
channels. Biochemistry 36, 13473–13482.
32. Koschak, A., Bugianesi, R.M., Mitterdorfer, J., Kaczorowski,
G.J., G arcia, M.L. & Knaus, H.G. (1998) S ubunit composition o f
brain voltage-gated potassium channels determined by hongo-
toxin-1, a novel peptide derived from Centruroides limbatus

venom. J. Biol. Chem. 273, 2639–2644.
33. Novick,J.,Leonard,R.J.,King,V.F.,Schmalhofer,W.,Kaczo-
rowski, G .J. & Garcia, M .L. (1991) Purification a nd character-
ization of two novel p eptidyl toxins directed against K
+
channels
from venom of new world scorpions. Biophys. J. 59,78a.
34. Galvez, A., Gimenez-Gallego, G., Reuben, J.P., Roy-Contancin,
L.,Feigenbaum,P.,Kaczorowski,G.J.&Garcia,M.L.(1990)
Purification and characterization of a unique, potent, peptidyl
probe for the h igh conductance calcium-activated po tassium
channel from venom of the scorpion Buthus tamulus. J. Biol.
Chem. 265, 11083–11090.
35. Escoubas, P., Romi-Lebrun, R., Lebrun, B., Herrmann, R.,
Moskowitz, H., Rajendra, W., Hammock, B. & Nakajima, T.
(1997) Tamu lotoxin, a novel member of the potassium channel
active short toxins f rom the v enom o f the Indian red scorpion
Buthus tamulus. Toxicon 35, 806.
36. Dauplais, M., G ilquin, B ., P ossani, L .D., Gu rrol a-Briones, G.,
Roumestand, C. & Menez, A. (1995) Determination of the
three-dimensional solution s tructure of noxiustoxin : analysis of
structural differences with related short-chain scorpion toxins.
Biochemistry 34, 16563–16573.
37. Cornet,B.,Bonmatin,J.M.,Hetru,C.,Hoffmann,J.A.,Ptak,M.
& Vovelle, F. (1995) Refined three-dimensional solution structure
of insect defensin A. Structure 3, 435–448.
38. Bruix, M., Jimenez, M.A., Santoro, J., G onzalez, C., Colilla, F .J.,
Mendez, E. & Rico, M. ( 1993) Solution structure of gamma 1-H
and gamma 1-P thionins from barley and wheat endosperm
determined by 1H-NMR: a structural motif common to toxic

arthropod proteins. Biochemistry 32, 715–724.
39. Terras, F.R., Torrekens, S., Van Leuven, F., Osborn, R.W.,
Vanderleyden, J ., Cammue, B .P. & Broekaert, W.F. (1 993) A n ew
family of basic cysteine-rich plant antifungal proteins from
Brassicaceae species. FEBS Lett. 316, 233–240.
40. Bontems, F., Gilquin, B ., Roumestand, C., Menez, A. & Toma, F.
(1992) Analysis of side-chain organization on a refined model of
charybdotoxin: structural and f unctional implications. Biochem-
istry 31, 7756–7764.
41. Johnson, B.A. & Sugg, E.E. (1992) Determination of the three-
dimensional structure of iberiotoxin in solution by 1H nuclear
magnetic resonance spectroscopy. Biochemistry 31 , 8151–8159.
42. Martins, J.C., Zhang, W .G., Tartar, A ., Lazdunski, M. &
Borremans, F.A. (1990) Solution c onformation of leiurotoxin I
(scyllatoxin) by
1
H nuclear magnetic resonance. Resonance
assignment and secondary structure. FEBS Lett. 260, 249–253.
43. Park, C.S. & Miller, C. (1992) Interaction of charybdotoxin with
permeant ions inside the po re of a K
+
channel. Neuron 9, 307–313.
44. Menez, A., Bontems, F., Roumestand, C., Gilquin, G. & Toma, F.
(1992) Analysis of side-chain organization on a refined model of
charybdotoxin: structural and functional implications. Proc. R.
Soc. Edinburgh 99B, 83–103.
45. Aiyar, J., W ithka, J.M., Rizzi, J.P., Singleton, D.H., Andrews,
G.C., Lin, W., Boyd, J., Hanson, D.C., Simon, M., Dethlefs, B.
et al. (1995) Topology of the pore-region of a K+ channel
revealed by the NMR-derived structures of scorpion t oxins.

Neuron 15, 1169–1181.
46. Goldstein, S.A., Pheasant, D.J. & Miller, C. (1994) The char-
ybdotoxin receptor of a Shaker K
+
channel: peptide and
channel residues mediating molecular recognition. Neuron 12,
1377–1388.
47. Gairi, M., Romi, R., Fernandez, I., Rochat, H., Martin-Eauclair e,
M.F., Van Rietschoten, J., Pons, M. & Giralt, E. (1997) 3D
structure of kaliotoxin: is residue 34 a key for channel selectivity?
J. Pept. Sci. 3, 314–319.
48. Dauplais, M., Lecoq, A., Song, J ., Cotton, J., Jamin, N., Gilquin,
B., Roumestand, C., Vita, C., de Medeiros, C.L., Rowan, E.G.,
Harvey, A.L. & Menez, A. ( 1997) On the convergent evolution of
animal toxins. Conservation of a diad of functional residues in
potassium channel-blocking toxins with unrelated structures.
J. Biol. Chem. 272, 4302–4309.
49. Gasparini, S. , Danse, J .M., Lecoq, A., Pinkasfeld, S., Zinn-Justin,
S., Young, L.C., de Me deiro s, C.C., Rowan, E.G., H arvey, A.L . &
Menez, A. (1998) Delineation of the functional site of alpha-
dendrotoxin. The functional topographies of dendrotoxins are
different but share a conserved core with those of other Kv1
potassium channel-blocking toxins. J. Biol. Chem. 273,
25393–25403.
50. Hidalgo, P. & MacKinnon, R. (1995) Revealing the architecture of
aK
+
channel pore through mutant cycles with a peptide inhib itor.
Science 268, 307–310.
51. Krezel, A.M., Kasibhatla, C., Hidalgo, P., MacKinnon, R. &

Wagner, G. (1995) Solution structure o f the potassium channel
inhibitor agitoxin 2 : caliper for pro bing channel geometry. Protein
Sci. 4, 1478–1489.
52. Ranganathan, R., Lewis, J .H. & MacKinnon, R. (1996) Spatial
localization of the K
+
channel selec tivity filter by mutant cycle-
based structure analysis. Neuron 16, 131–139.
53. Tytgat, J. (1994) Mutations in the P-region of a mammalian
potassium channe l (RCK1): a co mparison with t he Shak er
potassium channel. Biochem. Biophys. Res. Commun. 203,
513–518.
54. Gomez-Lagunas, F., Olamendi-Portugal, T., Zamudio, F.Z. &
Possani, L.D. (1996) Two novel toxins from the venom of the
scorpion Pandinus imperator show th at the N-term inal amino a cid
sequence is important for their affinities towards Shaker B K
+
channels. J. Membr. Biol. 152, 49–56.
55. Bougis, P.E., Rochat, H. & Smith, L.A. (1989) Precursors of
Androctonus australis scorpion neurotoxins. Structures of pre-
cursors, processing outcomes, and expression of a functional
recombinant toxin II. J. Biol. Chem. 264, 1 9259–19265.
56. Carbonell, L.F., Hodge, M.R., Tomalski, M.D. & Miller, L.K.
(1988) Synthesis of a gene coding for an insect-specific scorpion
neurotoxin and a ttempts to express i t usin g baculovirus v ectors.
Gene 73, 409–418.
57. Pang, S.Z., Oberhaus, S.M., Rasmussen, J.L., Knipple, D.C.,
Bloomquist, J.R., Dean, D.H., Bowman, K.D. & Sanfor d, J.C.
(1992) Expression of a gene encoding a scorpion insectotoxin
peptide in yeast, bacteria and plants. Gene 116, 165–172.

58. Dee, A., Belagaje, R.M., Ward, K., Chio, E. & Lai, M.H.
(1990) Expression and secretion of a functional scorpion
insecticidal toxin in cultured mouse cells. Biotechnology 8,
339–342.
59. Ducancel, F., Boulain, J.C., Tremeau, O. & Menez, A. (1989)
Direct expression in E. coli of a f unction ally active prote in A -snake
toxin fusion protein. Protein Eng. 3, 139–143.
60. Swartz, K.J. & M acKinnon, R. (1995) An inhibitor of the Kv2.1
potassium channel iso lated from t he veno m of a Chilean taran tula.
Neuron 15, 941–949.
1864 I. Huys et al. (Eur. J. Biochem. 269) Ó FEBS 2002
61. Legros, C., F eyfant, E., Sampieri, F ., Rochat, H., Bougis, P .E. &
Martin-Eauclaire, M.F. (1997) Influence of a NH2-terminal
extension o n the activity of KTX2, a K
+
channel blocker p urified
from Androctonus australis scorpion venom. FEBS Lett. 417,
123–129.
62. Romi, R., Crest, M ., Gola, M., Sampieri, F., Jacquet, G.,
Zerrouk, H., Mansuelle, P., Sorokine, O., Van Dorsselaer, A., &
Rochat, H. et al. (1993) Synthesis and characterization of
kaliotoxin. Is the 26–32 sequence essential for potassium channel
recognition? J. Biol. Chem. 268, 26302–26309.
63. Sabatier, J.M., Zerrouk, H., Darbon, H., Mabrouk, K.,
Benslimane, A., Rochat, H., Martin-Eauclaire, M.F. & Van
Rietschoten, J. ( 1993) P05, a new leiurotoxin I -like scorpion t oxin:
synthesis and structure–activity relationships of the alpha-
amidated analog, a ligand of C a
2+
-activated K

+
channels with
increased affinity. Biochemistry 32, 2763–2770.
64. Sabatier, J.M., Fremont, V., Mabrouk, K., Crest, M., Darbon, H.,
Rochat, H ., Van Rietschoten, J. & Martin-Eauclaire, M.F. (1994)
Leiurotoxin I , a scorpion to xin s pecific for Ca
2+
-activated K
+
channels. Structure-activity analysis using synthetic analogs. Int. J.
Pept. Protein Res. 43, 486–495.
65. Blatz, A .L. & Magleby, K. L. (19 86) Single apami n-blocked
Ca
2+
-activated K
+
channels of small conductance in cultured rat
skeletal muscle. Nature 323, 718–720.
66. Grissmer, S., Nguyen, A .N., Aiyar, J., Hanson, D .C., Mather,
R.J., Gutman, G.A., Karmilowicz, M.J., Au perin, D.D. &
Chandy, K.G. (1994) Pharmacological characterization of five
cloned voltage-gated K
+
channels, types Kv1.1, 1.2, 1.3, 1.5, and
3.1, stably expressed in mammalian c ell lines. Mol. Pharmacol. 45 ,
1227–1234.
67. Leonard, R.J., Garcia, M.L., Slaughter, R.S. & Reuben, J.P.
(1992) Selective blockers of v oltage-gated K
+
channels depolarize

human T lymphocytes: mechanism o f the antiproliferative effect of
charybdotoxin. Proc.NatlAcad.Sci.USA89, 10094–10098.
68. Pongs, O. (1992) Molecular biology of voltage-dependent potas-
sium channels. Physiol. Rev. 72 , S69–S88.
69. Laraba-Djebari, F., Legros, C., Crest, M., Ceard, B., Romi, R.,
Mansuelle, P., Jacquet, G., van Rietschoten, J., Gola, M., &
Rochat, H. et al. (1994) The kaliotoxin family enlarged. Purifica-
tion, characterization, and precursor nucleotide sequence of
KTX2 from Androctonus australis venom. J. Biol. Chem. 269,
32835–32843.
Ó FEBS 2002 Novel K
+
channel blocker parabutoxin 3 (Eur. J. Biochem. 269) 1865