Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

Molecular cloning and functional expression of a gene encoding an
antiarrhythmia peptide derived from the scorpion toxin
Fang Peng
1
, Xian-Chun Zeng
1
, Xiao-Hua He
1
, Jun Pu
2
, Wen-Xin Li
1
, Zhi-Hui Zhu
2
and Hui Liu
1
1
Department of Biotechnology, College of Life Sciences, Wuhan University, China;
2
Department of Cardiology, Tongji Hospital,
Huazhong University of Science and Technology, Wuhan, China
From a cDNA library of Chinese scorpion Buthus martensii
Karsch, full-length cDNAs of 351 nucleotides encoding
precursors (named BmKIM) that contain signal peptides of
21 amino acid residues, a mature toxin of 61 residues with
four disulfide bridges, and an extra Gly-Lys-Lys tail, were
isolated. The genomic sequence of BmKIM was cloned and
sequenced; it consisted of two exons disrupted by an intron
of 1622 bp, the largest known in scorpion toxin genomes,
inserted in the region encoding the signal peptide. The
cDNA was expressed in Escherichia coli.Therecombinant

BmKIM was toxic to both mammal and insects. This is the
first report that a toxin with such high sequence homology
with an insect-specific depressant toxin group exhibits toxi-
city to mammals. Using whole cell patch-clamp recording, it
was discovered that the recombinant BmKIM inhibited
the sodium current in rat dorsal root ganglion neurons
and ventricular myocytes and protected against aconitine-
induced cardiac arrhythmia.
Keywords: sodium current; ventricular myocyte; rat dorsal
root ganglion; BmKIM; patch-clamp.
Scorpion venom is a rich resource for various bioactive
peptides. Accumulated data have demonstrated that scor-
pion neurotoxins affect the ion permeability of excitable
cells by specific interaction with Na
+
,K
+
,Ca
2+
or Cl
–
channels [1–3]. Scorpion toxins that interact with sodium
channels are composed of 60–70 amino acid residues, which
can be divided into a or b mammal neurotoxins and
classified as excitatory or depressant insect-selective neuro-
toxins according to biological specificity in vivo, pharmaco-
logical and electrophysiological activity [4,5]. The a-toxins
bind to mammalian Na
+
channels on site 3 in a voltage-

dependent manner and slow their inactivation by modula-
ting their voltage dependence. Unlike scorpion a-toxins,
b-toxins bind in a voltage-independent manner to site 4 on
the mammalian Na
+
channels and shift the activation
voltage to more negative potentials [6,7]. Scorpion insect
toxins are selectively active on lepidopterous and dipterous
insects [8]. The excitatory toxins cause a fast excitatory
paralysis in animals and induce repetitive firing in insect
nerves; in contrast, the depressant toxins cause a slow
depressor flaccidity due to depolarization of the nerve
membrane and blockage of the sodium conductance in
axons [9,10]. Although some toxins act specifically on
mammals and insects, others additionally affect both groups
and crustaceans [11–13].
Thus far, hundreds of distinct peptides specific for Na
+
channels have been purified from 20 to 30 different species
of scorpions; at least 120 complete primary structures have
been identified [14,15]. Most of the effects of these peptides
have been demonstrated in nerve and skeletal muscle and
with lower frequency in cardiac muscle even though the
incidence of cardio-pulmonary abnormalities induced by
the scorpion sting is well documented [16,17]. In fact, the
concept of toxicity should include not only neurotoxins but
also other toxins. The Asian scorpion Buthus martensi
Karsch (BmK) is not dangerously venomous for mammals;
in fact, its components have demonstrated antihyperalgesic
and antiepileptic effect [18,19]. In traditional Chinese

medicine, BmK has been used for its reversal effects on
circulation failure. However, the cardiovascular effects of
BmK venom have not been systematically studied and the
mechanism underlying the alterations in cardiovascular
function remains unclear [20]. In our present work, we
describe the cloning of the gene sequence of BmKIM, the
functional expression of the recombinant toxin in Escheri-
chia coli and its effect on the sodium channels of neurons
and ventricular myocytes.
EXPERIMENTAL PROCEDURES
Materials
Buthus martensi Karsch scorpion were collected from farm
areas in Hubei province in China. Sarcophaga falculata
blowfly larvae, Sprague–Dawley (SD) rats, and albino
Kunming mice were bred in the laboratory. E. coli strains
BL21 and vector pGEX-5x-1 were used for expression.
Corrspondence to W X. Li, Department of Biotechnology,
College of Life Sciences, Wuhan University, Wuhan 430072, China.
Fax: + 86 27 87883833, Tel.: + 86 27 87682831,
E-mail: ,
Abbreviations:IPTG,isopropylthio-b-
D
-galactoside; GSH, glutathi-
one; GST, glutathione S-transferase; DRG, dorsal root ganglia;
PVC, premature ventricular complex; VT, ventricular tachycardia;
VF, ventricular fibrillation.
Note: The nucleotide sequences reported in this paper have been
submitted to the GenBank with accession numbers AF459791 and
AF459792.
(Received 6 May 2002, revised 16 July 2002, accepted 25 July 2002)

Eur. J. Biochem. 269, 4468–4475 (2002) Ó FEBS 2002 doi:10.1046/j.1432-1033.2002.03136.x
Synthesis of oligonucleotide probe
The oligonucleotide probe used to screen the venom
gland cDNA library, constructed as described previously
[21], was designed according to the conserved region of
the amino acid sequence of insect-specific depressant
toxins (G39–D49). The sequence of the probe was
5¢-GGACTTGCATGCTGGTGTGAAGGCCTTCCTG
AT-3¢. The probe was
32
P-end-labelled using T4 polynucleo-
tide kinase.
Screening of the venom gland cDNA library
Ten thousand clones from the venom gland cDNA library
were analyzed by the
32
P-end-labelled oligonucleotide
probe. High and low density screenings of bacterial colonies
for recombinant plasmids were performed on nylon filters
as described previously [22].
Amplification of genomic DNA of BmKIM
The oligonucleotides used for PCR were the following:
forward primer A1, 5¢-GCC
GGATCCTGATTGCCTA
GAAGATGA-3¢; reverse primer A2, 5¢-GCC
CTCGAG
TCAACCGCATGTATTACTTTCAG-3¢.Theforward
and reverse primers were preceded by BamHI and XhoI
sites (underlined), respectively, to allow ligation into
pBluescript. PCR was used to amplify the genomic

DNA encoding the conserved region of BmKIM precur-
sors. The scorpion BmK genomic DNA was purified
from the muscle tissue of scorpions as previously des-
cribed [23] and used as the template for PCR. The
product was reamplified by a second PCR reaction with a
nested gene-specific primer, 5¢-GCCCTCGAGCACCG
AAGCCTTTGCATTC-3¢ corresponding to the amino acid
sequence K25–Y32 and the same forward primer as the first
PCR.
DNA sequence analysis
Nucleotide sequence was determined using PE Biosystem
Model 377 DNA sequence with universal T7 promoter
primers according to the method of Sanger.
Construction of expression vector pGEX-5x-1-BmKIM
The template used for PCR was the double strand cDNA of
BmKIM inserted into pSPORT I. The primers A3 were as
follows: 5¢-GCC
GGATCCCCGATGACGATGACAAG
GATGGATATATAAGA-3¢ as forward primer containing
a BamHI restriction enzyme site (underlined) and corres-
ponding to five codons encoding an enterokinase cleavage
site and positions 64–79 of the BmKIM cDNA, i.e.
NH
2
-terminal residues 1–5 of BmKIM. The reverse primer
A2, that carried a XhoI restriction enzyme site and stop
codon, corresponded to positions 227–246 of BmKIM
cDNA. PCR was performed and the PCR product was
cloned into pGEX-5X-1 after digestion with BamHIand
XhoI and purification. The in-frame fusion was confirmed

by the dideoxynucleotide sequencing method with univer-
sal pGEX primers. E. coli BL21 was used for plasmid
propagation.
Cleavage of fusion protein and purification
by affinity chromatography
E. coli strain BL21 carrying the pGEX-BmKIM was grown
at 37 °C in Luria–Bertani broth containing 50 lgÆmL
)1
ampicillin. When the cell density had reached D
600
¼ 0.6,
induction was initiated by the addition of 1.0 m
M
isopropyl
thio-b-
D
-galactoside (IPTG). Cells were harvested 4 h after
addition of IPTG by centrifugation and resuspension in
1.0 mL water per 50 mL of culture. The supernatant from
the bacterial cell lysate obtained by sonication was added to
prepacked glutathione (GSH) Sepharose 4B and washed in
50 m
M
Tris/HCl and 10 m
M
EDTA buffer, adjusted to
pH 8.0. After elution of the unbound proteins, the bound
GSH binding protein termed fusion protein glutathione
S-transferase-BmKIM (GST-BmKIM) was eluted from the
GSH agarose in the same buffer containing 20 m

M
GSH or
cleaved directly by enterokinase. The buffer 50 m
M
Tris/
HCl, 5 m
M
CaCl
2
,40m
M
dithiothreitol, and 14 m
M
EDTA, adjusted to pH 8.0 containing enterokinase was
added to the column which bind the fusion protein GST-
BmKIM at 26 °C. The eluate containing enterokinase was
added again to the column. The operation was repeated
three times which took about 10 min. The cleavage yield
was eluted from the GSH gel in the water. The recombinant
toxin was then purified and desalted using Sephadex G-50
column (100 mL). Fractions were collected and analyzed by
SDS/PAGE; the fractions containing the recombinant
BmKIM protein were then lyophilized.
Amino acid composition analysis and N-terminal
sequencing
Amino acid analysis was carried out essentially as described
by Liu & Chang [24]. The sample was hydrolyzed by 2%
(v/v) tryptamine/4
M
-toluene-p-sulfonic acid at 110 °Cfor

24 h. Analysis of this preparation was completed using a
121-MB Beckman amino acid analyzer. An Applied Bio-
systems 476A sequencer was used for automated Edman
degradation. The phenylthiohydantoin derivatives of the
amino acids were identified using an Applied Biosystems
Model 120A PTH-Analyzer.
Circular dichroism spectroscopy
CD spectra were obtained between 250 and 180 nm on a
Jasco-715 spectropolarimeter using a quartz cell of 2 mm
path length with a sample concentration of 0.24 mgÆmL
)1
.
Spectra were measured at 2 nm intervals with a time
constant of 1 s at 25 °C. Data were collected from 10
separate recordings and averaged by using a microcompu-
ter. Data were expressed as the variation of molar amino
acid residue absorption coefficient (De). The secondary
structure content was determined according to the method
of Hennessey and Johnson [25].
Toxicity tests
Toxicity was tested by ventral injection of 2 lL aqueous
samples into 100 ± 2 mg, 5–6 day old Sarcophaga falculata
blowfly larvae and by tail vein injection of 200 lL,
subcutaneous injection of 2 mL, or intracerebroventricular
Ó FEBS 2002 Molecular cloning and function of gene BmKIM (Eur. J. Biochem. 269) 4469
injection of 2 lL aqueous samples into 20 ± 2 g albino
Kunming mice. Each sample was tested in six larvae or three
mice. The development of toxic effects was then monitored
over the next 2 days. Similar buffers or saline were used as
negative controls. The FPU

50
(flaccid paralysis unit), LD
50
(lethal dose) values were calculated according to the
methodology of Behrens & Karber [26].
Preparation of adult rabbit ventricular myocyte
The rabbit ventricular myocyte were prepared by an
improved enzymatic dissociation method [27]. The heart
were perfused through the aorta with Ca
2+
-free Tyrode’s
solution at 37 °C, followed by the Ca
2+
-free Tyrode’s
solution with added amounts of 0.2 m
M
Ca
2+
and 0.04%
collagenase I over an 8-min period. After perfusion, the
resected ventricles were minced into small pieces, incubated
in fresh Tyrode’s solution for 5–10 min. The isolated cells
were resuspended in the Tyrode’s solution containing 0.05%
BSA, and the Ca
2+
concentration was gradually increased
to 1.0 m
M
.TheCa
2+

-free Tyrode’s solution contained
(m
M
): NaCl 135, KCl 5.4, MgCl
2
1.0, NaH
2
PO
4
0.33, Hepes
10, glucose 10, adjusted to pH 7.25 with 1.0
M
NaOH.
Preparation of albino rats dorsal root ganglia neurons
Dorsal root ganglia (DRG) neurons were obtained from the
lumbar region of albino rats, and neurons were isolated by
the method described previously [28]. Ganglia were digested
with 0.2% collagenase II in a Hanks’ solution for 90 min
and then 0.1% trypsin for 10 min. After the treatment with
enzymes, the digested DRGs were triturated and washed
with Hanks’ solution three times. After resuspension in
Dulbecco’s minimum essential medium/F12 solution sup-
plemented with 10% fetal bovine serum, neurons were
plated on to polyornithine-coated coverslips. Isolated neu-
rons were incubated in 95% air plus 5% CO
2
for 2–7 h prior
to the experiment.
Whole-cell patch-clamp recording
The sodium current (I

Na
) of single cells was recorded using
the whole cell voltage clamp technique. The chamber was
continuously perfused at a temperature of 15 °Cinexternal
solution (m
M
): (NaCl 30, choline chloride 110, KCl 5.4,
CaCl
2
0.1, MgCl
2
1.0, NaH
2
PO
4
0.33, and Hepes 10 titrated
to pH of 7.3 with 1
M
NaOH). The solution inside the suction
pipette contained (m
M
): CsCl 120, CaCl
2
1.0, MgCl
2
5.0,
Na
2
ATP 5.0, EGTA 11, Hepes 10, and glucose 11, titrated to
pH of 7.3 with 1 m

M
CsOH. Using this solution allowed an
effective isolation of I
Na
from other ionic currents. A holding
potential of )80 mV was chosen. The pipette had a tip
resistance of less than 1.0
M
W, while the input resistance of
the cells was about 1.0 GW. Membrane currents were
measured with pipettes pulled from glass capillary tubes
and connected to an EPC-9 amplifier operating
PULSE
/
PULSEFIT
Software (HEKA Elektronik, Germany).
Aconitine-induced arrythmia model
Sprague–Dawley (SD) rats, weighing 230 ± 20 g, were
anesthetized with sodium pentobarbital (50 mgÆkg
)1
, i.p).
The experiments were carried out in accordance with the
guidelines laid down by the National Institutes of Health in
the USA regarding the care and use of experimental animals
and committee giving approval for the experiments. The
right jugular vein was cannulated for drug administration.
The lead II ECG maintained continuous readings using a
polygraph system. One hour after the intravenous admini-
stration of BmKIM (dissolved in distilled water and
administered in a volume of 0.5 mL per 250 g body wt),

aconitine was infused intravenously at a dose of 4 lgÆmin
)1
.
The times at which PVC (premature ventricular com-
plex), VT (ventricular tachycardia), and VF (ventricular
fibrillation) appeared were noted and recoded; the cumu-
lative aconitine dosage to induce PVC, VT, VF was
calculated. Data are expressed as mean ± SEM. Differences
between control and treatment groups were analyzed by
Dunnett’s test, paired t-test. Difference at a P-value < 0.05
was considered to be statistically significant.
RESULTS
Isolation and sequencing of BmKIM cDNA
The yield from the initial screening of the cDNA library
with the
32
P-labeled cDNA probe was about 260 positive
clones. On the final screening, 25 clones were selected on the
basis of the strength of the autoradiographic signal.
Restriction analysis revealed size variation of the insert
between 380 and 530 bp. The seven longest inserts were
subjected to sequence analysis. The nucleotide sequence
obtained was displayed an ORF of 258 bp encoding a
polypeptide of 85 amino acids and termed BmKIM. The 5¢
and 3¢ UTRs of BmKIM cDNA are 17 bp and 76 bp,
respectively. A single AATAAA polyadenylation signal was
found 11 nt upstream of the poly (A) tail. There was only
one stop codon (TAA) at the 3¢ terminus of the ORF. The
cDNA sequence has been submitted to GenBank under
accession number AF45972.

A search for deduced amino acid sequence homology
revealed that the precursor of BmKIM showed 89, 82, 82,
79, 75, and 69% sequence identity with that of BmKAEP
[29], BaIT
2
[30], LqqIT
2
[31], LqhIT
2
[32], BmKIT
2
[33], and
BjIT
2
[34], respectively (BmKAEP and BmKIT
2
are derived
from Buthus martensii Karsch; BaIT
2
from Buthacus
arenicola; LqqIT
2
from Leiurus quinquestriatus quinquestri-
atus; LqhIT
2
from Leiurus quinquestriatus hebraeus;BjIT
2
from Buthotus judaicus). This suggested that the signal
peptide cleavage occurred at the nucleotide 1702. Moreover,
the mature toxin should be composed of 61 amino acid

residues, which would be expected to lose three carboxy-
terminal amino acids (Gly-Lys-Lys) during post-transla-
tional processing according to a variety of rules applicable
to processing of neuroactive peptides [35]. BmKIM dis-
played high sequence homology with depressant insect-
selective toxins (BmKAEP, BaIT
2
, LqqIT
2
, LqhIT
2
,
BmKIT
2
and BjIT
2
). However, in comparison with these
toxins, BmKIM was not homologous at several positions:
Ile12, Trp16, Gly27, Phe28, and Tyr31; all other group
toxins contain Ser at position 31. Both this group and most
sodium-channel-binding scorpion toxin peptides have a
conserved Ser (or Ala or Asp) residue before the fifth Cys
residue, i.e. a small molecular residue rather than an
aromatic residue, such as Tyr. Also interesting is the fact
that Gly6 and Ser57 are highly conserved in depressant
4470 F. Peng et al. (Eur. J. Biochem. 269) Ó FEBS 2002
insect-select toxins from BmK (BmKIM, BmKAEP and
BmKIT
2
), but Arg6 or Lys6 and Thr57 are conserved in

other scorpion species.
Cloning and analysis of genomic sequence of BmKIM
We have isolated, cloned and sequenced the genomic
regions encoding BmKIM toxin. The genomic amplification
of BmKIM by nested PCR yielded a major band of about
1900 bp. The sequence has been submitted to GenBank
under accession number AF45971. Sequence analysis of this
fragment confirmed that the genomic gene of BmKIM
consisted of two exons disrupted by an intron of 1622 bp.
This intron is in the sequence encoding the signal peptide,
after the first base (G) of an Asp codon at position 63,
beginning with GT and ending with AG, consistent with
previously reported intron junctions. The sequence of the 5¢
splice donor was 5¢-G/gtaag and that of the 3¢ splice
acceptor was 5¢-ag/C; these sequences are consistent with
the consensus found in other scorpion toxins [14]. Using A3
and A2. corresponding to the mature toxin region as
primers, and the BmKIM genomic DNA as template for
PCR, the nucleotide sequence obtained was the same as the
cDNA. Therefore, there is only one intron in the sequence
encoding the signal peptide. The position and structure of
BmKIM intron are quite similar to that of other scorpion
sodium toxins, but so far it is the longest among known
scorpion toxin introns.
Construction of expression vectors and expression
of the fusion proteins
The cDNA encoding BmKIM was amplified by PCR with
forward and reverse primers. The noncoding regions, the
signal peptide and the three carboxy-terminal residues (Gly-
Lys-Lys) of the toxin were removed from the cDNA and

specific restriction enzyme sites were added to facilitate
insertion into the pGEX-5X-1 expression vector, such that a
gene fusion (GST-BmKIM) could be constructed. In the
construction, five codons encoding an enterokinase cleavage
site (encoding DDDDK) were added at the BmKIM
restriction site 5¢ to the factor Xa sequence such that the
linkage between GST and BmKIM in the fusion was
IEGRGIPDDDDK. These constructs were used to trans-
form E.coli and were expressed upon IPTG induction.
Optimal expression was achieved after 3 h of induction with
1.0 m
M
IPTG at 28 °C, adjusted to pH 8.0 with 10
M
NaOH, which formed the GST derivatives as a soluble
protein but not inclusion bodies. Periplasmic extracts
(before and after induction) of the transformants were
subjected to SDS/PAGE (Fig. 1). GST-BmKIM was then
purified from these extracts on an GSH affinity column as
exhibited in Fig. 1; intense bands corresponding to the
molecular masses of the expected proteins were obtained:
26 kDa for GST and 33 kDa for GST-BmKIM. The yields
of affinity-purified proteins were 10 mgÆL
)1
of culture,
estimated by Bradford means [36].
Enzymatic cleavage of fusion protein and purification
of the recombinant BmKIM
The fusion protein was cleaved completely with an entero-
kinase/substrate ratio of 50% at 26 °C for 10 min on the

GSH gel (Fig. 1). The recombinant BmKIM (rBmKIM)
was eluted from the GSH gel, purified and desalted using
Sephadex G-50 column (100 mL). The purified rBmKIM
migrated as a 6.7 kDa protein in a SDS/PAGE (Fig. 1). The
final yield of recombinant BmKIM was approximately
1–2 mgÆL
)1
of culture. The amino acid composition of
rBmKIM and the N-terminal sequence obtained from
sequencing DGYIRGSNGC were identical with the pre-
dicted protein. This clearly indicated that the expressed
rBmKIM fused with GST protein was processed correctly
by the enterokinase.
Circular dichroism spectrum
The CD spectrum of rBmKIM between 180 and 250 nm
was similar to those of other scorpion toxins (AaHIT2 [37],
CssII [38]; AaHIT2 is anti-insect toxin purified from the
venom of the Scorpion Androctonus australis Hector; CssII,
b-type antimammal toxin from Centruroides suffuses suffu-
ses). They were characterized by minima at 207 nm and by a
maximum at 190 nm. The negative band at 207 nm had a
lower intensity in the case of rBmKIM in comparison with
that in the spectra of AaHIT2 (a-toxin) and CssII (b-toxin).
Moreover, a weak negative band at 227 nm, present in the
CD spectrum of rBmKIM, was not observed in the CD
spectra of AaHIT2 or CssII; this could be related to n À p*
transition characteristic of b-turn structures(Fig. 2). By use
of CD data, the secondary structure content of rBmKIM
(Table 1) was calculated according to the method of
Hennessey & Johnson [25]. The sum of all the secondary

structures obtained by CD analysis fell between 0.90 and
1.10, and the values for contents in secondary structures
were either positive or never below )0.05 (Table 1). As
shown in Table 1, the CD data analysis of BmKIM was
Fig. 1. Expression and cleavage of gene GST-BmKIM fusion protein.
GST-BmKIM was expressed in E.coli BL21 by IPTG induction. The
fusion protein was purified with GSH agarose system and G-50 col-
umn chromatography. BmKIM was liberated from the fusion protein
by enterokinase. Coomassie-strained gel of Laemmli 15% poly-
acrylamide gel of uninduced cell-free extract of E.coli carrying pGEX-
5x-1-BmKIM (lane 1); total cell-free extract induced with IPTG for 3 h
(lane 2); molecular mass markers indicated at 31, 20, 16, 14, 6.3 and 3.5
kDa (lane 3); purified fusion protein by GSH agarose system (lane 4);
purified GST (26 kDa) by GSH agarose system (lane 5); cleavaged
fusion protein by enterokinase (lane 6); and purified recombinant
BmKIM (lane 7).
Ó FEBS 2002 Molecular cloning and function of gene BmKIM (Eur. J. Biochem. 269) 4471
compared to the CD data analyses of other scorpion toxins
and displayed the similar secondary structure. Therefore,
the rBmKIM was a correctly refolded recombinant toxin.
Effect of rBmKIM on sodium currents in DRG neurons
and ventricular myocytes
The membrane potential of DRG neurons and ventricular
myocytes was held at )80 mV, close to the resting
membrane potential. Whole cell path-clamp recording
revealed that rBmKIM could inhibit the total sodium
currents both in DRG neurons and ventricular myocyte
(Fig. 3A). The effect of BmKIM on current–voltage (I–V)
relationship was examined between )70 and +30 mV in
10 mV steps. As shown in Fig. 3B, there was no shift of

either the threshold, peak or equilibrium potential of I
Na
under control conditions, in the presence of rBmKIM. This
was identical with the predicted function (a depressant
toxins, which inhibited the sodium current) based on its high
sequence homology with depressant toxins. Moreover, the
effect on DRG neurons and ventricular myocyte were both
dose-dependent. At higher concentration, rBmKIM inhi-
bited the sodium currents completely, at low concentration,
just half or less. The relative changes in the peak I
Na
were
plotted as a function of toxin concentration (Fig. 4). The
continuous line was drawn according to the equation: the
percentage decrease in I
Na
¼ (IC
50
/[C] + 1)
)1
where [C] is
the toxin concentration, and IC
50
is the dose for 50% block.
As shown in Fig. 4, there was difference in the effect of
rBmKIM on the DRG neurons and ventricular myocyte.
The response of DRG neurons to rBmKIM (IC ¼
0.498 l
M
) was shifted to a substantially lower concentration

than the response of ventricular myocytes to rBmKIM
Table 1. Secondary structure analyses. H, a-helix; A, antiparallel
b-sheet;P,parallelb-sheet; T, b-turn; O, other structures. tot, total.
The secondary structures from analysis by the method of Hennessey
and Johnson [25].
Protein H A P T O tot
AaHIT2 0.24 0.34 )0.02 0.25 0.29 1.10
CssII 0.16 0.35 )0.01 0.26 0.24 1.01
BmKIM 0.18 0.30 0 0.28 0.22 0.98
Fig. 2. Circular dichroism spectra of AaHIT2, CssII and BmKIM from
180 to 250 nm De corresponds to the variation of molar amino acid
residue absorption coefficient expressed in
M
)1
Æcm
)1
.
Fig. 3. The inhibitory effects of BmKIM on
cardiac peak sodium currents (I
Na
). (A) Effect
of BmKIM under whole cell patch-clamp
recording. Control of sodium currents recor-
ded by stepping up the membrane from )80 to
+30 mv in 10 mV increments from the hold-
ing potential of )80 mv on ventricular myo-
cyte and DRG neuron. A decrease in the peak
sodium currents is caused by BmKIM.
(B) Relationship of voltage and sodium cur-
rents in the presence and absence of BmKIM.

4472 F. Peng et al. (Eur. J. Biochem. 269) Ó FEBS 2002
(IC ¼ 3.662 l
M
). This suggested rBmKIM interacts with
DRG neuron sodium channels with higher affinity than the
ventricular myocyte sodium channels. Unlike Ts À c
and
CnII-10 (Ts À c
is from Brazilian scorpion Tityus serrula-
tus; CnII-10 is from Mexican scorpion Centruroides noxius),
they are equally potent for cardiac and neuronal Na
+
channels [39].
Pharmacological activity of recombinant BmKIM
Injected into larvae, rBmKIM caused a slow, progressive
depressant flaccid paralysis. The FPU
50
was 2.4 lgper
100 mg. The toxic effect on mice was not achieved by
subcutaneous or intracerebroventricular injection, but only
by intravenous injection of purified rBmKIM. The LD
50
was about 0.8 mgÆkg
)1
. These data indicated that rBmKIM
had toxicity to both mammals and insects, though the
toxicity was at a lower level.
Assay of antiarrhythmia activity
Table 2 illustrates the effects of rBmKIM on aconitine-
induced arrhythmias. Using the model of aconitine-induced

arrhymia in rats and compared with distilled water,
pretreatment of rBmKIM at 50 lgÆkg
)1
significantly
increased the dosage of aconitine required to induced
PVC, VT, and VF. To some extent, these results indicated
that rBmKIM produced antiarrhythmia activity in rat.
DISCUSSION
Toxicity tests in vivo showed that the recombinant toxin had
toxic effect not only on insects but also on mammals,
though the gene of the toxin displayed high sequence
homology with that of insect-specific depressant toxins. This
is first report of such insect-specific toxin had toxic effect on
mammals. Because the toxic effect on the mice was not
found for subcutaneous and intracerebroventricular injec-
tion but only for intravenous injection, it is possible that the
toxic effect of rBmKIM on mammals is relation to the
cardio toxicity.
In fact, various scorpion venoms have been known to
have direct myocardial action and manifest with cardio-
pulmonary abnormalities including cardiac arrhythmias,
arteria hypertension, pulmonary edema and circulatory
failure[16].BmKscorpionvenomhasbeenusedin
traditional Chinese medicine for its reversal effect on
circulation failure. However, the cardiovascular effects of
BmK venom have not been systematically studied and a
regimen for effective treatments has not been established.
The mechanisms underlying these alterations in cardiovas-
cular function remain unclear. It has been suggested that the
cardiovascular effects of scorpion venom are dependent

upon the venom stimulation of the sympathetic and
parasympathetic nervous system [40]. Recently, an increas-
ing number of studies suggest that several scorpion venoms
and some of their purified toxins could directly affect the
functional status of cardiac myocytes [41,42]. Using whole
cell patch-clamp recording, it was determined that BmKIM
inhibited total sodium currents of ventricular myocyte and
protected against aconitine-induced cardiac arrhythmias.
Although the rBmKIM also produced effects on DRG
neurons, the BmKIT
2
(75% sequence identity with
BmKIM) has the same effects on DRG neurons [43] but
has no toxicity to mammals. It suggested that the effect on
DRG neurons wasn’t sufficient to kill mice, and the
ventricular myocyte may be the direct target of the
rBmKIM by intravenous injection.
Knowing that rBmKIM can affect sodium channels of
DRG neurons and that ventricular myocytes possess
different affinity and induce different functions provides
valuable information for the study of nerve and cardiac
Na
+
channels. No doubt, functional expression of BmKIM
would make it possible to further study the biological
mechanisms of cardiovascular effects and its structure.
BmKIM displayed high sequence homology with that of
depressant insect-selective group. It would be of interest to
determine the rationale for the toxicity of BmKIM in
mammals, when other members of the depressant insect-

selective group do not possess this trait. Comparing amino
acid sequences, Tyr31 may be important because it was
Ser is usually found at this position in most of the
sequences of the depressant insect-selective group. In fact,
Ser31 was very conserved in most Na
+
channel-specific
scorpion toxin peptides. It was located at the third or
fourth position before the fifth Cys. Sometimes, Ser31 is
substituted by small residues such as A (Ala) or D (Asp).
Only AaHIT
4
and BmKAS, a specific anti-insect toxin,
also contained a Tyr residue at this position. AaHIT
4
,the
unique anti-insect toxin also has a toxic effect on mammals
and can acts on the a-andb-sites of the mammalian
sodium channel [44]. Therefore, whether Tyr31 is related
Table 2. The amounts of aconitine required to induce arrhythmia in
untreated rats and rats given 50 lgÆkg
)1
of BmKIM. *P <0.05vs.
control.
Dose of aconitine to produce l
)1
gkg
)1
Drug PVC VT VF
Control 38 ± 467± 590± 10

BmKIM 75 ± 5* 100 ± 8* 148 ± 14*
Fig. 4. Concentration–response curve of BmKIM for peak Na current
(I
Na
) at a holding potential of )80mv. The line is a fit of the function
(IC
50
/[C] + 1)
)1
,withIC
50
¼ 4.25 · 10
)6
M
. Points represent mean
value for six cells.
Ó FEBS 2002 Molecular cloning and function of gene BmKIM (Eur. J. Biochem. 269) 4473
to the recognition of different sodium channel needs to be
determined.
Scorpion toxic peptides have a highly conserved, dense
core formed by an a-helix and two to three strands of
b-sheet structural motifs, maintained by disulfide bridges
[11]. Therefore, their species specificity is probably mediated
by rather subtle changes in amino acid residues in selected
positions of the primary structure. It has been suggested that
the net charge of the toxins is important to define the degree
of toxicity of the peptides. Apparently, the positively
charged toxins have lower LD
50
values, in other words,

are more toxic [45]. The aromatic residues may play a major
role in toxin-channel recognition because they not only
affect the binding to Na
+
channels but also alter the
conformation of the receptor by the p electron cloud. So,
aromatic resides might be related to affecting different Na
+
channel, and the residues with positive charged might be
related to the efficiency. This was supported by modification
of the LqhaIT, whose mutations at three sites, Tyr49-Ile,
Ala50-Lys and Asn54-Lys, resulted in a marked decrease in
antimammalian toxicity (6.4-fold) but little change in its
biological activity against insects [46]. We assume that
Tyr31 may determine whether BmKIM acts specifically
towards mammals or arthropods. Additionally, BmKIM
does not have a strong positive potential, which accounts
for its low toxicity to both mammals and insects. Further
modifications of residues that belong to the aromatic cluster
and positive charges may be useful for final determination
of the toxic site and for clarification of the molecular basis
for the wide toxic range of BmKIM.
ACKNOWLEDGEMENTS
We thank Wang Teng and Dr Wang Xi for providing the coordinates
for the electrophysiology of BmKIM; Prof Ma Hui-wen for his
kindness in offering us the plasmid pGEX and GST Gel. Professor Yi
Qing-min for uses his lyophile apparatus and his helpful discussions.
This work was sponsored by the National Natural Science Foundation
of China (No. 39970897).
REFERENCES

1. Catterall, W.A. (1980) Neurotoxins that act on voltage sensitive
sodium channel in excitable membranes. Annu. Rev. Pharmacol.
Toxicol. 20, 15–43.
2. Catterall, W.A. (1988) Structure and function of voltage-sensitive
ion channels. Science 242, 50–61.
3. Martin-Euclaire, M.F. & Couraud, F. (1995) Scorpion neuro-
toxins: effects and mechanisms. In Handbook of Neurotoxicity
(Chang, L.W. & Dyer, R., eds), pp. 683–716. Marcel Decker Press,
New York.
4. Gordon, D., Savarin, P., Gurevitz, M. & Zinn-Justin, S. (1998)
Functional anatomy of scorpion toxins affecting sodium channels.
J. Toxicol. Toxin Rev. 17, 131–159.
5. Gordon, D. (1997) Sodium channels as targets for neurotoxins. In
Toxins and Signal Transduction (Gutman,Y.&Lazarowici,P.,
eds), pp. 119–149. Harwood Academic Publishers, the Nether-
lands.
6. Couraud, F., Jover, E. & Dubois, J.M. (1982) Two types of
scorpion toxin receptor sites, one related to the activation, the
other to the inactivation of the action potential sodium channel.
Toxicon 20, 9–16.
7. Stickhartz, G., Rando, T. & Wang, G.K. (1987) An integrated
view of the molecular toxinology of sodium channel gating in
excitable cells. Annu. Rev. Neurosici. 10, 237–267.
8. Xiong, Y.M., Ling, M.H. & Chi, C.W. (1999) The cDNA
sequence of an excitatory insect selective neurotoxin from the
scorpion Buthus martensi Karsch. Toxicon 37, 335–341.
9. Pelhate, M. & Zlotkin, E. (1982) Actions of insect toxins and other
toxins derivated from the venom of the Scorpion Androctonus
australis on isolated giant axons of the cockroach (Periplameta
americana). J. Exp. Biol. 97, 67–77.

10. Zlotkin, E., Kadouri, D. & Gordon, D. (1985) An excitatory and a
depressant insect toxin from scorpion venom both affect sodium
conductance and possess a common binding site. Arch. Biochem.
Biophys. 240, 877–887.
11. Possani, L.D. (1984) Structure of scorpion toxins. In Handbook of
Natural Toxins (Tu, A.T., ed.), pp. 513–550. Marcel Decker Press,
New York.
12. Loret, E.P., Martin-Eauclaire, M.F., Mansuelle, P. & Sampieri, F.
(1991) An anti-insect toxin purified from the scorpion Androctonus
australis Hector also acts on the alpha- and beta-sites of the
mammalian sodium channel: sequence and circular dichroism
study. Biochemistry 30, 633–640.
13. Lebreton, F., Delepierre, M., Ramirez, A.N., Balderas, C. &
Possani, L.D. (1994) Primary and NMR three-dimensional struc-
ture determination of a novel crustacean toxin from the scorpion
Centruroides limpidus Karsch. Biochemistry 149, 135–146.
14. Possani, L.D., Becerril, B., Delepierre, M. & Tytgat, J. (1999)
Scorpion toxins specific for Na
+
-channels. Eur. J. Biochem. 264,
287–300.
15. Possanin,L.D.,Merino,E.,Corona,M.,Bolivar,F.&Becerril,B.
(2000) Peptides and genes coding for scorpion toxins that affect
ion-channels. Biochimie 82, 861–868.
16. Ismal, M. (1995) The scorpion envenoming syndrome. Toxicon 33,
825–858.
17. Tarasiuk, A., Khvatskin, S. & Sofer, S. (1998) Effects of antivenom
serotherapy on Hemodynamic Pathophysiology in Dogs injected
with L. quinquestriatus scorpion venom. Toxicon 36, 963–971.
18. Wang, C.Y., Tan, Z.Y. & Ji, Y.H. (2000) Antihyperalgesia effect

of BmKIT2, a depressant insect-selective scorpion toxin in rat by
peripheral administration. Brain Res. Bull. 53, 335–338.
19. Zhou, X.H., Yang, D., Zhang, J.H., Liu, C.M. & Lei, K.J. (1989)
Purification and N-terminal partial sequence of anti-epilepsy
peptide from venom of the scorpion Buthus martensi Karsch.
Biochem. J. 257, 509–517.
20. Wang, R., Moreau, P. & Deschamps, A. (1994) Cardiovascular
effects of Buthus Martensii Karsch Scorpion venom. Toxicon 32,
191–200.
21. Zeng, X.C., Li, W.X. & Zhu, S.Y. (2000) Cloning and char-
acterization of the cDNA sequences of venom peptides from
Chinese scorpion Buthus martensii Karsch. Toxicon 38, 893–899.
22. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecullar
Choning: a Laboratory Manual, 2nd edn. Cold Spring Harbor-
Laboratory, Cold Spring Harbor, NY.
23. Gendeh, G.S., Chung, M.C. & Jeyaseelan, K. (1997) Genomic
structure of a potassium channel toxin from Heteractis magnifica.
FEB Lett. 418, 183–188.
24. Liu, Y.Y. & Chang, Y.H. (1971) Hydrolysis of proteins with
p-toluenesulfonic acid determination of tryptophan. J. Biol. Chem.
246, 2842–8848.
25. Hennessey, J.P. & Johnson, W.C. (1981) Information content in
the circular dichroism of protein. Biochemistry 20, 1085–1094.
26. Behrens, B. & Karber, C. (1935) Wie sind Reihenversuche fur
biologische Auswertungen amzweckmabigsten anzuorden. Arch.
Exp. Pathol. Phanmakol. 177, 379–388.
27. Mitra, T. & Morad, M. (1985) A uniform enzymatic method for
dissociate of myocytes from hearts and stomachs in vertebrates.
Am. J. Phsiol. 249, H1056.
28. Sango, K., Horie, H., Takano, M., Inoue, S. & Takenaka, T.

(1994) Diabetes-induced reduction of neuronal survival in hypo-
tonic environments in culture. Brain Res. Bull. 4, 364–368.
4474 F. Peng et al. (Eur. J. Biochem. 269) Ó FEBS 2002
29.Wang,C.G.,He,X.L.,Shao,F.,Liu,W.,Ling,M.H.,Wang,
D.C. & Chi, C.W. (2001) Molecular characterization of an anti-
epilepsy peptide from the scorpion Buthus martensi Karsch. Eur. J.
Biochem. 268, 2480–2485.
30. Cestele, S., Kopeyan, C., Oughideni, R., Mansuelle, P., Granier,
C. & Rochat, H. (1997) Biochemical and pharmacological char-
acterization of a depressant insect toxin from the venom of the
scorpion Buthacus arenicola. Eur. J. Biochem. 243, 93–99.
31. Kopeyan, C., Mansuelle, P., Sampieri, F., Brando, T., Bahraoui,
E.M., Rochat, H. & Granier, C. (1990) Primary structure of
scorpion anti-insect toxins isolated from the venom of Leiurus
quinquestriatus quinquestriatus. FEBS Lett. 261, 423–426.
32. Zilberberg, N., Zlotkin, E. & Gurevitz, M. (1992) Molecular
analysis of cDNA and the transcript encoding the depressant
insect selective neurotoxin of the scorpion Leiurus quinquestriatus
hebraeus. Insect Biochem. Mol Biol. 22, 199–203.
33. Ji, Y.H., Terakawa, S. & Xu, K. (1994) Primary structure of
depressant insect-selective neurotoxin from venom of scorpion
Buthus martensi Karsch. Chinese Sci. Bull. 39, 945–949.
34. Zilberberg, N., Zlotkin, E. & Gurevitz, M. (1991) The cDNA
sequence of a depressant insect selective neurotoxin from the
scorpion Buthotus judaicus. Toxicon 29, 115–1158.
35. Mains, R.E., Dickerson, I.M., May, V., Stoffers, D.A., Perkins,
S.N.,Ouagik,L.,Husten,E.J.&Eiper,B.A.(1990)Cellularand
molecular aspects of peptide hormone biosynthesis. In Frontiers in
Neuroendocrinology (Martini, L. & Ganong, M.F., eds), pp.
52–59. Raven Press, New York.

36. Bradfond, M.M. (1976) A rapid sensitive method for the quanti-
tation of microgram quantities of protein utilizing the principle of
protein-dye binding. Anal. Biochem. 72, 248–254.
37. Loret, E.P., Mansuelle, P. & Rochat, H. (1990) Neurotoxins
Active on insects: amine acid sequences, chemical modification,
and secondary structure estimation by circular dichroism of toxins
from the scorpion Androctonus australis Hector. Biochemistry 29,
1492–1501.
38. Martin-Eauclaire, M.F., Garcia, Y., Perez, L.G., Ayeb, M.,
Kopeyan, C., Bechis, G., Jover, E. & Rochat, H. (1987) Puri-
fication and chemical and biological characterizations of seven
toxins from the Mexican scorpion, Centruroides suffuses suffuses.
J. Biol. Chem. 262, 4452–4459.
39.Yatani,A.,Kirsch,G.E.,Possani,L.D.&Brown,A.M.
(1988) Effects of New world scorpion toxins on single-channel
and whole cell cardiac sodium currents. Am.J.Physiol.254,
H443–H451.
40. Kumar, E.B., Soomro, R.S. & Hamdani (1991) Scorpion venom
cardiomyopathy. Am. Heart J. 123, 725–729.
41. Silveira, N.P., Moraes-Santos, T., Azevedo, A.D. & Freire-maia,
L. (1991) Effects of Tityus serrulatus scorpion venom and one of
its purified toxin on isolated guinea-pig heart. Comp. Biochem.
Physiol. 98c, 329–336.
42. Teixeira, A.L., Fontoura, B.F., Freyve-Maia, L., Machado, C.R.,
Camargos, E.R. & Teixeira, M.M. (2001) Evidence for a direct
action of Tityus serrulatus scorpion venom on the cardiac muscle.
Toxicon 39, 703–709.
43. Li, Y.J., Tan, Z.Y. & Ji, Y.H. (2000) The binding of BmKIT2, a
depressant insect-selective scorpion toxin on mammal and insect
sodium channels. Neuroscience Res. 38, 257–264.

44. Loret, E.P., Martin-Eauclaire, M.F., Mansuelle, P., Sampieri, F.
& Granier, C. (1991) An anti-insect toxin purified from the scor-
pion Androctonus australis Hector also acts on the a-andb-sites of
the mammalian sodium channel: sequence and circular dichroism
study. Biochemistry 30, 633–640.
45. Becerril, B., Corna, M., Coronas, F.I., Zamudio, F. & Possani,
L.D. (1996) Toxic peptides and genes encoding toxin c of the
Brazilian scorpions Tityus bahiensis and Tityus stigmurus. Bio-
chem. J. 313, 753–760.
56. Zilberberg,N.,Gordon,D.,Pelhate,M.,Adams,M.E.,Norris,
T.M. & Zlotkin, E. (1996) Function expression and genetic
alteration of an alpha scorpion neurotoxin. Biochemistry 35,
10215–10222.
Ó FEBS 2002 Molecular cloning and function of gene BmKIM (Eur. J. Biochem. 269) 4475