Study on the association of ahrr rs2292596 and male infertility in vietnamese population (khóa luận tốt nghiệp)

VIETNAM UNIVERSITY OF AGRICULTURE

FACULTY OF BIOTECHNOLOGY
*****************

UNDERGRADUATE THESIS
TITLE:
“STUDY ON THE ASSOCIATION OF AhRR rs2292596 AND
MALE INFERTILITY IN VIETNAMESE POPULATION”

Student

: Tran Huu Dinh

Major

: Biotechnology

Supervisor

: Dr. Nguyen Thuy Duong
Assoc. Prof. Dr. Nguyen Xuan Canh

Hà Nội, 2021


DECLARATION
I hereby declare that this is my own work and that neither any part of this
thesis nor the whole of the thesis has not been previously published in other theses
or dissertations.
I certify that, to the best of my knowledge, my thesis does not violate

anyone’s copyright and that any ideas, methods, citation and other materials are
fully acknowledged in accordance with the standard referencing practices.
Hanoi, February 2nd, 2021
Student

Tran Huu Dinh

i


ACKNOWLEDGEMENTS
First and foremost, I would like to express my sincere gratitude to my
supervisor, Dr. Nguyen Thuy Duong, for her permission to conduct my thesis in
her laboratory and also for her patience, motivation, and immense knowledge. Her
enthusiasm for biology kept me constantly expanded my knowledge and continued
my research. Without her guidance, this thesis would have never been
accomplished. I could not have imagined better supervisors for my undergraduate
thesis.
Additionally, I would like to thank Assoc. Prof. Dr. Nguyen Xuan Canh for
his encouragement and instruction to study outside the the university campus. His
support continuously motivated me to get involve in the scientific research field.
My sincere thanks goes to other lecturer in faculty of Biotechnology in
Vietnam University of Agriculture for supporting and sharing their valuable
knowledge and experiences during my thesis implementation time.
Last but not least, I would like to thank my labmates in human genome
laboratory for their kind assistance, and inspiration during my hard time, especially
Msc. Duong Thi Thu Ha. Without her presious advices, I could not have overcome
difficultities during conducting experiments.
Student

Tran Huu Dinh

ii


CONTENTS
DECLARATION ................................................................................................................... i
ACKNOWLEDGEMENTS .................................................................................................ii
CONTENTS ....................................................................................................................... iii
LIST OF TABLES ............................................................................................................... v
LIST OF FIGURES ............................................................................................................. vi
LIST OF ABBREVIATION...............................................................................................vii
PART 1: INTRODUCTION................................................................................................. 1
PART 2: LITERATURE REVIEW...................................................................................... 2
2.1.

General concept ...................................................................................................... 2

2.2.

Clinical assessment ................................................................................................. 2

2.3.

Causes ..................................................................................................................... 3

2.4.

AhRR and male infertility........................................................................................ 5

2.5.

International research .............................................................................................. 6

2.6.

Vietnam research .................................................................................................... 9

PART 3: MATERIALS AND METHODS ........................................................................ 11
3.1.

Study subjects ....................................................................................................... 11

3.2.

Materials................................................................................................................ 11

3.3.

Methods ................................................................................................................. 12

3.3.1.

Extraction of total DNA from blood samples ................................................ 12

3.3.2.

Primer design ................................................................................................. 13

3.3.3.

Amplification of the DNA region containing AhRR rs2292596 .................... 13

3.3.4.

PCR-RFLP ..................................................................................................... 13

3.3.5.

PCR purification ............................................................................................. 14

3.3.7.

Statistical analysis .......................................................................................... 16

PART 4: RESULTS ........................................................................................................... 18
4.1.

Extraction of total DNA from blood samples ....................................................... 18

4.2.

Amplification of the DNA region containing AhRR rs2292596 ........................... 18

4.3.

PCR-RFLP ............................................................................................................ 19

4.4.

Sanger sequencing ................................................................................................ 20

4.4.

Statistical analysis ................................................................................................. 21

PART 5: DISCUSSION ..................................................................................................... 23
iii


PART 6: CONCLUSION ................................................................................................... 26
PART 7: REFERENCES .................................................................................................... 27
APPENDIX ........................................................................................................................ 32

iv


LIST OF TABLES
Table 2. 1. Four categorizes of underlying causes of male infertility. ...................... 4
Table 3. 1. Primers information. .............................................................................. 11
Table 3. 2. Number and size of DNA bands of 3 genotypes of AhRR rs2292596. .. 14
Table 4. 1. Quantity summary of rs2292596 genotype. ........................................... 20
Table 4. 2. Allele frequency of polymorphism AhRR rs2292596. ........................... 21
Table 4. 3. Correlation between rs2292596 and male infertility. ............................ 22

v


LIST OF FIGURES
Figure 2. 1. Structure of Human AhR, ARNT, and AhRR. (Sakurai et al., 2017) ....... 5

Figure 2. 2 Feedback regulation model of AhR/ AhRR signaling pathway................ 6
Figure 2. 3. Discovery of genes related to male infertility (Xavier et al., 2020)....... 7
Figure 3. 1. Condition of PCR reaction. .................................................................. 13
Figure 3. 2. Recognition site of BsuRI (HaeIII). ..................................................... 14
Figure 4. 1. Total DNA of six samples in 0.8% agarose gel.................................... 18
Figure 4. 2. PCR products amplifying DNA region containing AhRR rs2292596. . 19
Figure 4. 3. BsuRI-digested PCR products of six samples on agarose gel 2.5 %.... 19
Figure 4. 4. Genotyping of AhRR rs2292596 using Sanger sequencing. ................. 21
Figure 5. 1. Frequency of allele G of Vietnamese and other populations. .............. 25

vi


LIST OF ABBREVIATION
AhR

Aryl hydrocarbon receptor

AhRR

Aryl hydrocarbon receptor repressor

ARNT

Aryl hydrocarbon receptor nuclear translocator

AIS

Androgen insensitivity syndrome

aCGH

Microarray-based Comparative Genomic Hybridization

ART

Assisted reproductive technology

AZF

Azoospermia factor

bHLH

basic helix–loop–helix

bp

Base pair

CBAVD

Congenital bilateral absence of the vas deferens

CNV

Copy Number Variation

CUAVD

Congenital unilateral absence of the vas deferens

DNA

Deoxyribonucleic acid

EDTA

Ethylenediaminetetraacetic acid

EtOH

Ethanol

FISH

Fluorescence in situ hybridization

HWE

Hardy – Weinberg equilibrium

MMAF

Multiple morphological abnormalities of the sperm flagella

n

Number

NOA

Non-obstructive azoospermia

OA

Obstructive azoospermia

OD

Optical density

OR

Odd ratio

PAIS

Partial androgen insensitivity syndrome

PAS

Per-Arnt-Sim
vii


PCR

Polymerase chain reaction

SNP

Single nucleotide polymorphism

TAE

Tris – Acetate - EDTA

WHO

World Health Organization

95% CI

95% Confident interval

viii


PART 1: INTRODUCTION
Reproductive impairment is an increasingly urgent problem in developing
countries, especially Vietnam since the national infertile rate of couples during
childbearing age accounts for up to 7.7%. In general, male reproductive concerns
such as low sperm production; abnormal sperm morphology and function;
obstruction of sperm delivery ducts, etc. are responsible for approximately onethird of the childless cases. Moreover, male infertility is a multifactorial disease
caused by varicoceles, retrograde ejaculation, genetic factors, immunologic
infertility, overexposure to certain environmental factors (pesticides, chemicals,
alcohol, smoking, etc.), and many other sources. Among them, genetic factors
contribute a significant part to the infertility since more than 2000 genes are
involving the spermatogenic processes. Worldwide researches have been carried

out in different directions from clinical features to triggered elements of infertility
to discover the underlying causes of infertile problems, among which studies on the
association of genetic polymorphism in specific populations are receiving more and
more global attraction. In Vietnam, most of the studies mainly concentrate on
clinical properties along with infertile treatments, whereas genetic aspects of male
infertility especially genes related to environmental conditions are extremely
limited. As a result, we conducted the study “Study on the association of AhRR
rs2292596 and male infertility in the Vietnamese population”.

1


PART 2: LITERATURE REVIEW
2.1. General concept
According to World Health Organization (WHO), infertility is a disease
characterized by the incapacity to achieve a clinical pregnancy after at least 12
months of unprotected sexual intercourse or due to the deterioration in the
reproductive system of either partner or both (Zegers-Hochschild et al., 2017).
Male infertility is further classified as primary and secondary (Asha, 2017;
Leaver, 2016; Mélodie and Christine, 2018; Zegers-Hochschild et al., 2017). The
former type refers to infertile men have never successfully established a clinical
pregnancy before. The latter indicates men who are unable to initiate a pregnancy
but had previously initiated one or more pregnancies.
Infertility globally affects about 7% of male human population (Krausz et
al., 2015; Krausz and Riera-Escamilla, 2018; Xavier et al., 2020) and is currently
deemed as a global public health issue, resulting in an increase in the number of
governmental concerns in population growth, fertility and mortality rate,
demographic balance, and national health. Furthermore, it is an increasing problem
in the entire world since the age-standardized prevalence rate of male infertility
increased by 8.224% from 1990 to 2017, with an increasing rate of 0.291% per year

(Sun et al., 2019).
2.2. Clinical assessment
Semen analysis is a credible investigation for measuring clinical andrology,
male infertile, reproductive issues, epidemiology, and pregnancy risk assessments
with a sensitivity of nearly 89.6%, which means that it can detect problems from 9
out of 10 men (Butt and Akram, 2013). In 2010, World Health Organization
(WHO) generates a lower reference limit for human semen features by conducting
an analysis of semen samples on a reference male population of over 4500 men
whose partner had a time-to-pregnancy (TTP) of equal or less than 12 months. The
following criteria are based on the fifth centiles (with 95 th percent confidence
2


intervals) (Cooper et al., 2010): semen volume, 1.5 ml; total sperm number, 39
million per ejaculate; sperm concentration, 15 million per ml; vitality, 58% live;
progressive motility, 32%; total (progressive and nonprogressive) motility, 40%;
morphologically normal forms, 4.0%.
The term "Azoospermia" refers to the condition of incapable of producing
sperms, while "Oligospermia" represents a condition, in which the sperm is at a low
concentration (< 15 million sperm/ ml). “Asthenospermia” is a term used to point
out motility problems of sperms, in which less than 40% of the sperm are moving,
and less than 32% are swimming progressively. Abnormalities in spermatozoa are
characterized by the phrase "Teratozoospermia", which means that less than 4% of
the sperm are normally shaped. However, some men in reality can not produce
sperm at all probably due to the blockage along the vas deferens as well as
ejaculatory ducts; thus, completely no semen can be manufactured. This status is
named "Obstructive azoospermia" (OA) to separate it from “Non-obstructive
azoospermia” (NOA), where sperms are still produced without any damage to the
delivery system but more likely due to dampening in the production process.
2.3. Causes

Generally, male reproductive concerns are assumed to account for at least
50% of infertile cases (Mélodie and Christine, 2018). However, male infertility is a
multifactorial disease and can be divided into non-genetic and genetic factors
(Asha, 2017). Genetics accounts for more than 15% of prevalent causes of male
infertility diseases, ranging from chromosome abnormalities to single nucleotide
alterations (Fainberg and Kashanian, 2019; Krausz et al., 2015). The underlying
causes of male infertility based on clinical aspects are categorized in 4 groups
(Table 2.1): (1) spermatogenic quantitative defects; (2) ductal dysfunction; (3)
hypothalamic-pituitary axis disturbances; and (4) spermatogenic qualitative defects
(Krausz and Riera-Escamilla, 2018; Tournaye et al., 2017).
3


Table 2. 1. Four categorizes of underlying causes of male infertility.
Aetiological groups

Diseases

Genetic candidates
Chromosomal anomalies
(numerical or structural)

Azoospermia

Y chromosome deletions (AZFa,

Spermatogenic

AZFb, and AZFc)

quantitative defects

TEX11
Oligozoospermia
Hypoandrogenization owing
to PAIS

gr/gr deletion (AZFc region)
AR

CBAVD
CFTR

Ductal dysfunction
CUAVD
Kallman syndrome
Hypothalamic-pituitary
axis disturbances

Normosmic hypogonadotropic

FGFR1, ANOS1, TAC3, GNRH1,
GNRHR

hypogonadism
Globozoospermia

DPY19L2

Spermatogenic

Sperm macrocephaly

AURKC

qualitative defects

MMAF

DNAH1

PCD

DNAH1, DNAH11, DNAH5

AZF: Azoospermia factor; CBAVD: congenital bilateral absence of the vas deferens; CUAVD:
Congenital unilateral absence of the vas deferens; MMAF, multiple morphological abnormalities
of the sperm flagella; PAIS, partial androgen insensitivity; PCD, primary ciliary dyskinesia;

Despite the efforts of performing many genetic methods to identify the
causes of male infertility, there are still a large number of affected cases remaining
as unknown causes or as idiopathic cases. The reason is probably due to the
extreme genetic complexity as semen and testis histological phenotypes are
heterogeneous, and more than 2,000 genes participate in spermatogenesis (Krausz
and Riera-Escamilla, 2018). Recently, genetic polymorphisms in genes with
common cell function, specific spermatogenic function, and endocrine function
4


have been studied for their association with male infertility (Krausz et al., 2015).

Among them, polymorphisms of AhRR and genes involved in the AhR signaling
pathway had received more attention for their correlation with several diseases
including male infertility.
2.4. AhRR and male infertility
Aryl Hydrocarbon Receptor (AhR) Repressors (AhRR), located on 5p15.33,
spans over 166 kb, and contains 12 exons (Karchner et al., 2009). AhRR protein is
identified as the members of the basic helix-loop-helix (bHLH) Per-ARNT-Sim
(PAS) family (Hollie, 2011). Family members of bHLH-PAS form a heterodimer
with other members of the same family through their N-terminal bHLH-PAS
domains (Figure 2.1). While the bHLH domain is responsible for DNA binding, the
PAS domains (PAS-A and PAS-B) are involved in protein-protein interaction and
ligand binding, which is in the PAS-B domain of AhR but not in AhRR (Sakurai et
al., 2017). The protein of AhRR is involved in the regulation of cell growth and
differentiation and participates in the AhR ligand-triggered pathway, which
includes 3 major molecules: aryl hydrocarbon receptor (AhR), aryl hydrocarbon
receptor repressors (AhRR), aryl hydrocarbon receptor nuclear translocator
(ARNT)

Figure 2. 1. Structure of Human AhR, ARNT, and AhRR. (Sakurai et al., 2017)

In AhR pathway, AhR is a ligand-dependent transcription factor, and diverse
exogenous and endogenous ligands such as 2,3,7,8-tetrachlorodibenzo-p-dioxins
5


(TCDD) induce it. The AhR then triggers the expressions of genes encoding
molecules involved in detoxication, metabolism, and cell differentiation and
proliferation. The main specified AhR target genes are CYP1A1 and AhRR. In the
absence of ligands, AhR resides in the cytoplasm by forming a complex with heat
shock protein 90 (Hsp90), X-associated protein 2, and p23 (Figure 2.2). If TCDD

presents in the cytoplasm, it binds to AhR, and the ligand-bound AhR is
translocated to the nucleus and dimerizes with aryl hydrocarbon receptor nuclear
translocator (ARNT). The ligand-AhR-ARNT complex binds to the cognate
xenobiotic responsive elements (XREs) in the promoter/enhancer regions of
multiple genes, and regulates their transcription. Meanwhile, the expression of
AhRR, which is upregulated by activated AhR, negatively represses the activity of
AhR (Fujii‐ Kuriyama and Kawajiri, 2011). Thus, polymorphisms in such genes
might affect the mediating of dioxins into the body, resulting in male infertility.

Figure 2. 2 Feedback regulation model of AhR/ AhRR signaling pathway

2.5. International research
The searching for the genetic cause of male infertility initiates in the middle
of the twentieth century and remains an attractive field in the present assisted by
6


the development of modern molecular technologies (Xavier et al., 2020) (Figure
2.3). The earliest and most common method for identifying the underlying genetic
abnormalities in infertile men is karyotyping (Krausz and Riera-Escamilla, 2018;
Xavier et al., 2020). Its application was to identify the presence of an extra X
chromosome, which is found in Klinefelter syndrome (47, XXY) (Kydd, 1960;
Strong, 1959) or, by combining with fluorescence in situ hybridization (FISH),
uncover several sex reversal disorders; for example, 46, XX male (de la Chapelle et
al., 1964; Therkelsen, 1964); Robertsonian translocations (Hamerton, 1968).
In 1976, by analyzing karyotype, Tiepolo and colleagues discovered a
deletion of the Y chromosome at the distal portion of band q11 in 6 men with
azoospermia with normal male condition (Tiepolo and Zuffardi, 1976), suggesting
that the region in a long arm of the Y chromosome was indispensable for
spermatogenesis, which was later called Azoospermia Factor (AZF) region.

However, all diseases that had been reported above by using karyotyping are
limited to the identification of male infertility cause in azoospermia and
oligospermia patients (Krausz and Riera-Escamilla, 2018; O'Flynn O'Brien et al.,
2010; Xavier et al., 2020).

Figure 2. 3. Discovery of genes related to male infertility (Xavier et al., 2020).

7


The invention of Sanger sequencing in 1977 and polymerase chain reaction
(PCR) in 1983 shed the light on identifying mutations resulting in male sterility.
However, the first gene was called in 1988 for its connection with male infertility
was on the X chromosome, instead of on the sex chromosome of men. Using a
PCR-based approach along with Southern blotting, Brown, and colleagues were
able to detect a partial deletion of the human androgen receptor gene (AR) in a
subject with complete androgen insensitivity syndrome (AIS) (Terry R. Brown,
1988). In 1989, researchers utilized restriction fragment length polymorphism
(RFLP) following with PCR-based sequencing to detect mutation of CFTR genes in
chromosome 7 (Kerem et al., 1989), and further identified the association and
distribution of mutation in patients with obstructive azoospermia (Anguiano et al.,
1992; V Dumur, 1990). In 1995, using PCR and sequence-tagged sites (STSs),
researchers identified the strongest candidate genes related to males in azoospermic
patients with Y microdeletions, which was named Deleted in Azoospermia (DAZ)
(Renee Reijo, 1995). Further usage of the PCR technique uncovered 3 loci in Yq11,
or previously called AZF region, involving in the spermatogenetic process,
designated as AZFa, AZFb, and AZFc (Vogt et al., 1996).
Since the introduction of microarray in 1995, the approaches to findings of
the genetics of male infertility have become thriving. To identify the idiopathic
etiology of male infertility, genes with common cellular functions such as DNA

repair, xenobiotic metabolism, meiosis, and endocrine regulation were investigated
in addition to spermatogenetic genes. Approximately 70% of reported SNPs reside
in genes with common cell functions but were predicted relevance to germ cells
such as apoptotic, process, DNA repair, detoxification of environmental molecules,
response to reactive oxygen species, etc. (Krausz et al., 2015). At first, large sets of
polymorphic markers had been developed and applied to screen genomes of
infertile men from consanguineous family for identifying infertility genes such as
AURCK (Dieterich et al., 2007), SPATA16 (Dam et al., 2007), and DNAH1 (Ben
8


Khelifa et al., 2014). Later, using microarray-based comparative genomic
hybridization (array CGH) and single nucleotide polymorphisms (SNP) arrays,
genomic deletions and duplications have been increasingly detected. Several genes
with deletions have been discovered such as DPY19L2 (Noveski et al., 2013),
TEX11 (Yatsenko et al., 2015), DMRT1 (Lopes et al., 2013), etc. Along with 2
modern techniques: next-generation sequencing and whole exome sequencing, at
least 300 SNPs disseminated in more than 123 genes and some CNVs had been
described as related to male infertility, but the data remain controversial and
inconsistent (Araujo et al., 2019; Krausz et al., 2015).
Polymorphisms in AhRR and genes of AhR signaling cascade were also
investigated for the association with male infertility because of their function in
mediating foreign chemical into the human body. In 2017, the crystal structure of
the AhRR–ARNT heterodimer was construct to reveal a structural basis for
understanding the mechanism by which AhRR represses AhR-mediated gene
transcription. Previously, polymorphism in AhRR gene had been reported to be
associated with a variety of diseases including rheumatoid arthritis (Cheng et al.,
2017), oral cancer (Cavaco et al., 2013), germ cell cancer (Brokken et al., 2013),
and also reproductive diseases: endometriosis (Tsuchiya et al., 2005; Watanabe et
al., 2001) and micropenis (Fujita et al., 2002; Soneda et al., 2005). Among the

studies, the polymorphism AhRR rs2292596 was proposed to be crucial in the
function of the signaling pathway. In fact, the polymorphisms was concluded to be
associated with the increase in antioxidant capacity of seminal plasma in infertile
men (Josarayi et al., 2017). However, publications on the correlation of this
polymorphism with male infertility in several populations (Japanese, Iranian, and
Estonian) generated inconsistent results.
2.6. Vietnam research
Since the rate of male reproductive impairment has been increased
significantly in recent years, researches on the disease are received enormous
9


attention. These studies mainly focus on the clinical aspects, treatment methods,
and diagnostic techniques developments to detect male infertility (Cao Thị Tài
Nguyên et al., 2018; Lương Thị Lan Anh and Lan., 2018; Nguyễn Thị Trang et al.,
2018; Tai Nguyen et al., 2017). However, these diagnostic methods only
concentrate on the microdeletion and disorders related to the Y chromosome. For
instance, in 2018, two separated research groups from Hanoi Medical University
and Can Tho University had independently developed 2 techniques, Real-time PCR
and QF-PCR, to detect AZF microdeletions in men with reproductive issues.
However, studies on the impact of polymorphisms and mutations with reproductive
deterioration in men appear in a limited number. In 2018, Trang and colleagues had
performed a comprehensive study on the association of polymorphism in 2
xenobiotic metabolism enzymes N-acetyltransferase-2 (NAT2) and Glutathione Stransferases (GSTs) in correlation with male infertility in a cohort of 300 patients
and controls. The conclusion revealed the significant association between the 4
SNPs in these 2 genes with idiopathic male infertility as well as proposed that they
are novel genetic markers for the susceptibility of male infertility by unknown
causes (Thi Trang et al., 2018). The scarcity and inconsistence of researches on the
underlying genetic cause of male infertility, particularly in AhRR gene along with
the dramatic increase of infertile patients in Vietnam has prompted us to conduct a

case-control

association

study

of

polymorphism

AhRR

rs2292596

(NG_029834.2:g.123665C>G) in the Vietnamese population.

10


PART 3: MATERIALS AND METHODS
3.1. Study subjects
The study consisted of 422 subjects (218 male infertile patients and 204
controls) (Appendix 1). Patients were selected by the criteria of (1) experiencing
childless status after at least 12 months of regular unprotected sexual intercourse;
(2) being diagnosed with azoospermia or oligospermia (< 15 million sperms/ ml);
and (3) non-obstructive azoospermia (NOA); (4) normal karyotype, and no AZF
region disorders; (5) no medical history of diseases affecting fertility including
shrinkage of testicles caused by mumps, transmitted diseases, and drug addiction.
Controls were selected among men who had at least 1 child without seeking
assisted reproductive technology (ART). All subjects that fulfilled the essential

above requirements gave informed consent for the blood collection. The study was
approved by the Institutional Review Board of the Institute of Genome Research,
Vietnam Academy of Science and Technology.
3.2. Materials
Components for PCR reactions: Taq polymerase, nuclease-free water,
dNTPs, Dream Taq buffer (10X), primers AhRR_F and AhRR_R synthesized by
PHUSA Biochem company.
Table 3. 1. Primers information.

Name
AhRR _F

Sequence
5’CCAGGCAACTTAGACATCTTCTC3’

AhRR _R

5’TGTGTAAGGCAAAGCACACC3’

Kit: GeneJET Whole Blood Genomic DNA Purification (Thermo Fisher),
BigDye Terminator v3.1 Cycle Sequencing, GeneJET PCR Purification (Thermo
Fisher).
Other chemical components: ethanol, restriction enzyme BsuRI (HaeIII)
(Thermo Fisher), agarose, TAE, etc.
11


Equipments: pipetman, GenAmp PCR System 9700, PowerPac 300
Electrophoresis; GelDoc (Amersham); etc.
3.3. Methods

3.3.1. Extraction of total DNA from blood samples
Whole blood (2 mL/ sample) was collected and stored at -20oC. Total DNA
was extracted from the blood samples using GeneJET Whole Blood Genomic DNA
Purification Kit (Thermo Fisher). The procedure was conducted based on the
manufacturer guideline as described below:
In a 1.5 ml eppendorf tube containing 20 µL of proteinase K solution, a
volume of 200 µL of whole blood was added and mixed by vortexing. Then, a
volume of 400 µL of lysis solution was added to the mixture and mixed thoroughly
by vortexing to acquire a uniform suspension. Using a thermomixer to further
incubate the samples at 56oC for 10 minutes to lyse the cells completely. After
incubation, a volume of 200 µL of ethanol (96-100%) was added into the mixture
and mixed gently by pipetting. Then, the prepared mixture was transferred to the
spin column and centrifuged for 1 minute at 8,000 rpm. The flow-through after
each centrifugation was discarded. Next, the column was added with 500 µL of
wash buffer I containing ethanol and centrifuged for 1 minute at 10,000 rpm.
Afterward, the column was added with 500 µL of wash buffer II containing ethanol
and was centrifuged for 3 minutes at maximum speed (≥ 14,000 rpm), followed by
another centrifugation for 1 minute at maximum speed. After that, the collection
tube was discarded and the column was placed into a new 1.5 ml eppendorf tube.
Finally, a volume of 200 µL of elution buffer was added to the center of the column
membrane to elute genomic DNA. The column was incubated for 2 minutes at
room temperature and then centrifuged for 1 minute at 10,000 rpm. After collecting
the final solution, the column was discarded.

12


The DNA content was measured by a spectrophotometer (NanoDrop
One/Onec , Thermo Fisher). For quality control, 2 µL of the total DNA were run on
1% agarose gel. All the DNA samples were stored at -20oC.

3.3.2. Primer design
A pair of primers was designed to amplify the DNA region containing the
single nucleotide polymorphism AhRR rs2292596. Primer Blast (NCBI) was
utilized for designing the required specific pair of primers. Then, both reverse and
forward primers were checked for self-and hetero-dimer by using the
OligoAnalyzer tool ( to avoid dimerization.
3.3.3. Amplification of the DNA region containing AhRR rs2292596
PCR amplification was performed with specific primers designed previously
and working DNA samples. The total volume of PCR reaction was 10 µL
including: 6.95 µL of nuclease-free water (H2O); 1 µL of Dream Taq buffer (10X);
0.6 µL of dNTPs (2.5 mM); 0.05 µL Taq polymerase (5U/ µL); 0.2 µL primer F/R
(10 pmol); and 1 µL of DNA template (~2.5 ng/ µL). The PCR condition is
illustrated in the figure below (Figure 3.1). The quality of PCR product was
checked by running 2 µL on 1.2% agarose gel.

Figure 3. 1. Condition of PCR reaction.

3.3.4. PCR-RFLP
13


PCR products were digested with restriction enzyme (RE) BsuRI (HaeIII)
(Thermo Fisher) (Figure 3.2) according to the restriction fragment length
polymorphism (PCR-RFLP) technique.

Figure 3. 2. Recognition site of BsuRI (HaeIII).

BsuRI (HaeIII) is a blunt end RE and was predicted to recognize the region
surrounding the targeted SNP by SnapGene® software (from Insightful Science;
available at snapgene.com). If no mutation occurs, RE cut the PCR product into 3

fragments (45 bp, 229 bp, and 163 bp); and if the mutation occurs, RE cut the PCR
product into 4 fragments (45 bp, 229 bp, 33 bp, and 130 bp). The number and size
of three genotypes of AhRR rs2292596 theoretically observed in the agarose gel are
illustrated in the table below.
Table 3. 2. Number and size of DNA bands of 3 genotypes of AhRR rs2292596.

Genotype
CC
CG
GG

Number of DNA band
2
3
2

Size of DNA band (bp)
229; 163
229; 163; 130
229; 130

The total volume of digestion reaction was 5 µL based on the protocol
suggested by the manufacturer: 3µL of PCR products; 1.4 µL of nuclease-free
water (H2O); 0.3 µL buffer R (10X); and 0.3 µL of BsuRI (HaeIII) (10U/ µL). The
mixture was incubated at 37oC in a water bath for 4 – 6 hours. Digested products
were further verified for quality by electrophoresis in 2.5% agarose gel. Depending
on the DNA bands acquired from enzymatic digestion of PCR products, the
genotype of AhRR rs2292596 was determined.
3.3.5. PCR purification

14


To verify the digestion results of the PCR-RFLP method, 5% (20 samples)
out of 422 samples were randomly selected to be purified and subsequently
sequenced by the Sanger technique. PCR reaction was performed with a total
volume of 25 µL for purification including: 17.375 µL of nuclease-free water
(H2O); 2.5 µL of Dream Taq buffer (10X); 1.5 µL of dNTPs (2.5 mM); 0.125 µL
Taq polymerase (5U/ µL); 0.5 µL primer F/R (10 pmol); and 2.5 µL of DNA
template (~2.5 ng/ µL). The condition of the reaction was illustrated above (Figure
4). PCR products after being examined with electrophoresis in 1.2% agarose gel
were purified by GeneJET PCR Purification Kit (Thermo Fisher) to remove
excessive elements (primers, dNTPs, buffer). The procedure was conducted based
on the given instruction of the Kit manufacturer as described below:
A 1:1 volume of binding buffer was added to a 0.2 ml tube containing PCR
products and mixed thoroughly by pipetting. If the DNA fragment is ≤ 500 bp, a
1:2 volume, compared to the PCR mixture, of 100% isopropanol was also added to
the tube. The whole mixture was then mixed thoroughly again by pipetting. Next,
the whole solution was transferred to the GeneJET purification column and
centrifuged for 1 minute at 10,000 rpm. The flow-through after each centrifugation
was discarded. Afterward, the column was added with 700 µL of wash buffer (with
ethanol) and centrifuged for 2 minutes at 10,000 rpm, followed by another
centrifugation for1 minute at 12,000 rpm to completely remove the residual buffer
and placed into a fresh 1.5 ml eppendorf tube. The column was then left to dry for
at least 15 minutes at room temperature. Finally, 15 µL of elution buffer was added
to the center of the GeneJET column membrane and the column was incubated for
at least 5 minutes at room temperature. To collect the PCR purification products,
the column was centrifuged for 1 minute at 10,000 rpm. A volume of 2 µL of the
purified product was run on 1.2% agarose gel. Qualified products were then used
for Sanger sequencing.

3.3.6. Sanger sequencing
15


In the current study, the Sanger method was applied to sequence the PCR
products. Desired DNA sequences were identified by automated sequencer ABI
PRISM 3500 Genetic Analyzer (Applied Bio-systems, Carlsbad, CA, USA), using
BigDye Terminator v3.1 Cycle Sequencing Kit. The amplifying reaction was
performed with a total volume of 15 µL including primer rs2292596_F (10 pmol);
DNA template and buffer. Condition of PCR reaction in GenAmp® PCR System
9700 was implemented as follow: 96oC/ 1 minute; 25 cycles of 96oC/ 10 seconds;
50oC/ 5 seconds; 60oC/ 4 minutes. Then, products were kept in 4oC. After that, PCR
products were purified using EtOH/EDTA: A volume of 5 µL EDTA 125 mM was
added to 60 µL 100% to PCR mixture and mixed thoroughly. The mixture was then
left at room temperature for 15 minutes. The solution was further centrifuged for 15
minutes at 12.000 rpm to precipitate the DNA. Next, the EtOH was removed and
the precipitation was washed with 60 µL EtOH 70%. The mixture was further
centrifuged for 10 minutes at 10.000 rpm. After the precipitation was dried, 10 µL
of Hi-DITM Formamide was added to denature at 95oC for 5 minutes.
All components were then transferred to wells of capillary electrophoresis
systems 80 cm x 50 àL with polymer POP4 (ABI) in ABI PRISMđ 3500-Avant
Genetic Analyzer system. The obtained sequence results were then compared with
the reference sequence (NG_029834.2) of AhRR by SnapGene® software (from
Insightful Science; available at snapgene.com).
3.3.7. Statistical analysis
Data obtained from PCR-RFLP method were analyzed by SPSS software
version 26 (IBM, New York, NY, USA) and Microsoft Excel (Microsoft Corp.,
Washington, DC, USA). Chi-square test (χ2) was carried out to examine the HardyWeinberg equilibrium (HWE) of the population and to assess the correlation
between genotype and allele type of polymorphism with male infertility
probability. The correlation was investigated in 3 test models: additive, dominants,

and recessive and was estimated by OR (odds ratio) index with a confidence
16