Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx

BioMed Central
Page 1 of 12
(page number not for citation purposes)
Virology Journal
Open Access
Methodology
Development of a real-time QPCR assay for the detection of RV2
lineage-specific rhadinoviruses in macaques and baboons
A Gregory Bruce, Angela M Bakke, Margaret E Thouless and Timothy M Rose*
Address: Department of Pathobiology, School of Public Health and Community Medicine, University of Washington, Seattle, WA 98195 USA
Email: A Gregory Bruce - ; Angela M Bakke - ;
Margaret E Thouless - ; Timothy M Rose* -
* Corresponding author
Abstract
Background: Two distinct lineages of rhadinoviruses related to Kaposi's sarcoma-associated
herpesvirus (KSHV/HHV8) have been identified in macaques and other Old World non-human
primates. We have developed a real-time quantitative PCR (QPCR) assay using a TaqMan probe to
differentially detect and quantitate members of the rhadinovirus-2 (RV2) lineage. PCR primers
were derived from sequences within ORF 60 and the adjacent ORF 59/60 intergenic region which
were highly conserved between the macaque RV2 rhadinoviruses, rhesus rhadinovirus (RRV) and
Macaca nemestrina rhadinovirus-2 (MneRV2). These primers showed little similarity to the
corresponding sequences of the macaque RV1 rhadinoviruses, retroperitoneal fibromatosis
herpesvirus Macaca nemestrina (RFHVMn) and Macaca mulatta (RFHVMm). To determine viral
loads per cell, an additional TaqMan QPCR assay was developed to detect the single copy cellular
oncostatin M gene.
Results: We show that the RV2 QPCR assay is linear from less than 2 to more than 300,000 copies
using MneRV2 DNA, and is non-reactive with RFHVMn DNA up to 1 billion DNA templates per
reaction. RV2 loads ranging from 6 to 2,300 viral genome equivalent copies per 10
6
cells were
detected in PBMC from randomly sampled macaques from the Washington National Primate

Research Center. Screening tissue from other primate species, including another macaque, Macaca
fascicularis, and a baboon, Papio cynocephalus, revealed the presence of novel rhadinoviruses,
MfaRV2 and PcyRV2, respectively. Sequence comparison and phylogenetic analysis confirmed their
inclusion within the RV2 lineage of KSHV-like rhadinoviruses.
Conclusions: We describe a QPCR assay which provides a quick and sensitive method for
quantitating rhadinoviruses belonging to the RV2 lineage of KSHV-like rhadinoviruses found in a
variety of macaque species commonly used for biomedical research. While this assay broadly
detects different RV2 rhadinovirus species, it is unreactive with RV1 rhadinovirus species which
commonly co-infect the same primate hosts. We also show that this QPCR assay can be used to
identify novel RV2 rhadinoviruses in different primate species.
Published: 05 January 2005
Virology Journal 2005, 2:2 doi:10.1186/1743-422X-2-2
Received: 16 November 2004
Accepted: 05 January 2005
This article is available from: />© 2005 Bruce et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License ( />),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Virology Journal 2005, 2:2 />Page 2 of 12
(page number not for citation purposes)
Background
Members of the Rhadinovirus genus of the gammaherpes-
viruses are lymphotrophic and are associated with a vari-
ety of lymphoproliferative diseases. Herpesvirus saimiri
(HVS), the prototype rhadinovirus isolated from the
South American squirrel monkey, causes fulminant T-cell
lymphomas in closely related host species [1]. Kaposi's
sarcoma-associated herpesvirus (KSHV)/human herpesvi-
rus 8, the only known human rhadinovirus, is associated
with classical and AIDS-related Kaposi's sarcoma, primary
effusion lymphoma and multicentric Castleman's disease

[2]. Other rhadinoviruses have been isolated from rumi-
nants, including wildebeest, sheep and cows, that are
associated with malignant catarrhal fever, a lymphoprolif-
erative syndrome [3,4].
We and others have demonstrated the existence of two
distinct lineages of KSHV-like rhadinoviruses in Old
World non-human primates [5,6]. The rhadinovirus-1
(RV1) lineage includes KSHV and closely related
homologs infecting different Old World non-human pri-
mate species. In macaques, the RV1 lineage is represented
by retroperitoneal fibromatosis herpesvirus (RFHV) that
was identified in retroperitoneal fibromatosis (RF) tumor
lesions of two macaque species at the Washington
National Primate Research Center (WaNPRC) [7,8]. The
RV2 lineage in macaques includes rhesus rhadinovirus
(RRV) which was first identified in co-cultures of periph-
eral blood mononuclear cells (PBMC) of rhesus macaques
(M. mulatta) in the New England National Primate
Research Center (NENPRC) [9] and pig-tailed macaque
rhadinovirus/M. nemestrina RV2 (MneRV2) [5,10,11].
While sequence analysis of the RRV genome demon-
strated a close similarity to KSHV [12,13], phylogenetic
analysis of multiple gene sequences has grouped RRV and
the closely related MneRV2 within the RV2 lineage dis-
tinct from RFHV and KSHV [5]. Although RV2 rhadinovi-
ruses have been identified in all Old World non-human
primates tested, including gorillas and chimpanzees, no
evidence of a human homolog has so far been found
[6,14-17].
While complete genomic sequences have been obtained

for two closely related strains of the RV2 lineage rhadino-
virus of rhesus macaques, RRV strain H26-95 from the
NENPRC [13] and RRV strain 17577 from the Oregon
National Primate Research Center (ONPRC) [12], little
information is known regarding the sequences of RV2
rhadinoviruses from other macaque species, and assays to
detect these rhadinoviruses have not been developed.
Quantitative real-time PCR assays (QPCR) have been
developed to specifically detect RRV in rhesus macaque
samples [18,19], but these assays have not be shown to
cross to other RV2 rhadinovirus species. Since the WaN-
PRC and other primate research centers in the US and
abroad utilize macaque species other than rhesus for bio-
medical research, we decided to obtain sequence informa-
tion from the RV2 rhadinovirus of pig-tailed macaques,
MneRV2, in order to develop a general assay to detect RV2
rhadinoviruses from different macaque species. Our strat-
egy was to identify gene sequences that were highly con-
served between different RV2 species but not conserved
within macaque RV1 rhadinoviruses, such as RFHVMn or
RFHVMm, which are sometimes found in conjunction
with RV2 rhadinovirus infections. Previous nucleotide
sequence information for MneRV2 consisted only of a
region of the DNA polymerase which had significant
sequence similarity with the macaque RV1 rhadinovi-
ruses, and therefore was unsuitable for the desired assay
[5]. We analyzed several regions of the RV1 and RV2 rhad-
inovirus genomes as targets for a general RV2 specific
assay and identified the ORF 59/60 junctional region as a
suitable target. This region was highly conserved within

macaque RV2 rhadinovirus species but not within
macaque RV1 rhadinoviruses. In this paper, we report the
development of a sensitive and specific TaqMan QPCR
assay and its use in detecting and quantitating RV2 rhadi-
noviruses from different primate species.
Results
Identification of the ORF 59/60 junctional region from the
RV1 and RV2 rhadinovirus species from Macaca
nemestrina, RFHVMn and MneRV2
The ORF 59 and ORF 60 genes show high levels of homol-
ogy between the related rhadinoviruses, KSHV and RRV,
with 52% and 70% identity at the amino acid level,
respectively [13]. Using the CODEHOP approach [20,21],
we developed degenerate primers targeting conserved
amino acid motifs "RDEL" (ORF 60) and "PQFV" (ORF
59) that would enable the amplification and sequence
analysis of the ORF 59/60 junctional region of novel RV1
and RV2 rhadinovirus species as described in Materials
and Methods. The CODEHOP primers were used in PCR
amplification of DNA obtained from spleen tissue from
442N, a M. nemestrina, which has been previously shown
to contain a co-infection of both MneRV-2 and RFHVMn
rhadinoviruses [5]. PCR products from both MneRV2 and
RFHVMn were obtained as described in Materials and
Methods. Sequence analysis revealed a close similarity
between the 833 bp of the ORF59/60 junctional region
between the "RDEL" and "PQFV" motifs of MneRV2 and
the corresponding region of RRV, with an 87% nucleotide
identity. The 834 bp sequence of the RFHVMn junctional
region was 67% identical to the corresponding region of

KSHV and 60% identical to the RRV sequence. Phyloge-
netic analysis using DNA maximum-likelihood demon-
strated a close clustering of the MneRV2 and RRV
sequences, while the RFHVMn sequence clustered with
the KSHV ORF59/60 sequence, as expected for the
macaque homolog of KSHV (Figure 1).
Virology Journal 2005, 2:2 />Page 3 of 12
(page number not for citation purposes)
TaqMan quantitative PCR (QPCR) assay specific for RV2
rhadinoviruses
Multiple alignment of the RRV and MneRV2 nucleotide
sequences revealed large regions of identical sequences
within both the ORF 59 and ORF 60 coding regions and
the ORF 59/60 intergenic region. As shown in Figure 2, a
region of 71 identical nucleotides in the MneRV2 and RRV
sequences was identified at the 3' end of the ORF 60 gene
and the adjacent intergenic region. This region was only
43% conserved with the corresponding sequence of RFH-
VMn. Using Primer Express software (Applied Biosys-
tems), a set of PCR primers (RV2a and RV2b) and a probe
(RV2-FAM) were identified for a TaqMan QPCR assay (71
bp amplicon) which would specifically detect these
macaque RV2 rhadinoviruses and not cross to known RV1
rhadinoviruses (Fig. 2 and Table 1).
TaqMan QPCR assay for the cellular gene, oncostatin M,
to determine cell number
In order to determine viral copy number per cell, an addi-
tional TaqMan QPCR assay was developed to detect a sin-
gle copy cellular gene, oncostatin M (OSM) [22]. We had
previously determined the sequence of the OSM gene in

an African green monkey which was highly conserved
with the human gene (unpublished results). Using PCR
primers derived from consensus sequences of the human
and monkey gene, we determined the sequence of the
entire OSM coding sequence of the M. nemestrina OSM
gene (data not shown). Multiple alignment of the human,
monkey and macaque OSM sequences revealed a region
within exon 3 which was highly conserved. Using Primer
Express software, a set of primers (OSMa and OSMb; 76
bp amplicon) and a probe (OSM-FAM) were identified
(Fig. 3 and Table 1) which could be used to detect OSM
DNA from macaque, monkey and human sources allow-
ing quantitation of cell number in tissue samples.
QPCR Assay Development and Characterization
The RV2 and OSM QPCR assays were optimized using
DNA obtained from the spleen of a rhesus macaque,
MmuA01111, which we have previously determined to
contain RRV DNA in a background of macaque genomic
DNA [23]. Initially, a temperature gradient PCR was per-
formed to determine annealing temperatures that gave a
single PCR product. An annealing temperature of 62°C
was chosen because that temperature was optimal in both
the RV2 and OSM assays (data not shown). The magne-
sium chloride, nucleotide, primer and probe concentra-
tions were then varied to determine conditions which
gave optimal efficiency.
Standard curves were obtained from a dilution series
using the optimal conditions for the RV2 and OSM assays
as described in Material and Methods. For the RV2 assay,
purified MneRV2 DNA obtained from a lytic infection of

rhesus primary fetal fibroblasts (RPFF) was assayed in
duplicate using 4-fold dilutions. As seen in Figure 4A, the
assay was linear across a range of dilutions from less than
2 to more than 3.0 × 10
5
copies of MneRV2, with a slope
of -3.320 (100% efficiency) and r
2
= 0.997. For the OSM
assay, MmuA01111 genomic DNA was assayed in
duplicate using 4-fold dilutions, with the amount of DNA
tested ranging from 0.06 ng (corresponding to 20 diploid
OSM gene copies: equivalent to 10 cells) up to 1 µg (cor-
responding to 3.2 × 10
5
diploid OSM gene copies:
equivalent to 1.6 × 10
5
cells). The assay was linear across
this range with a slope of -3.322 (100% efficiency) and r
2
= 0.999 (Fig. 4B).
Phylogenetic analysis of the nucleotide sequences of the ORF59/60 junctional region from various rhadinovirusesFigure 1
Phylogenetic analysis of the nucleotide sequences of
the ORF59/60 junctional region from various rhadi-
noviruses. Sequences of the PCR products obtained using
CODEHOP PCR primers from the rhadinoviruses MneRV2
(M. nemestrina), MfaRV2 (M. fascicularis), PcyRV2 (Papio cyno-
cephalus) and RFHVMn (M. nemestrina) were aligned with the
corresponding published sequences for KSHV (homo sapiens;

U93872, bp 96678–97514), RRV (M. mulatta; AF083501, bp
92374–93205), and HVS (squirrel monkey, HSGEND, bp
81608–82613) using ClustalW. Phylogenetic analysis was per-
formed using the DNA maximum likelihood procedure from
Phylip. The division of New and Old World primate hosts is
indicated. The RV1 and RV2 lineages of the Old World pri-
mate rhadinoviruses are shown. Novel viruses identified with
the RV2 QPCR assay are underlined.
0.1
RV2
RRV
MfaRV2
MneRV2
PcyRV2
RFHVMn
KSH
V
RV1
HVS
Old World
Primates
New World
Primates
0.1
RV2
RRV
MfaRV2
MneRV2
PcyRV2
RFHVMn

KSH
V
RV1
HVS
Old World
Primates
New World
Primates
Virology Journal 2005, 2:2 />Page 4 of 12
(page number not for citation purposes)
Primer location and specificity of the RV2 QPCR assayFigure 2
Primer location and specificity of the RV2 QPCR assay. Corresponding sequences from the end of ORF 60 and the
adjacent intergenic region from different rhadinoviruses (see legend to Figure 1) were aligned. Rhadinovirus species and line-
ages are indicated. The primer set and probe were designed from the RRV and MneRV2 sequences. The RV2a primer and RV2-
FAM probe were derived from the sense strand, as shown, while the RV2b primer was derived from the antisense strand. The
alignment shows the mismatches between the primer and probe sequences and the MfaRV2 and PcyRV2 sequences identified
with the RV2 assay in this study. Dots represent residues identical to those in the RRV sequence, and highlight the similarity of
the primer sequences within the RV2 lineage of rhadinoviruses and the dissimilarity with members of the RV1 lineage of
rhadinoviruses.
Table 1: PCR primers
Primer
1
Gene Target Sequence
2
RV2 QPCR Assay (Figure 2)
RV2a RV2 ORF 60 5'-TCTGAATATGTCACATCCGTTCATA-3'
RV2b RV2 ORF 59/60 intergenic 5'-GGCCCGGAAAATGAGTAACA-3'
RV2-FAM
3
RV2 ORF 60 and 59/60 intergenic 5'-(6-FAM)-TGATCTGTAGTCCCCATGTGTCC-(BHQ-1)-3'

OSM QPCR Assay (Figure 3)
OSMa Exon 3 OSM 5'-CCTCGGGCTCAGGAACAAC-3'
OSMb Exon 3 OSM 5'-GGCCTTCGTGGGCTCAG-3'
OSM-FAM Exon 3 OSM 5'-(6-FAM)-TACTGCATGGCCCAGCTGCTGGACAA-(BHQ-1)-3'
ORF 59/60 CODEHOP Primers
RDELa
4
ORF 60 bias
5
KSHV 5'-CTTGCCAACGATTACATTTCCAGRGAYGARCT-3'
SRDEa
4
ORF 60 bias RRV 5' CTGGCTAACGACTACATCTCCAGRGAYGARCT-3'
NFFEa ORF 60 bias KSHV 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3'
PQFVb
6
ORF 59 bias KSHV 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3'
QFVRb
6
ORF 59 bias RRV 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3'
CFICb ORF 59 bias RRV 5'-TACAAAATACAGCGAGTGATANATRAARCA-3'
Gene-Specific Primer
MPVDb ORF 59 (RFHV/KSHV)
7
5'-TGAAAATCCACAGGCATGAT-3'
1
The terminal "a" or "b" in the primer name indicates the plus or minus sense of the gene transcription, respectively.
2
IUB code for ambiguous nucleotides: R = A or G; Y = C or T; N = A, C, G, or T
3

FAM indicates a TaqMan dual-labeled probe with the fluorescent dye 6-FAM at the 5' end and the "black hole quencher" (BHQ) dye at the 3' end.
4
These CODEHOP primers target the same motif but are biased differently (see below).
5
"bias" indicates that the 5' consensus region of the CODEHOP primer was derived from a particular sequence" see [20].
6
These CODEHOP primers target the same motif but are biased differently.
7
This primer sequence is identical to the RFHVMn, RFHVMm and KSHV sequences
RRV TGATAAT TCTGAATATGTCACATCCGTTCATA A TGATCTGTAGTCCCCATGTGTCC CA TGTTACTCATTTTCCGGGCC AGAGGCTCTATT
MneRV2 C C .
MfaRV2 G . T
PcyRV2 G G . T A A GCT

RFHVMm C A T CACA T.G GAGA. . C T GA GG.GCCCAATT AC GT C.C.GCGG.G.TATTT .AG.CAGGCT
RFHVMn A T CACA G GAGA. . C T GACGGAT CCTGGT GCGCGTAA.C A CTGA TCC.CAATGC.A
KSHV A C T CAC G.GT GAC.G . C T GAAGGTT.ACCTGT. CG.A C C.ACCT CCTAAAAG.TC.

RV2a Primer
RV2b Primer
RV2-FAM Probe
RV1
RV2
Lineage
Species
ORF 60 ORF 60/ORF 59 Intergenic Region
Virology Journal 2005, 2:2 />Page 5 of 12
(page number not for citation purposes)
To determine the linearity of the RV2 assay with a biolog-
ically relevant sample, DNA from the spleen of

MmuA01111 which contains cells naturally infected with
RRV was subjected to 4-fold dilutions while keeping
genomic DNA levels constant at 1 µg per reaction by the
addition of DNA from an uninfected animal. The results
demonstrate that the assay was linear from less than 66
copies of RRV (256-fold dilution of MmuA01111 DNA in
uninfected macaque DNA) to more than 1.7 × 10
4
RRV
copies per µg genomic DNA (MmuA01111 DNA undi-
luted) with a slope of -3.318 (100% efficiency) and r
2
=
0.988 (Fig. 5). This shows that the viral load determina-
tion would be accurate down to 410 RRV genomes/10
6
cells which is 1 viral copy per 2400 cells. The upper limit
in this assay was determined to be greater than 110,000
viral genomes/10
6
cells which is the number of viral cop-
ies of RRV in 1 µg of DNA from the MmuA01111 spleen.
To ensure that the RV2 assay does not detect RV1 viruses,
the assay was performed using DNA from the human and
macaque RV1 rhadinoviruses. A DNA sample from the
KSHV infected BCBL-1 cell line [24] containing approxi-
mately 4 × 10
6
copies of the KSHV genome and a sample
containing 10

9
copies of a PCR product of the ORF59/60
junctional region from RFHVMn were used as templates
in the RV2 assay. The RV-2 QPCR assay was negative for
these templates under the standard reaction conditions.
Identification of a novel RV2 rhadinovirus in Macaca
fascicularis using the RV2 QPCR assay
Since the RV2 QPCR assay was based on consensus
sequences shared by two distinct members of the RV2 lin-
eage from M. mulatta and M. nemestrina, RRV and
MneRV2, respectively, we tested to see if this assay could
be used to identify a novel RV2 rhadinovirus in M. fascic-
ularis. DNA was obtained from spleen tissue of Mfa95044,
an M. fascicularis from the Tissue Distribution Program at
the WaNPRC. Approximately 250 ng of spleen DNA pro-
duced a positive result in the RV2 QPCR assay with an
Primer location and specificity for the OSM QPCR assay to detect cell copy numberFigure 3
Primer location and specificity for the OSM QPCR assay to detect cell copy number. Corresponding sequences
from the third exon of the OSM gene from human, African green monkey (AGM) and pig-tailed macaque (Mn) are aligned with
the positions of the OSM primer set and probe indicated. The OSMa primer and OSM-FAM probe were derived from the
sense strand, as shown, while the OSMb primer was derived from the antisense strand.
OSM-Mn CCTCGGGCTCAGGAACAAC GTC TACTGCATGGCCCAGCTGCTGGACAA CTCAGACATGA CTGAGCCCACGAAGGCC
OSM-AGM A
OSM-Human A C.G T
OSMa Primer OSM-FAM Probe OSMb Primer
Standard curves obtained from the RV2 rhadinovirus and OSM reference cellular gene assaysFigure 4
Standard curves obtained from the RV2 rhadinovirus
and OSM reference cellular gene assays. A) The stand-
ard RV2 assay was performed on purified MneRV2 DNA in a
series of four-fold dilutions over the range of 2 copies to 3.0

× 10
5
copies of MneRV2. (slope = -3.320, 100% efficiency; r
2
= 0.997). B) The standard OSM assay was performed on
MmuA01111 spleen DNA in a series of four-fold dilutions
over the range of 0.06 ng (20 diploid OSM gene copies) to 1
µg (3.2 × 10
5
diploid OSM gene copies). (slope = -3.322,
100% efficiency; r
2
= 0.999)
A.
B.
MneRV2 Standard Curve
25
30
35
40
45
1 10 100 1000 10000 100000 1000000
Starting Copy Number
Threshold Cycle (C
T
)
25
30
35
40

45
1 10 100 1000 10000 100000 1000000
Starting Copy Number
Threshold Cycle (C
T
)
Oncostatin M Standard Curve
25
30
35
40
45
1 10 100 1000 10000 100000 1000000
Starting Copy Number
Threshold Cycle (C
T
)
Oncostatin M Standard Curve
25
30
35
40
45
1 10 100 1000 10000 100000 1000000
Starting Copy Number
Threshold Cycle (C
T
)
Virology Journal 2005, 2:2 />Page 6 of 12
(page number not for citation purposes)

average cycle threshold (C
T
) of 31.9 cycles. In order to
prove that the assay detected a novel rhadinovirus, CODE-
HOP primers were used in a PCR amplification reaction
with the Mfa95044 spleen DNA to obtain the ORF59/60
intergenic region of this rhadinovirus as described in the
Materials and Methods. An 832 bp PCR product was
obtained and sequenced. A comparison of this sequence
with the corresponding region from RRV and MneRV2
showed 94% and 86% nucleotide identity, respectively.
The nucleotide identity with the corresponding region in
RFHV and KSHV was only 59% and 60%, respectively.
Phylogenetic analysis showed a close clustering of the M.
fascicularis sequence with the RRV sequence and a more
distant relationship with the MneRV2 sequence,
confirming its origin from an RV2 rhadinovirus of M. fas-
cicularis, herein termed MfaRV2 (Figure 1). The evolution-
ary relationship of these rhadinovirus species mirrors that
determined for the host macaque species themselves,
where the M. mulatta and M. fascicularis have been shown
to be more closely related to each other than to M. nemes-
trina [25]. Our data supports the hypothesis of a co-speci-
ative divergence of the Old World primate rhadinoviruses
and their hosts [26]
Identification of a novel RV2 rhadinovirus in the baboon,
Papio cynocephalus, using the RV2 QPCR assay
To further determine the specificity of the RV2 QPCR
assay, DNA obtained from lymphocytes of baboon
Pcy78404 was tested for the presence of a related RV2

rhadinovirus species under the standard assay conditions.
Approximately 250 ng of lymphocyte DNA produced a
positive result with an average C
T
of 33.8 cycles. In order
to determine the identity of the reactive DNA species,
CODEHOP primers were used in a PCR reaction with the
baboon DNA as template as described in Materials and
Methods. A product was obtained that yielded an 834 bp
sequence which was 83% identical to the ORF59/60 inter-
genic region of each of the macaque RV2 rhadinoviruses,
RRV, MneRV2 and MfaRV2, and 58% identical to the cor-
responding region in both KSHV and RFHVMn. The
baboon sequence clustered with the macaque RV2 rhadi-
novirus sequences confirming its origin from an RV2
rhadinovirus of the baboon (Papio cynocephalus), herein
termed PcyRV2. Phylogenetic analysis demonstrated that
while PcyRV2 clustered within the RV2 rhadinovirus line-
age, it branched off separately from the macaque RV2
rhadinoviruses as expected for a baboon rhadinovirus
(Fig. 1).
Biologically relevant standard curve obtained with the RV2 rhadinovirus assay using RV2 DNA in a constant amount (1 µg) of genomic DNAFigure 5
Biologically relevant standard curve obtained with the RV2 rhadinovirus assay using RV2 DNA in a constant
amount (1 µg) of genomic DNA. DNA from MmuA01111 which was naturally infected with RRV was assayed in duplicate
in four-fold dilutions made with uninfected macaque DNA. (slope = -3.318, 100% efficiency; r
2
= 0.988].
RV2 Standard Curve in 1ug Genomic DNA
25
30

35
40
45
1 10 100 1000 10000 100000
Starting Quantity (copies)
Threshold Cycle (C
T
)
RV2 Standard Curve in 1ug Genomic DNA
25
30
35
40
45
1 10 100 1000 10000 100000
Starting Quantity (copies)
Threshold Cycle (C
T
)
Virology Journal 2005, 2:2 />Page 7 of 12
(page number not for citation purposes)
Previously, an RV2 rhadinovirus, PapRV2, was detected in
a baboon (Papio anubis) [27], and a partial sequence of the
DNA polymerase was obtained. In order to compare
PcyRV2 with PapRV2, we utilized CODEHOP PCR prim-
ers [7] to amplify a region of the polymerase gene of
PcyRV2 that could be compared to the sequence available
for PapRV2. DNA sequence for 352 bp of the DNA
polymerase gene was obtained. An alignment of this
sequence with the corresponding sequence of the PapRV2

rhadinovirus revealed a 97% sequence identity with 11
nucleotide differences which altered one amino acid.
Specificity of the RV2 QPCR assay
In order to compare the ability of the RV2 QPCR assay to
detect different rhadinovirus templates, test samples con-
taining roughly equivalent viral copy numbers in a back-
ground of genomic DNA were prepared. DNA from
purified MneRV2, DNA from MmuA01111 spleen which
contains RRV, and DNA from Mfa95044 spleen which
contains MfaRV2 were diluted in DNA from a virus nega-
tive macaque to have approximately the same virus load
as that found in the baboon lymphocyte DNA containing
PcyRV2. As shown in Figure 6, all four samples have rela-
tively similar levels of the different viruses, as indicated by
the similar C
T
values (30.3, MneRV2; 30.8, RRV; 31.6,
MfaRV2; and 33.2, PcyRV2). The cumulative fluorescence
curve for the MneRV2 and RRV samples were superimpos-
able with slopes typical of those seen in the assays per-
formed in Figures 4 and 5 which showed amplification
efficiencies of 100%. In contrast, both the M. fascicularis
and baboon templates produced fluorescence curves with
significantly decreased slopes, indicating lower amplifica-
tion efficiencies. The efficiencies of these PCR reactions
were calculated to be approximately 81% (r
2
= 0.900) for
Comparison of the RV2 QPCR assay using different rhadinovirus templates diluted in genomic DNAFigure 6
Comparison of the RV2 QPCR assay using different rhadinovirus templates diluted in genomic DNA. The

PcyRV2 results were obtained using 1 µg of spleen DNA from baboon, Pcy78404, naturally infected with PcyRV2. The other
rhadinovirus DNA templates were diluted in uninfected macaque genomic DNA to yield approximately equivalent C
T
values.
The MneRV2 results were obtained using DNA from purified MneRV2 in macaque genomic DNA. The RRV results were
obtained using DNA from spleen of MmuA01111, naturally infected with RRV. The MfaRV2 results were obtained using DNA
from spleen of Mfa95044, naturally infected with MfaRV2. The released reporter fluorophore is plotted as a function of the
amplification cycle number.
20000
15000
10000
5000
0
-5000
20 22 24 26 28 30 32 34 36 38 40 42 44
Cycles
20000
15000
10000
5000
0
-5000
PCR Base Line Subtracted CF RFU
MneRV2
RRV
MfaRV2
PcyRV2
20000
15000
10000

5000
0
-5000
20 22 24 26 28 30 32 34 36 38 40 42 44
Cycles
20000
15000
10000
5000
0
-5000
PCR Base Line Subtracted CF RFU
20000
15000
10000
5000
0
-5000
20 22 24 26 28 30 32 34 36 38 40 42 44
Cycles
20000
15000
10000
5000
0
-5000
PCR Base Line Subtracted CF RFU
MneRV2
RRV
MfaRV2

PcyRV2
Virology Journal 2005, 2:2 />Page 8 of 12
(page number not for citation purposes)
the MfaRV2 and 72% (r
2
= 0.929) for the PcyRV2, how-
ever, the low levels of virus in these samples made it diffi-
cult to accurately determine the efficiencies, as indicated
by the correlation coefficients.
The novel ORF 59/60 intergenic regions of MfaRV2 and
PcyRV2 were aligned with the corresponding sequences of
RRV, MneRV2, RFHVMn, and KSHV. Also aligned was a
partial sequence of the ORF 59/60 region obtained from
RFHVMm (see Materials and Methods). As shown in Fig-
ure 2, the MfaRV2 sequence contained single nucleotide
mismatches with the RV2a primer and RV2-FAM probe;
an exact match was seen with the RV2b primer. The
PcyRV2 sequence contained the same nucleotide mis-
matches seen in MfaRV2 and additionally had a second
nucleotide mismatch within both the RV2a primer and
the RV2-FAM probe. An additional mismatch was found
between the PcyRV2 sequence and the RV2b primer. These
nucleotide mismatches correlated with the decreased
amplification efficiency of the assay with this template, as
shown in Figure 6.
RV2 QPCR screen of the prevalence of RV2 rhadinoviruses
in macaques housed at the WaNPRC
DNA samples were obtained from PBMC of a random
assortment of thirty macaques housed at the WaNPRC
and analyzed using the standard RV2 and OSM QPCR

assays. While all of the samples were positive for the single
copy OSM gene, only six of the thirty macaques were
positive for the presence of an RV2 rhadinovirus. In all of
these six cases, both duplicate reactions in the assay were
positive yielding average viral loads of 6–2300 per 10
6
cells (Table 2). However, in four of the six positive
macaques, the RV-2 assay result was low and outside the
linear range of the assay.
Discussion
We have developed a TaqMan probe-based QPCR assay to
quantitate the viral load of macaque rhadinoviruses
belonging to the RV2 lineage of KSHV-like
rhadinoviruses. The primers and probe for this assay were
based on sequences within the 3' end of the ORF 60 cod-
ing sequence and the ORF 59/60 intergenic region which
were identical between the pig-tailed and rhesus macaque
rhadinoviruses, MneRV2 and RRV, respectively, but were
not conserved with the corresponding macaque viruses
from the RV1 lineage of KSHV-like rhadinoviruses RFH-
VMn and RFHVMm. We have also developed a TaqMan
probe-based QPCR assay targeting the single copy cellular
gene, OSM, to serve as an internal control for quantitating
cell copy number. Both assays were designed to give 100%
PCR efficiency at the same annealing temperature, are lin-
ear over more than 4 orders of magnitude and are sensi-
tive enough to detect less than 20 copies of the DNA
target. The RV2 assay is able to accurately detect less than
66 copies of viral DNA in a genomic DNA background,
even when the viral load is as low as 1 copy per 2400 cells.

Quantitation of the cellular DNA and viral DNA copy
numbers in a tissue sample provides a suitable method for
comparing viral loads, even between samples of unknown
purity or degradation status. Because of the small size of
the amplicons for both assays, OSM (76 bp) and RV2 (71
bp), viral loads can even be determined in formalin-fixed
Table 2: RV2 rhadinovirus load in PBMC of 30 healthy macaques in the WaNPRC colony
Animal RV2 DNA load in PBMC (Viral copies per 10
6
cells; mean ± SD
1
)
M. nemestrina (pig-tail)
A98078 2300 ± 1200
F94132 650 ± 460
A98079 340 ± 49*
90152 5.8 ± 4.2*
16 other M. nemestrina Below the limit of detection
M. fascicularis (crab-eating)
98023 250 ± 96*
7 other M. fascicularis Below the limit of detection
Unknown macaque species
98062 57 ± 52*
1 other unknown species Below the limit of detection
% of all macaques testing positive 6/30 = 20%
1
Samples (1 µg) were assayed in duplicate and the means were determined. Standard deviations were calculated using the sum of the errors of the
viral and OSM copy number determinations, as described in Materials and Methods.
* These results, while positive for both duplicates, were outside of the linear range of the assay.
Virology Journal 2005, 2:2 />Page 9 of 12

(page number not for citation purposes)
paraffin embedded tissue in which significant degrada-
tion of the DNA has occurred. Due to the similarities in
sequence of the human, macaque and African green mon-
key OSM genes, the OSM QPCR assay may be suitable for
quantitation of DNA in tissue from a number of other Old
World primate species.
We have screened DNA from a number of random PBMC
samples from macaques at the WaNPRC for the presence
of an RV2 rhadinovirus. We detected RV2 rhadinovirus
DNA in 6 of 30 macaques; 4 of 20 M. nemestrina, 1 of 7 M.
fascicularis and 1 of 2 macaques whose species is not
known. In these macaques, the viral copy number was
determined to range from 6–2300 per 10
6
cells. Although
the copy number in the single positive M. fascicularis was
calculated to be 250 viruses per 10
6
cells, this would be a
low estimate due to the 81% efficiency of the amplifica-
tion of that template, as discussed above. Our results for
RV2 rhadinoviruses in the macaque species tested at the
WaNPRC were similar to those determined for RRV in
rhesus macaques at the Tulane National Primate Research
Center [18]. In the Tulane study, a QPCR assay developed
against the interleukin-6 homolog of RRV found infre-
quent and low levels of RRV in PBMC of healthy and SIV-
infected rhesus macaques. Only two healthy macaques
had detectable RRV DNA with levels of 320 and 880

genomes per 10
6
cells. In the other 28 animals, the RRV
load was below the level of detection. While RRV was
detected more frequently in SIV-infected macaques in this
study, the virus load was similar to that seen in healthy
macaques.
The Tulane RRV assay had a similar sensitivity to our RV2
assay, with a lower limit of one RRV genome per 10,000
cell equivalents however, it was designed to specifically
target only RRV while our RV2 assay is capable of detect-
ing RRV, MneRV2 and other macaque and baboon
rhadinoviruses. In this report, we have used the RV2 assay
to detect novel RV2 rhadinovirus homologs in both the
spleen of a crab-eating macaque (Macaca fascicularis) and
the lymphocytes of a baboon (Papio cynocephalus). The
standard RV2 assay had an amplification efficiency less
than 100% with the M. fascicularis and P. cynocephalus
templates which cautions against its use for accurate
quantitation of the MfaRV2 and PcyRV2 rhadinoviruses.
The primer and probe binding regions of these two
rhadinoviruses showed nucleotide mismatches which cor-
relate with the decrease amplification efficiency of the
assay.
We have shown that the RV2 QPCR assay is capable of
detecting a novel RV2 rhadinovirus, PcyRV2, in a baboon.
Previously, an RV2 rhadinovirus, PapRV2, was also
detected in baboons by others [27] using the degenerate
PCR primer approach targeting the DNA polymerase gene
that we had originally developed to detect novel herpesvi-

ruses [7]. In order to compare the two baboon viruses, we
have sequenced a region of the DNA polymerase gene of
PcyRV2. An alignment of this sequence with the
corresponding sequence of the PapRV2 rhadinovirus
revealed a 97% sequence identity with 11 nucleotide dif-
ferences. This nucleotide similarity is consistent with the
origin of these two viruses from two related species of
baboons; the PcyRV2 rhadinovirus was isolated from the
baboon species Papio cynocephalus, while the PapRV2
rhadinovirus was isolated from the baboon species Papio
anubis.
Conclusions
In this report, we describe a QPCR assay which provides a
quick and sensitive method for screening RV2 rhadinovi-
ruses found in the variety of non-human primate species
commonly found in the National primate centers. While
this assay broadly detects different RV2 rhadinoviruses
species, it is unreactive with several RV1 rhadinovirus
species. We also show that this QPCR assay can be used to
identify novel RV-2 rhadinoviruses in primates.
Methods and Materials
Animals
Fresh frozen spleen tissue samples from Macaca nemest-
rina (Mne) 442N were provided by R. Shibata while at the
National Institutes of Health, Bethesda, MD. This pig-
tailed macaque had been experimentally infected with a
pathogenic SHIV strain [28]. We have previously obtained
PCR evidence for the presence of both RV1 and RV2
macaque rhadinoviruses, RFHVMn and MneRV2,
respectively, in RF tumor and spleen tissue of this animal

[5]. Fresh frozen RF tumor tissue from Macaca mulatta
(Mmu) YN91-224, an SIV-infected rhesus macaque diag-
nosed with RF, was kindly provided by H. McClure, Yerkes
National Primate Research Center. Fresh frozen spleen tis-
sue samples were also obtained from Macaca mulatta
(Mmu) A01111 at the WaNPRC, a rhesus macaque that
had been experimentally infected with SIV which we have
shown to be co-infected with the RV1 and RV2 macaque
rhadinoviruses, RFHVMm and RRV, respectively
(unpublished observations). Fresh frozen spleen tissue
from a Macaca fascicularis (Mfa) 95044 and lymphocytes
from a baboon (Papio cynocephalus) (Pcy78404) were
kindly provided by H. Bielefeldt-Ohmann and C C. Tsai,
respectively, from the WaNPRC. DNA from the PBMC of
thirty random healthy colony macaques was also
obtained from the virus screening program at the
WaNPRC.
Cells
The KSHV-infected pleural effusion lymphoma cell line,
BCBL-1, was obtained from D. Ganem (Howard Hughes
Institute – UCSF), and was carried in RPMI 1640 supple-
Virology Journal 2005, 2:2 />Page 10 of 12
(page number not for citation purposes)
mented with 10% fetal bovine serum, penicillin, strepto-
mycin, glutamine, and β-mercaptoethanol. Rhesus
primary fetal fibroblasts (RPFF) were kindly provided by
Dr. Michael Axthelm (ONPRC).
Rhadinovirus
An isolate of MneRV2, was obtained from an M. nemest-
rina, MneJ97167, at the WaNPRC. The MneRV2 was used

to infect cultures of RPFF and viral particles were har-
vested from culture supernatent by high speed centrifuga-
tion. Viral DNA used as positive controls in the PCR assays
was obtained by disruption of the viral particles using
phenol/chloroform and ethanol precipitation.
DNA samples
DNA was extracted from frozen tissues using standard
proteinase K-phenol/chloroform extractions and concen-
trated by ethanol precipitation.
PCR amplification primers
The protein sequences of the ORF 59 and ORF 60 genes
from KSHV and RRV were aligned using ClustalW. The
consensus-degenerate hybrid oligonucleotide primer
(CODEHOP) technique [20,21] was used to design two
sets of degenerate PCR primers within both ORF 59 and
ORF 60 that would enable the amplification and sequence
analysis of the ORF 59/60 junctional region of novel RV1
and RV2 rhadinovirus species. The ORF 59 and ORF 60
genes are arranged in the same transcriptional orientia-
tion in both RRV and KSHV. Two sense-strand CODEHOP
primers, RDELa and SRDEa contained nucleotides encod-
ing the highly conserved amino acid motif, Arg-Asp-Glu-
Leu (RDEL; 8 fold degenerate), in ORF 60. Primer RDELa
was biased toward the RV1 rhadinoviruses and contained
a 5' consensus region derived from the KSHV sequence
(Accession no. NC_003409). Primer SRDEa was biased
toward the RV2 rhadinoviruses and contained a 5' consen-
sus region derived from the RRV sequence (Accession no.
AF210726). Two antisense-strand CODEHOP primers,
PQFVb and QFVRb contained all coding possibilities for

the highly conserved motif, Pro-Gln-Phe-Val (PQFV) in
ORF 59 (16 fold degenerate), and were biased to the
KSHV and RRV sequences, respectively (see Table 1). An
additional anti-sense strand CODEHOP primer, CFICb
(16 fold degenerate), was designed from a Cys-Phe-Ile-
Cys (CFIC) motif in the ORF 59 gene, downstream of the
PQFV motif and contained all coding possibilities for the
CFIC motif and was biased to RRV.
Amplification of the ORF 59/60 junctional region of novel
rhadinoviruses
To obtain the ORF 59/60 junctional regions between the
RDEL motif of ORF 60 and the PQFV motif of ORF 59 of
MneRV2, PcyRV2, RFHVMn, and RFHVMm, DNA was
obtained from different sources and used in PCR amplifi-
cation with different CODEHOP PCR primers. Reactions
were performed in 1 µM forward and reverse primers, 200
µM each dNTP, 20 mM Tris-HCl (pH 8.4), 50 mM KCl,
and 2.5 units Platinum Taq polymerase (Invitrogen) using
a 55–70°C annealing temperature gradient (BioRad
Icycler). For MneRV2, PCR amplification was performed
on Mne442N spleen DNA using primers RDELa and
PQFVb. For PcyRV2, PCR amplification was performed on
lymphocyte DNA from baboon Pcy78404, using SRDEa
and QFVRb. In both cases an ~830 bp PCR fragment was
obtained and sequenced. To obtain the sequence of RFH-
VMn which had a low copy number, it was necessary to
amplify the RDEL-PQFV region in two fragments. A
CODEHOP primer NFFEa (See Table 1), downstream of
the RDEL motif was designed and used in conjunction
with PQFVb to amplify an ~600 bp product from the

Mne442N DNA. From the sequence of this product a spe-
cific primer, MPVDb, was derived and used in conjunc-
tion with RDELa to obtain an overlapping ~400 bp
product. A similar strategy was used with RF tumor DNA
obtained from MmuYN91-224 to obtain sequence from
the ORF 59/60 junctional region of RFHVMm, however,
only the sequence from NFFEA to PQFVB was obtained
for comparison purposes. The ORF 59/60 junctional
region of MfaRV2 was also obtained in two fragments. An
~400 bp PCR product was obtained after amplification of
spleen DNA from Mfa95044, using the RV2 QPCR assay
primer RV2b (see QPCR assay below and Table 1) and
CODEHOP primer RDELa. An overlapping ~1400 bp PCR
product was obtained using the RV2 QPCR assay primer,
RV2a, in conjunction with an additional CODEHOP
primer, CFICb.
Sequence alignment and phylogenetic analysis
Nucleotide sequences were aligned using ClustalW and
analyzed using the DNA maximum-likelihood program
from the Phylip package, version 3.62 (University of
Washington, Seattle). Phylogenetic tree output was pro-
duced using TreeView.
Real-time QPCR design
The RV2 assay was designed to amplify a 71-bp amplicon
from the ORF 59/60 junctional region of macaque viruses
belonging to the RV2 rhadinovirus lineage using consen-
sus primers "RV2a" (forward primer 5'-TCTGAATATGT-
CACATCCGTTCATA-3') and "RV2b" (reverse primer 5'-
GGCCCGGAAAATGAGTAACA-3') with a TaqMan probe
"RV2" 5'-(6-FAM)-TGATCTGTAGTCCCCATGTGTCC-

(BHQ-1)-3' (Table 1 and Figure 1). As an internal control
for cellular DNA which would allow the determination of
the viral copy number per cell, a QPCR assay was devel-
oped to detect exon 3 of oncostatin M (OSM), a single
copy cellular gene [Rose, 1993 #18]). The OSM assay
amplifies a 76-bp amplicon from the macaque OSM gene
using "OSMa" (forward primer 5'-CCTCGGGCTCAG-
Virology Journal 2005, 2:2 />Page 11 of 12
(page number not for citation purposes)
GAACAAC-3') and "OSMb" (reverse primer 5'-GGCCT-
TCGTGGGCTCAG-3') with a TaqMan probe "OSM" 5'-(6-
FAM)-TACTGCATGGCCCAGCTGCTGGACAA-(BHQ-1)-
3' (Table 1 and Figure 2)
Reactions (50 µl) contained approximately 250–1000 ng
of template DNA, 1 µM forward and reverse primers, 100
nM probe, 200 µM each dNTP, 20 mM Tris-HCl (pH 8.4),
50 mM KCl, and 2.5 units Platinum Taq polymerase (Inv-
itrogen). Magnesium chloride concentrations were 4.0
mM for the RV2 assay and 2.0 mM for the OSM assay.
After activation of the polymerase by incubation for 1
minute at 95°C, amplification was performed on a Bio-
Rad iCycler equipped with an optical module for 45 cycles
of 95°C for 30 s, 62°C for 30 s and 72°C for 30 s. The
copy number for each assay was calculated from the cycle
threshold (C
T
) determined using the Bio-Rad software.
The viral load was calculated as a cellular genome copy
equivalent by using the formula:
Viral load (genome equivalent copies) = Viral copy

number/diploid OSM copy number
Samples were assayed in duplicate and the means were
determined. Standard deviations were calculated using
the sum of the errors of the viral and OSM copy number
determinations.
List of Abbreviations
AGM, African green monkey; CODEHOP, consensus-
degenerate hybrid oligonucleotide primer; C
T
, cycle
threshold; KSHV/HHV8, Kaposi's sarcoma-associated her-
pesvirus/human herpesvirus 8; Mfa, Macaca fascicularis;
MfaRV2, Macaca fascicularis rhadinovirus-2; Mm/Mmu,
Macaca mulatta; Mn/Mne, Macaca nemestrina; MneRV2,
Macaca nemestrina rhadinovirus-2; ORF, open-reading
frame; OSM, oncostatin M; Pcy, Papio cynocephalus;
PcyRV2, Papio cynocephalus rhadinovirus-2; PCR, polymer-
ase chain reaction; QPCR, quantitative PCR; RFHV,
retroperitoneal fibromatosis herpesvirus; RRV, rhesus
rhadinovirus; RV1, rhadinovirus-1; RV2, rhadinovirus-2;
Competing Interests
The author(s) declare that they have no competing
interests.
Authors' Contribution
Design and conception of the study (AGB, TMR); develop-
ment of the methods for amplification of the ORF59/60
regions (AGB, TMR); Development of the QPCR assays
and quantitative analysis (AGB, AMB); Virus isolation and
preparation (MET); Sequence analysis, alignment and
phylogeny (AGB, AMB, TMR); Manuscript preparation

(AGB, AMB, MET, TMR). All authors read and approved
the final manuscript.
Acknowledgments
We would like to thank R. Shibata of the Laboratory of Molecular Microbi-
ology, National Institute of Allergy and Infectious Disease, NIH (currently
at Gilead Sciences), H. McClure at the YNPRC, and H. Bielefeldt-Ohmann
and C C. Tsai at the WaNPRC for their generous gifts of tissue, and W.
Morton, Director of the WaNPRC, for his continued interest and support.
We would also like to acknowledge the excellent technical support of C.
Saunders who performed the PBMC assays.
This work was partially supported by RR13154 and RR00166 from the
National Center for Research Resources. T. Rose is the recipient of a K02
award, AI49275, from the National Institute for Allergy and Infectious
Diseases.
References
1. Fickenscher H, Fleckenstein B: Herpesvirus saimiri. Philos Trans R
Soc Lond B Biol Sci 2001, 356(1408):545-567.
2. Viejo-Borbolla A, Schulz TF: Kaposi's sarcoma-associated her-
pesvirus (KSHV/HHV8): key aspects of epidemiology and
pathogenesis. AIDS Rev 2003, 5(4):222-229.
3. Coulter LJ, Reid HW: Isolation and expression of three open
reading frames from ovine herpesvirus-2. J Gen Virol 2002,
83(Pt 3):533-543.
4. Zimmermann W, Broll H, Ehlers B, Buhk HJ, Rosenthal A, Goltz M:
Genome sequence of bovine herpesvirus 4, a bovine Rhadi-
novirus, and identification of an origin of DNA replication. J
Virol 2001, 75(3):1186-1194.
5. Schultz ER, Rankin GWJ, Blanc MP, Raden BW, Tsai CC, Rose TM:
Characterization of two divergent lineages of macaque rhad-
inoviruses related to Kaposi's sarcoma-associated

herpesvirus. J Virol 2000, 74(10):4919-4928.
6. Greensill J, Sheldon JA, Renwick NM, Beer BE, Norley S, Goudsmit J,
Schulz TF: Two distinct gamma-2 herpesviruses in African
green monkeys: a second gamma-2 herpesvirus lineage
among old world primates? J Virol 2000, 74(3):1572-1577.
7. Rose TM, Strand KB, Schultz ER, Schaefer G, Rankin GWJ, Thouless
ME, Tsai CC, Bosch ML: Identification of two homologs of the
Kaposi's sarcoma-associated herpesvirus (human herpesvi-
rus 8) in retroperitoneal fibromatosis of different macaque
species. J Virol 1997, 71(5):4138-4144.
8. Rose TMRJTSERRBWTCC: Analysis of 4.3 Kb of the divergent
locus-B of macaque retroperitoneal fibromatosis-associated
herpesvirus (RFHV) reveals close similiarity to Kaposi's sar-
coma-associated herpesvirus (KSHV) in gene sequence and
genome organization. J Virol 2003, 77(9):5084-5097.
9. Desrosiers RC, Sasseville VG, Czajak SC, Zhang X, Mansfield KG,
Kaur A, Johnson RP, Lackner AA, Jung JU: A herpesvirus of rhesus
monkeys related to the human Kaposi's sarcoma-associated
herpesvirus. J Virol 1997, 71(12):9764-9769.
10. Mansfield KG, Westmoreland SV, DeBakker CD, Czajak S, Lackner
AA, Desrosiers RC: Experimental infection of rhesus and pig-
tailed macaques with macaque rhadinoviruses. J Virol 1999,
73(12):10320-10328.
11. Auerbach MR, Czajak SC, Johnson WE, Desrosiers RC, Alexander L:
Species specificity of macaque rhadinovirus glycoprotein B
sequences. J Virol 2000, 74(1):584-590.
12. Searles RP, Bergquam EP, Axthelm MK, Wong SW: Sequence and
genomic analysis of a Rhesus macaque rhadinovirus with
similarity to Kaposi's sarcoma-associated herpesvirus/
human herpesvirus 8. J Virol 1999, 73(4):3040-3053.

13. Alexander L, Denekamp L, Knapp A, Auerbach MR, Damania B,
Desrosiers RC: The primary sequence of rhesus monkey rhad-
inovirus isolate 26-95: sequence similarities to Kaposi's sar-
coma-associated herpesvirus and rhesus monkey
rhadinovirus isolate 17577. J Virol 2000, 74(7):3388-3398.
14. Lacoste V, Mauclere P, Dubreuil G, Lewis J, Georges-Courbot MC,
Gessain A: KSHV-like herpesviruses in chimps and gorillas.
Nature 2000, 407(6801):151-152.
15. Lacoste V, Mauclere P, Dubreuil G, Lewis J, Georges-Courbot MC,
Gessain A: A novel gamma 2-herpesvirus of the Rhadinovirus
2 lineage in chimpanzees. Genome Res 2001, 11(9):1511-1519.
16. Lacoste V, Mauclere P, Dubreuil G, Lewis J, Georges-Courbot MC,
Rigoulet J, Petit T, Gessain A: Simian Homologues of Human
Publish with Bio Med Central and every
scientist can read your work free of charge
"BioMed Central will be the most significant development for
disseminating the results of biomedical research in our lifetime."
Sir Paul Nurse, Cancer Research UK
Your research papers will be:
available free of charge to the entire biomedical community
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central
yours — you keep the copyright
Submit your manuscript here:
/>BioMedcentral
Virology Journal 2005, 2:2 />Page 12 of 12
(page number not for citation purposes)
Gamma-2 and Betaherpesviruses in Mandrill and Drill
Monkeys. J Virol 2000, 74(24):11993-11999.
17. Greensill J, Sheldon JA, Murthy KK, Bessonette JS, Beer BE, Schulz TF:

A chimpanzee rhadinovirus sequence related to Kaposi's
sarcoma-associated herpesvirus/human herpesvirus 8:
increased detection after HIV-1 infection in the absence of
disease. Aids 2000, 14(17):F129-35.
18. Ruff K, Baskin GB, Simpson L, Murphey-Corb M, Levy LS: Rhesus
rhadinovirus infection in healthy and SIV-infected macaques
at Tulane National Primate Research Center. J Med Primatol
2003, 32(1):1-6.
19. DeWire SM, Money ES, Krall SP, Damania B: Rhesus monkey rhad-
inovirus (RRV): construction of a RRV-GFP recombinant
virus and development of assays to assess viral replication.
Virology 2003, 312(1):122-134.
20. Rose TM, Schultz ER, Henikoff JG, Pietrokovski S, McCallum CM,
Henikoff S: Consensus-degenerate hybrid oligonucleotide
primers for amplification of distantly related sequences.
Nucleic Acids Res 1998, 26(7):1628-1635.
21. Rose TM: CODEHOPs: Consensus-Degenerate Hybrid Oligo-
nucleotide Primers. [ />].
22. Rose TM, Lagrou MJ, Fransson I, Werelius B, Delattre O, Thomas G,
de Jong PJ, Todaro GJ, Dumanski JP: The genes for oncostatin M
(OSM) and leukemia inhibitory factor (LIF) are tightly linked
on human chromosome 22. Genomics 1993, 17(1):136-140.
23. Bielefeldt-Ohmann HBDHBAMBAGDMGRLNLRJTSATMERTM:
Intestinal stromal tumors in a SIV-infected , SRV-2 negative
rhesus macaque (Macaca mulatta). Vet Pathol in press.
24. Renne R, Zhong W, Herndier B, McGrath M, Abbey N, Kedes D,
Ganem D: Lytic growth of Kaposi's sarcoma-associated her-
pesvirus (human herpesvirus 8) in culture. Nat Med 1996,
2(3):342-346.
25. Morales JC, Melnick DJ: Phylogenetic relationships of the

macaques (Cercopithecidae: Macaca), as revealed by high
resolution restriction site mapping of mitochondrial ribos-
omal genes. J Hum Evol 1998, 34(1):1-23.
26. McGeoch DJ: Molecular evolution of the gamma-Herpesviri-
nae. Philos Trans R Soc Lond B Biol Sci 2001, 356(1408):421-435.
27. Whitby D, Stossel A, Gamache C, Papin J, Bosch M, Smith A, Kedes
DH, White G, Kennedy R, Dittmer DP: Novel Kaposi's sarcoma-
associated herpesvirus homolog in baboons. J Virol 2003,
77(14):8159-8165.
28. Shibata R, Maldarelli F, Siemon C, Matano T, Parta M, Miller G, Fre-
drickson T, Martin MA: Infection and pathogenicity of chimeric
simian-human immunodeficiency viruses in macaques:
determinants of high virus loads and CD4 cell killing. J Infect
Dis 1997, 176(2):362-373.