báo cáo khoa học: "The grapevine guard cell-related VvMYB60 transcription factor is involved in the regulation of stomatal activity and is differentially expressed in response to ABA and osmotic stress" ppt

The grapevine guard cell-related VvMYB60
transcription factor is involved in the regulation of
stomatal activity and is differentially expressed in
response to ABA and osmotic stress
Galbiati et al.
Galbiati et al. BMC Plant Biology 2011, 11:142
(21 October 2011)
RESEARC H ARTIC L E Open Access
The grapevine guard cell-related VvMYB60
transcription factor is involved in the regulation
of stomatal activity and is differentially expressed
in response to ABA and osmotic stress
Massimo Galbiati
1,2†
, José Tomás Matus
3,4†
, Priscilla Francia
1
, Fabio Rusconi
2
, Paola Cañón
3
, Consuelo Medina
3
,
Lucio Conti
1,2
, Eleonora Cominelli
1,5
, Chiara Tonelli
1

and Patricio Arce-Johnson
3*
Abstract
Background: Under drought, plants accumulate the signaling hormone abscisic acid (ABA), which induces the
rapid closure of stomatal pores to prevent water loss. This event is trigged by a series of signals produced inside
guard cells which finally reduce their turgor. Many of these events are tightly regulated at the transcriptional level,
including the control exerted by MYB proteins. In a previous study, while identifying the grapevine R2R3 MYB
family, two closely related genes, VvMYB30 and VvMYB60 were found with high similarity to AtMYB60,an
Arabidopsis guard cell-related drought responsive gene.
Results: Promoter-GUS transcriptional fusion assays showed that expression of VvMYB60 was restricted to stomatal
guard cells and was attenuated in response to ABA. Unlike VvMYB30, VvMYB60 was able to complement the loss-of-
function atmyb60-1 mutant, indicating that VvMYB60 is the only true ortholog of AtMYB60 in the grape genome. In
addition, VvMYB60 was differentially regulated during development of grape organs and in response to ABA and
drought-related stress conditions.
Conclusions: These results show that VvMYB60 modulates physiological responses in guard cells, leading to the
possibility of eng ineering stomatal conductance in grapevine, reducing water loss and helping this species to
tolerate drought under extreme climatic conditions.
Background
Grapevine (Vitis vinifera L.)isafruitcroptraditionally
subjected to moderate or severe water stress, as this is an
efficient strategy to improve fruit and wine quality
(reviewed in [1,2]). Vitis species adapt well to drought con-
ditions due to good osmotic adjustment, large and deep
root systems, efficient control of stomatal aperture and
xylem embolism [3,4]. The strength and timing of these
responses varies between different cultivars and major dif-
ferences in water stress tolerance can be found when com-
pared to other species or hybrids from the Vitis genus [5].
Although these genotype-related variations involve
different aspects of the physiology o f the plant, they are

largely linked to differences in stomatal conductance (g
s
)
[6]. Stomata are microscopic pores distributed on the sur-
face of leaves and stems, surrounded by two highly specia-
lized guard cells. The opening and closure of the pore, in
response to internal signals and environmental cues,
allows the plant to co pe with the conflicting needs of
ensuring adequate uptake of CO
2
for photosynthesis and
preventing water loss by transpiration [7]. Under drought,
abscisic acid (ABA) is accumulated, inducing rapid stoma-
tal closure to limit water loss.
Increasing evidence indicates a role for transcription fac-
tors belonging to the R2R3 MYB subfamily as key modula-
tors of physio logical respons es in stomata [8,9]. In
particular, AtMYB60 has been shown to be differentially
expressed in guard cells in response to ABA, and the loss-
of function atmyb60-1 mutant displays constitutive
* Correspondence:
† Contributed equally
3
Pontificia Universidad Católica de Chile, Departamento de Genética
Molecular y Microbiología. Alameda 340. Santiago, Chile
Full list of author information is available at the end of the article
Galbiati et al. BMC Plant Biology 2011, 11:142
/>© 2011 Galbiati et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons
Attribution License ( which permits unrestricted use, distribution, and reprod uction in
any medium, provided the original work is properly cited.

reduction of light-induced stomatal opening and enhanced
tolerance to dehydration [10]. Guard cell-specific MYB
genes are thus focal points in understanding stomatal reg-
ulation in plants and represent molecular targets to modu-
late guard cell activity to improve crop survival and
productivity during drought.
The grapevine genom e has been estimated to contain a
total of 279 MYB genes [11], of which 108 belong to the
R2R3 subfamily [12]. A phylogenetic tree, constructed
with the complete grape, Arabidopsis and rice R2R3MYB
subfamilies, showed that many genes shar ing similar
functions were clustered in the same phylogenetic
groups. Some of these clades were conserved in gene
copy number (e.g. those related to trichome develop-
ment) while in those controlling flavonoid synthesis sev-
eral expansions events may have occurred [12].
In this work, we report the identification of two close
homologues of the guard cell-related AtMYB60 gene in
the grape genome, namely VvMYB60 and VvMYB30.
Analysis of gene expression in grape tissues revealed that
both VvMYB60 and VvMYB30 were expressed in green
tissues and developing seeds. As opposite t o VvMYB30,
VvMYB60 transcript abundan ce was greatly reduced by
ABA and osmotic stress. A GUS report er gene approach
in Arabidopsis showed that activity of the VvMYB60 pro-
moter was restricted to stomatal gua rd cells and was
down-regulated by ABA. Comparativ e analysis of regula-
tory regions revealed the presence of common guard
cell-specific motifs in the promoters of the grape and
Arabidopsis MYB60 genes. Finally, VvMYB60, unlike

VvMYB30, fully complemented the stomatal defects of
the atmyb60-1 mutant, thus indicating that VvMYB60 is
a functional ortholog of t he Arabidopsis AtMYB60 sto-
matal regulator.
Results
Phylogenetic relationships of MYB60 homologues
As a first approach to identify grape homologues of t he
AtMYB60 transcription factor, we searched the 108 R2R3
MYB proteins identified in the Vitis vinifera PN40024 gen-
ome[12],forthepresenceofadistinctiveC-terminal
motif (CtM2, YaSS
T
/
A
eNI
A
/
S
R
/
K
Ll), found in members of
Subgroup 1 of the Arabidopsis MYB family [13]. This sub-
group includes: AtMYB60, regulating light-induced stoma-
tal aperture [10,14]; AtMYB30, related to the regulation of
brassinosteroid-induced gene expression [15] and to the
biosynthesis of very-long-chain fatty acids involved in
hypersensitive cell death [16]; AtMYB96, an ABA/auxin
cross-talker, mediating AB A signaling during drought
stress and involved in promoting pathogen resistance

[17,18] and AtMYB94, whose function is still unknown.
Our search yielded two grape close homologues in the
grape genome version 12x: the annotated gene models
GSVIVT01008005001 (protein accession ABK59040) and
GSVIVT01029904001 (protein accession ACF21938).
A parsimony consensus tree was constructed to investi-
gate the phylogenetic relationships within these grape
proteins and members of Arabidopsis R2R3 MYB
Subgroup 1. Subgroup 2 was also included as some of its
members are involved in drought responses and ABA sig-
naling [19,20]. From this subg roup, a grape MYB14
homologue had also been previously isolated [12].
AtMYB61, regulating stomatal activity [21], but not
belonging to any of these subgroups, was included as an
out-group. As shown in Figure 1A, the two grape pr o-
teins ACF21938 a nd ABK59040 clustered wit h members
of the Arabidopsis Subgroup 1. Interestingly, AtMYB60,
the most distant member of Subg roup 1, was more
closely related to the grape protein accession ACF21938
than to the other members of the subgroup (AtMYB30,
31, 94 and 96). On the other hand, the grape accession
protein ABK59040 was closely related to AtMYB30 and
AtMYB31 and to a lesser extent to AtMYB94 and
AtMYB96 (Figure 1A). Hereafter, we will refer to
ACF21938 and A BK59040 as VvMYB60 and VvMYB30,
respectively. Based on these results, we further divided
Subgroup1 into Subgroup 1.1, (AtMYB30, AtMYB31,
AtMYB94 and AtMYB96) and Subgroup 1.2 (AtMYB60
andVvMYB60)(Figure1A).
As expected, all the proteins included in the tree dis-

closed a highly conserved R2R3 DNA binding domain
(Figure 1B). The identity between the R2R3 domain of
AtMYB60 and VvMYB60 and VvMYB30 was 99%, and
90%, respectively. In addition, AtMYB60 and VvMYB60
disclosed a distinctive PHEEG signature, encompassing
the two highly conserved glutamic acid residues, located
in the loop connecting the R2 and R3 repeats (Figure 1B).
The complete protein sequence of AtMYB60 showed 51%
amino acid identity to VvMYB60, and 48% identity to
VvMYB30. All of these protein s share two C-terminal
motifs ( CtM2 and CtM3) which are only found in sub-
group 1. I n addition, AtMYB30, 31, 96 and 94 possess a
third MYB domain (CtM1), which is absent in AtMYB60
and VvMYB60 (Figure 1B). The function of these C-term-
inal domains is still unknown although they might reflect
the functional differences between subgroups 1.1 and 1.2.
We determined the precise gene structure of both
VvMYB30 and VvMYB60, by comparing the complete
coding sequence with the full length cDNA sequence,
amplified from Pinot noir PN40024 genomic DNA and
leaf cDNA, respectively (Additional file 1). It was interest-
ing to note that in the 12x version of the grape genome,
GSVIVP01008005001, representing the VvMYB60 gene
model, was misannotated in terms of exon number.
Indeed, our results indicate the presence of three exons, as
opposed to the five exon s predicted by the gene model,
thus revealing a conserved exon/intron organization for
VvMYB30, VvMYB60 and AtMYB60 (Additional f ile 1).
Galbiati et al. BMC Plant Biology 2011, 11:142
/>Page 2 of 14

Figure 1 Analysis of grape and Arabidopsis MYB homologues within Subgroup 1.(A), Phylogenetic relationships between Arabidopsis and
grape subgroups 1 and 2 of R2R3 MYB factors, as described by Kranz et al., [13]. A consensus rooted tree was inferred using the Maximum
Parsimony method, constructed with MEGA4
®
software. (B) Alignment of deduced amino acid sequences of subgroup 1 and 2 R2R3 MYB
homologues from Arabidopsis and grape. The R2 and R3 repeats lie between the three alpha helices of each repeat. Boxes represent the C-
terminal motifs CtM1, CtM2 and CtM3 (red boxes) conserved in members of subgroup 1 and the PHEEG signature (blue box), distinctive of
AtMYB60 and VvMYB60 (subgroup 1.2). Amino acid residues are shaded in different colors, as indicated in the legend. Dots represent gaps
introduced to improve the alignment.
Galbiati et al. BMC Plant Biology 2011, 11:142
/>Page 3 of 14
Based on gene stru cture, MYB genes have been classified
in four different groups [ 12]. VvMYB30, VvMYB60 and
AtMYB60 all belong to Group I, which contains genes
with a characteristic R2 domain split between exons 1 and
2, and a R3 domain split between exons 2 and 3 (Addi-
tional file 1). The biggest differences in lengths were found
in the first intron and the third exon, which were longer in
the grape genes compared to AtMYB60.
Expression of VvMYB30 and VvMYB60 in grape tissues
and in response to hormonal and stress factors
qPCR analysis of gene expression in different grape
organs indicated that VvMYB30 and VvMYB60 tran-
scripts were most abundant in leaves, seeds and ripened
berry skins (Figure 2A). Interestin gly, VvMYB30 and
VvMYB60 revealed completely opposite expression pat-
terns during seed development; while VvMYB60 expres-
sion was gradually down-regulated towards the onset of
ripening (veraison), VvMYB30 expression was rapidly
activated (Figure 2B). During berry skin development,

VvMYB60 expression also showed a dramatic decrease to
full repression at veraison, followed by a slight increase
towards ripening (Figure 2C). In this tissue, VvMYB30
was mostly constantly expressed throughout the green
and ripening stages (Figure 2C).
In Arabidopsis, it has been shown that the expression
of the AtMYB60 gene is rapidly down-regulated following
treatment with ABA [10]. We thus analysed the expres-
sion of the grape genes in leaves treated with 50 or
100 μM ABA (Figure 2D and 2E). As reported in Figure
2D, VvMYB60 showed a significant decrease in expres-
sion levels in both 50 and 100 μM ABA treated samples,
when compared to the mock treated leaves. Conversely,
VvMYB30 did not show any change in expression after
exposure to the hormone under these conditions (Figure
2E). To further investigate the expression of VvMYB60
and VvMYB30 in respons e to osmotic stresses, we
designed an in vitro long-term salt stress experiment.
Nodal explants were placed vertically on sterile MS
media supplemented with 3 (standard), 100 or 200 mM
NaCl. Explants were maintained for a month in a growth
chamber until roots and/or leaves were visible and fully
expanded. At the end of the experiment, plantlets from
the 100 mM NaCl treatment had a small radicule and
high leaf anthocyanin accumulation, as a clear sign of
stress in the plant, while plants at 200 mM showed more
severe sympto ms, including systemic wilting and brown
pigmentation (Additional file 2). Under these conditions,
VvMYB60 and VvMY B30 showed opposite responses to
the increasing salt concentrations; while VvMYB60

expression was reduced five-fold at both concentrations
when compared to the control treatment, VvMYB30
expression increased three-fold on addition of 200 mM
NaCl (Figure 2F).
Activity of the VvMYB30 and VvMYB60 promoters in
Arabidopsis transgenic lines
We employed a reporter g ene approach in the heterolo-
gous model system Arabidopsis thaliana to investigate the
activity of both VvMYB30 and VvMYB60 pro moters. A
region of approximately 2 kb located upstream of the
ATG codon of VvMYB30 and VvMYB60 was fused to the
b-glucuronidase (GUS) reporter gene and the resulting
pVvMYB30:GUS and pVvMYB60:GUS constructs were
introduced in Arabidopsis by Agrobacterium-mediated
transformation [22].
We assessed the cell and tissue specificity of reporter
gene expression in ten independent T3 transgenic lines for
each promoter:GUS combination. Fifteen-day-old
pVvMYB30:GUS seedlings displayedexpressionofthe
reporter at the shoot apex, at the base of trichomes located
on leaf primordia, and in the emerging lateral roots
(Figure 3A, B and 3C) . At the same developmental stage,
pVvMYB60:GUS seedlings showed GUS expression exclu-
sively in guard cells distributed on cotyledons, hypocotyls
and developing leaves (Figure 3D and 3E). No expression
of the reporter gene was detected in rosette leaves from
mature pVvMYB30:GUS plants, even after prolonged incu-
bation of plant tissues in the GUS solution (data not
shown). On the other hand, we observed guard cell-speci-
fic signals in mature leaves of pVvMYB60:GUS plants,

consistent with the GUS profile observed in young seed-
lings (Figure 3F).
Next, we investigated expression of the reporter in
flowers and siliques from adult plants. Prior to pollina-
tion, pVvMYB30:GUS flowers reveal ed a diffuse staining
of carpels and stigmatic tiss ues (Additional file 3A). We
did not observe GUS expression in pre- and post-fertili-
zation flowers from most pVvMYB60:GUS lines. In two
transgenic lines, a weak staining was occasionally
detected in stamens, at the interface of filaments and
anthers (Additional file 3B). Finally, we did not detect
expression of the reporter in developing seeds from
either pVvMYB30:GUS or pVvMYB60:GUS transgenic
lines (Additional file 3C).
Expression of both the endogenous Arabidopsis and
grape MYB60 genes is rapidly down-regulated following
treatment with ABA [10] (Figure 2D). We thus investi-
gated changes in GUS expression in the pVvMYB60:GUS
lines in response to exogenou s applications of this hor-
mone, using both qPCR and histochemical analyses. A
previously described transgenic line ca rrying a transcrip-
tional fusion between the Arabidopsis AtMYB60 promoter
and the reporter GUS (pAtMYB60:GUS) was used as a
control for the experiment [10]. As expected, qPCR analy-
sis of GUS expression revealed a significant and rapid
decrease in the accumulation of GUS transcripts in the
control pAtMYB60:GUS plants following exposure to ABA
(P < 0.001) (Figure 3G). We observed a compara ble
Galbiati et al. BMC Plant Biology 2011, 11:142
/>Page 4 of 14

reduction in GUS expression in two independent
pVvMYB60:GUS lines, that were randomly selected for the
qPCR experiment (P < 0.001) (Figure 3G). Staining of
rosette leaves excised from all the ten pVvMYB60:GUS
lines, before and after treatment with ABA, confirmed the
negative effect of the hormone on the activity of the
VvMYB60 promoter (Figure 3H and 3I). Conversely, treat-
ment of pVvMYB30:GUS plants with ABA did not
Figure 2 Gene expression profiles of VvMYB60 and VvMYB30 in diff erent plant tissue s and in resp onse to ABA.(A) Expression in
grapevine organs. (B) and (C) Expression throughout berry seed and skin development (X-axis corresponds to weeks from veraison). Each gene
was independently normalized. (D) and (E) Expression in response to applied ABA in leaf disks. X-axis corresponds to hours after ABA application.
White circle: Mock solution, black circle: 50 μM ABA, black triangle: 100 μM ABA. (F) Expression changes of VvMYB60 and VvMYB30 in grapevine
plantlets subjected to salt stress conditions. Each gene was independently normalized against its control treatment (standard MS, with 3 mM
NaCl). Means and SD are the result of three independent replicates. Reference genes (UBIQUITIN and GLYCERALDEHYDE 3-PHOSPHATE
DEHYDROGENASE) were differently selected according to the experimental condition in which they presented less variation among samples and
assuming they behaved similarly as described in [43].
Galbiati et al. BMC Plant Biology 2011, 11:142
/>Page 5 of 14
Figure 3 Activity of the grape VvMYB60 promoter is localized to guard cells in Arabidopsis, and is down-regulated by ABA.(A) 15-day-
old pVvMYB30:GUS seedling. (B) Magnification of leaf primordia in (A), showing staining at the base of trichomes. (C) Detail of an emerging later
root. (D) 15-day-old pVvMYB60:GUS seedling. (E) Magnification of leaf primordia in (D), showing staining of differentiating stomata. (F) Detail of a
pVvMYB60:GUS mature leaf, showing staining of fully differentiated stomata. (G) qPCR analysis of GUS expression in response to 100 μM ABA, in
two independent pVvMYB60:GUS lines (mean ± SD, n = 3). A transgenic line carrying the 1.3 kb Arabidopsis MYB60 promoter fused to GUS
(pAtMYB60:GUS) was used as a control. Total RNA samples were extracted at the time points indicated (hours). Relative GUS transcript levels were
determined using gene-specific primers and normalized to the expression of the AtACTIN2 gene (At3g18780). Asterisks indicate values
significantly different from the untreated control (P < 0.001, t-test). (H) and (I) Histochemical analysis of GUS expression in pVvMYB60:GUS leaves
in response to ABA. (H) GUS staining of stomata in a control leaf. (I), GUS staining of stomata following 6 hours of exposure to 100 μM ABA.
Galbiati et al. BMC Plant Biology 2011, 11:142
/>Page 6 of 14
significantly affect the expression of the reporter (data not

shown).
Occurrence of guard cell-specific motifs in the VvMYB60
promoter
The conserved activity of the Arabidopsis and grape
MYB60 promoters, as emphasized by the analysis of the
corresponding promoter:GUS transgenic lines, suggests
that these two regulatory regions might share commo n
cis-elements responsible for the guard cell-specific
expression of the reporter. Previous evidence indicates a
role for DNA consensus sequences for DOF-type tran-
scription factors ([A/T]AAAG) as guard cell-specific cis-
active enhancers [23]. Specifically, clusters of at least
three [A/T]AAAG motifs located on the same strand
within a region of at most 100 bp were identified as puta-
tive guard cell-specific cis-regulatory elements [24].
The Arabidopsis AtMYB60 promoter contains multiple
[A/T]AAAG c lusters, of which the most proximal to the
translation start codon (-143 bp), is necessary and suffi-
cient to drive expression in guard cells (Cominelli,
unpublished results) (Additional file 4). We thus searched
the grape VvMYB30 and VvM YB60 prom oters for the
occurrence of [A /T]AAAG olig onucleotides, in a region
of 300 bp upst ream of the translation start site. We iden-
tified a cluster of three [A/T]AAAG motifs in the
VvMYB60 promoter, located at -169 bp from the ATG
codon of the endogenous gene, a distance comparable to
the position of the guard cell regulatory element found in
the promoter of AtMYB60. Consistent with the lack of
activity in Arabidopsis guard cells n o [A/T]AAAG clus-
ters were identified in the promoter of the grape

VvMYB30 gene (Additional file 4).
The cellular specificity of gene expression has been
investigated for a very limited number of grape genes.
Among these, VvSIRK,encodingaK
+
channel, has been
reported to be specifically expressed in guard cells [25].
Interestingly, we discovered an [A/T]AAAG cluster
upstream of the translation start codon (-200 bp) o f
VvSIRK, in the opposite orienta tion relative to the di rec-
tion of transcription (Additional file 4).
Functional complementation of the Arabidopsis atmyb60-
1 mutant by VvMYB60
A null allele of the Arabidopsis AtMYB60 gene (atmyb60-
1) displays constitutive reduction of the opening of the
stomatal po res and reduced water loss during drought
[10]. Interestingly, despite its increased tolerance to dehy-
dration relative to the wild type, the atmyb60-1 mutant
does not show obvious alterations in the sensitivity of
guard cells to ABA [10].
We used the atmyb60-1 allele to investigate the role of
VvMYB60 in the regulation of stomatal activity and to
explore the conservation of the MYB60 gene function
between grape and Arabidopsis. To this end, we introduced
the full length VvMYB60 cDNA in transgenic mutant
plants (atmyb60-C60 lines) to assess the ability of the grape
gene to rescue the stomatal defects of the atmyb60-1 allele.
As a control for the complementation, we generated a sec-
ond series of transgenic plants, in which we transformed
the full length VvMYB30 cDNA in the atmyb60-1 back-

ground (atmyb60-C30 lines). It is important to note that
the two VvMYB30 and VvMYB60 promoters displayed
very different patterns of a ctivity in Arabidopsis (Figure
3A, B, C, D, E and 3F). Hence, for a more robust and reli-
able comparison of the two grape genes in the atmyb60-1
background we used the 1.3 kb AtMYB60 promoter [10] to
drive the expression of VvMYB30 and VvMYB60 in guard
cells. T hree independent transgenic mutant lines with a
single insertion locus and comparable levels of expression
of the transgene were selected for further analysis of each
grape gene (Additional file 5).
We performed an in-vitro assay to evaluate the aperture
of the stomatal pore i n epidermal strips e xcised from
mutant and transgenic lines. In agreement with a previous
report [10], light-induced stomatal opening was reduced
in the atmyb60-1 mutant compared to the wild-type (Fig-
ure 4A and 4B). Mutant lines expressing the VvMYB30
gene did not display significant differences in the aperture
of the stomatal pores compared to atmyb60-1 (Figure 4A).
Conversely, a ll the mutant lines transformed w ith the
VvMYB60 gene displayed a wild-type response in terms of
light-induced stomatal opening, indicating full comple-
mentation of the atmyb60-1 mutation (Figure 4B).
To substantiate the results obtained in vitro, we investi-
gated the effect of both VvMYB30 and VvMYB60 in vivo,
by estimating whole-plant transpiration under stress con-
ditions. Wild-t ype, atmyb60-1, atmyb60-C30 and
atmyb60-C60 plants were grown in soil and pots were
covered with tin foil to prevent evaporation, so that
water loss occurring through stomatal transpiration

could be quantified. Pots were regularly watered for 20
days, and subsequently drought stress was imposed by
terminating irrigation. As expe cted, transpirational water
loss, as determined by soil water content m easurements,
was significantly reduced in atmyb60-1 compared to the
wild-type (P < 0.01 at 2, 4 and 10 days, P < 0.001 at 6, 8,
12-18 days) (Figure 4C and 4D). Consistently with results
from
the in vitro assay, mutant lines expressing the
VvMYB30 gene did not show any difference in term of
water lo ss com pared to the atmyb60-1 mu tant (Figur e
4C). Co nversely, under the same conditions, the lines
expressing the VvMYB60 gene displayed a rate of water
loss indist inguishable from the one observed in the wild-
type, thus demonstrating complete rescue of the stomatal
defects of the atmyb60-1 mutant (Figure 4D).
Galbiati et al. BMC Plant Biology 2011, 11:142
/>Page 7 of 14
Figure 4 The grape VvMYB60 gene complements stomatal defects of the Arabidopsis atmyb60-1 mutant.(A) and (B) St omatal aperture
assay in wild-type, atmyb60-1 and three independent transgenic mutant lines carrying the VvMYB30 (A) or the VvMYB60 (B) gene, under the
control of the guard cell-specific AtMYB60 promoter. Measurements were performed on epidermal strips excised from dark-adapted plants and
exposed to light for 4 hr. Each bar indicates mean ± SD of three separate experiments (n = 100 stomata per bar). The asterisk indicates values
significantly different from wild-type (P < 0.001, t-test). (C) and (D) Changes in soil water content during drought stress treatment of wild-type,
atmyb60-1 and three independent mutant lines complemented with the VvMYB30 gene (C), or the VvMYB60 gene (D). Plants grown under
normal watering conditions for 20 days were drought stressed by complete termination of irrigation. For clarity the responses of the atmyb60-
C30 and atmyb60-C60 transgenic lines have been plotted in two different graphs. Each point indicates mean ± SD (n = 20).
Galbiati et al. BMC Plant Biology 2011, 11:142
/>Page 8 of 14
Discussion
Identification of a Grape ortholog of the AtMYB60

Transcription Factor
The MYB superfamily constitutes the mo st abundant
group of transcription factors found in plants, with at least
198 members in Arabidopsis and 183 in rice [26]. In
grape, 108 putative R 2R3- M YB family genes were found
in the first genome version (8x coverage) [12], whereas
more than 125 R2R3 MYB genes can be found usi ng the
12x version (Matus, unpublished results). Plant R2R3-type
MYB transcription factors are implicated in several pro-
cesses related to cell fate, plant development, hormonal
responses, pathogen-disease resistance, drought and cold
tolerance, light sensing and flavonoid biosynthesis, among
many other functions [27]. MYB genes have been inten-
sively investigated in grape, yet most studies have focused
on members of the R2R3 cl ade involved in the regulation
of the anthocyanin and pro-anthocyanidin biosynthetic
pathway, as the accumulation of these f lavonoid com-
pounds in fruit tissues is a key determinant of berry and
wine quality [28]. Conversely, MYB genes clustered out-
side the flavonoid biosynthes is functional group received
little attention.
This work shows the identification of the grape
VvMYB60 gene, as a functional ortholog of the Arabidop-
sis AtMYB60 gene, involved in the regulation of light-
induced stomatal aperture [10]. Four lines of evidence
support this conclusion: i) the aminoacidic sequence of
the VvMYB60 and AtMYB60 proteins is highly con-
served, ii)theVv MYB60 and AtMYB60 genes show very
similar expression profiles, both in terms of tissue- and
cell-specificity and response to ABA, iii)theVvMYB60

and AtMYB60 promoters drive expression of reporter
genes exclusively in guard c ells and share co mmon cis-
regulatory elements, iv) the expression of VvMY B60 in
the atmyb60-1 mutant background completely rescues
the loss of the AtMYB60 function.
The Arabidopsis and grape MYB60 proteins resulted
more similar to each other than to any other MYB in
grape or Arabidopsis, even inside subgroup 1, reason why
we denoted subgroups 1.1 and 1.2 for further classifica-
tion. Two main features d iscriminate between the Arab i-
dopsis and grape MYB60 proteins and other closely
related proteins from subgroup 1: a distinctive PHEEG sig-
nature in the MYB domain, located in the loop connecting
the R2 and R3 repeats, and the lack of th e first (CtM1) of
three C-terminal motifs present in all the other MYB pro-
teins assigned to subgroup 1 (Figure 1B). Notably, both
characteristics are conserved in putative MYB60 orthologs
that we identified in other plant genomes, including oil-
seed rape, tomato, cucumber and poplar (data not shown).
Even though a role for the PHEEG and CtM1 motifs has
not yet been described, it is intriguing to speculate that
the presence of the former and the absence of the latter,
might contribute to the specificity of the MYB60 function
in guard cells.
Expression features of VvMYB60 in grape organs
It has been previously shown that the Arabidopsis
AtMYB60 gene is expressed in seedlings, rosette leave s,
stems and flowers and its level of expression is rapidly
down-regulated by the stress hormone ABA [10]. In addi-
tion, publicly available repositories of microarray-based

gene profiling experiments indicate that AtMYB60 is
transiently expressed during seed development, peaking
in stage 7 seeds (walking stick embryos) and rapidly
declining in m ature seeds (The Bio-Array Resource for
Plant Functional Genomics, />Our survey of VvMYB30 and VvMYB60 expression in
grape tissues revealed that both genes are preferentially
expressed in leaves, berry skin and seeds (Figure 2A).
Similarly to AtMYB60, and opposite to VvMYB30, expres-
sion of VvMYB60 in seeds was down-regulated during
seed development (Figure 2B). In berry skin VvMYB60
expression was higher before veraison, when the grape
berry is photosynthetically active and stomata are func-
tional, and was reduced after veraison, when stomata
evolve into non-functional lenticels [29] (Figure 2C). Inter-
estingly, at this stage, the onset of ripening and the accu-
mulation of sugars are correlated to increasing levels of
ABA in the berry [30], suggesting a possible negative effect
of the ho rmone on the expression of VvMYB60 in grape
tissues. Indeed, treatment of leaves with exogenous ABA
resulted in the rapid down-regulation of VvMYB60 expres-
sion (Figure 2D). In contrast, the hormone did not have
any effect on the accumulation of the VvMYB30 tran-
scripts (Figure 2E). Additionally, osmotic stresses which
trigger ABA-mediated responses, as high concentrations
of NaCl, caused the rapid down-regulation of VvMYB60
expression in grape tissues (Figure 2F). Interestingly, it has
been recently shown that applications of low concentra-
tions of ABA can trigger a transient up-regulation o f
MYB60 expression in Arabidopsis seedlings [31]. This sug-
gests that the pattern of AtMYB60 expression in response

to osmotic stress might be rather complex and dose-
dependent. Even though the detailed analysis of the
mechanisms that regulate the expression of the VvMYB60
gene extends beyond the scope of th is work, it will be
intriguing to further i nvestigate the expression profile of
VvMYB60 in different grape tissues in response to a wider
range of ABA concentrations.
The VvMYB60 promoter specifically drives reporter gene
expression in Arabidopsis guard cells
Reporter gene analysis and RT-PCR experiments
performed on p urified Arabidopsis stomata, clearly
Galbiati et al. BMC Plant Biology 2011, 11:142
/>Page 9 of 14
demonstrated that in green tissues, AtMYB60 is exclu-
sively expressed in guard cells [8,24].
We produced Arabidopsis lines harboring the GUS
marker gene under the control of t he VvMYB30 and
VvMYB60 promoters to establish the cellular localiza-
tion of gene expression . Histochemical analysis of GUS
expression in several independent lines indicated that
the activity of the VvMYB60 promoter is restricted to
guard cells (Figure 3D, E and 3F). This result is consis-
tent with the expression of the endogenous VvMYB60
gene in leaves and berry skin, which both contain sto-
mata, and with the lack of expression in roots (Figure
2A). Reporter gene approaches in Arab idopsis provide
efficient and reliable tools to investigate the expression
of grape genes and to identify gene regulatory elements
[25]. Yet, we did not observe reporter activity in devel-
oping seeds of the pVvMYB30:GUS and pVvMYB60:

GUS lines (Additional file 3C). This finding is in con-
trast with data from qPCR experiments, which showed
that both genes are highly expressed in grape seeds (Fig-
ure 2A and 2B). This discrepancy could simply be arte-
factual, because of the heterologous genetic background.
However, it is important to note that we did not detect
GUS activity in developing seeds of pAtMYB60:GUS
plants, used as a positive control in this study, despite
the high expression of the endogenous Arabidopsis gene
in these organs [32]. Different hypotheses can be formu-
lated to explain the lack of activity of the AtMYB60 and
VvMYB60 promoters in seeds. First, cis-elements
responsible for the seed expression of the endogenous
genes could be located outside the regulatory genomic
regions considered in this work. However, Cominelli
and colleagues reported that the complete 5’ and 3’
AtMYB60 intergenic regions, cloned upstream and
downstream of the GUS gene, do n ot drive expression
of the reporter in seeds [10]. Alternatively, expression of
AtMYB60 and VvMYB60 in seeds could be mediated by
intragenic regulatory elements. Cis-acting motifs, located
in introns, have been demonstrated to be required to
establish the correct expression domain of transcription
factors, such as the MADS-box AGAMOUS gene [33].
Most interestingly, seed-specific enhancers have been
mapped in the intronic regions of seed-expressed genes
in different plant species [34]. Finally, the finding that
the AtMYB60 mRNA is associated with polyribosomes
purified from guard cells but not from other plant tis-
sues [35], opens the possibility for a translational level

of regulation for MYB60 expression in see ds. Clearly,
more work is needed to unravel the nature of the cis-
regulatory elements that modulate MYB60 expression in
seeds, together with revealing the function of this gene
in these organs. Nevertheless, it is reasonable to con-
clude that the stomata-s pecific activity of the VvMYB60
promoter in Arabidopsis mirrors the expression of the
endogenous gene in grape guard cells.
While the identity of the cis-acting elements required for
the expression of AtMYB60 and VvMYB60 in seeds
remains elusive, their expression in stomata is most likely
regulated, in cis, by DOF recognition DNA motifs. We
identified a cluster of [A/T]AAAG DOF target sites in
close proximity to the VvMYB60 translational start codon
(Additional file 4). Such a cluster has been described as a
guard cell-specific cis-regulatory element in different plant
species, including Arabidopsis and potato [23,24]. The
occurrence of [A/T]AAAG motifs in the guard cell-speci-
fi
c Vv
MYB60 and VvSIRK grape promoters lends further
support to the conservation of the cis- and, possibly, trans-
mechanisms that direct expression in guard cells in
distantly related plant species. Interestingly, strong conser-
vation across a wide range of flowering plant species has
also been reported for other cell-specific cis-motifs, such
as the root hair-specific cis-elements (RHEs) [36].
VvMYB60 is a functional ortholog of AtMYB60
The ability of VvMYB60 to fully complement, both in vitro
and in vivo, the stomatal defects exhibited by the atmy60-1

mutant u nequivocally demonstrates that VvMYB60 is a
true ortholog of the Arabidopsis AtMYB60 transcription
factor. Importantly, the VvMYB30 gene product, which
shares 47% identity to VvMYB60, did not complement the
atmyb60-1 mutation. This result is in agreement with
functional studies which indicate that, despite the high
degree of homology between the AtMYB30 and AtMYB60
aminoacidic sequences, these two proteins play two dis-
tinct functional roles. In Arabidopsis, AtMYB30 mediates
brassinosteroid-induced gene expression [15] and patho-
gen-induced hypersensitive response [16], whereas
AtMYB60 positively regulates light-induced stomatal
opening and modulates water loss under drought [10].
As a whole, our findings indicate a role for VvMYB60 in
the regulation of guard cell activity and transpiration rate
in grapevine. Stomatal conductance is a key trait in grape-
vine, as it directly d etermines the isohydric/anisohydric
behavior displayed by different genotypes. These differ-
ences are due to stomatal control over evaporative demand
rather than stomatal density in vegetative tissues [37]. Cul-
tivar-specific differences have al so been described for the
effects of water deficit on ABA metabolism and signaling
[38]. Anisohydric cultivars such as Pinot Noir possess
insufficient stomatal regulatio n and show high transpira-
tion rates and stomatal conductance, whereas isohydric
cultivars as Shiraz, display much lower values [39]. In this
perspective, it wil l be interesting to surv ey variations in
naturally occurring VvMYB60 alleles and to establish their
contribution to differences in stomatal activity in different
Vitis species and cultivars.

Galbiati et al. BMC Plant Biology 2011, 11:142
/>Page 10 of 14
Conclusions
VvMYB60 could represent a valuable t arget for down-
stream biotechnological applications. Although grapevine
is a highly productive water stress-adapted plant, the avail-
ability of molecular targets for engineering or breeding of
new cultivars with enhanced stomatal responses represents
an attractive approach to increase water use efficiency and,
possibly, to reduce pathogen penetration through the sto-
matal pore [40,41].
Methods
Phylogeny reconstruction and bootstrap analysis
Alignments were performed using the BLOSUM matrix
(Gap opening and extension penalties of 10 and 5, respec-
tively) of the ClustalW algorithm-based AlignX
®
module
from Mega4 Software [42]. A rooted tree was constructed
using the Neighbour Joining Method (NJ) in MEGA4 and
confirmed with MEGA3. Tree nodes were evaluated by
bootstrap analysis for 100 replicates (pairwise deletion,
uniform rates and Poisson correction options). Publicly
available s equences were coll ected from Gen bank via
NCBI ( The corresponding
cDNAs of the complete c oding sequences of VvMYB30
and VvMYB60 were amplified from PN40024 genomic
DNA and leaf cDNA, respectively, using the following pri-
mer combinations: VvMYB30F1-VvMYB30R3 and
Vv60L2F4-Vv60L2R4 (see below for primer sequences).

Field sampling of grape organs and nucleic acid
extraction
Grapevine organs (Vitis vinifera L. cv. Cabernet Sau-
vignon) were colle cted from a commercial vineyard in
the Maipo Valley, Chile, and fr ozen in liquid nitrogen for
RNA extraction. Fo r grape berry skin and seed sampling,
a total of nine grape clusters were collected from three
plants every t wo weeks during fruit development, b egin-
ning two weeks after fruit set and ending at eight weeks
after veraison. Total RNA was isolated from all grapevine
tissues as described [43]. For cDNA synthesis, one μgof
total RNA was reverse transcribed wi th random hexamer
primers using StrataScript
®
reverse transcriptase (Strata-
gene) according to the manufacturer’s instructions.
ABA and salt treatment experiments
For ABA treatments, young leaves of Vitis vinifera cv.
Cabernet Sauvignon were cut from two month old plant-
lets cultivated in vitro and placed in petri dishe s supple-
mented with 50 μM, 100 μMABA(+/-cis, trans ABA;
SIGMA), dissolved in 100% ethanol, or with an equal
amount of 100% ethanol (mo ck solution). Samples were
maintained in a growth chamber at 20°C in the light (120
μmo l m
-2
sec
-1
of measured light irradiance), and every
two hours three leaves from each treatment were col-

lected for RNA extraction.
For salt treatments, nodal explants of Vitis vinifera cv.
Cabernet Sa uvignon w ere placed vertically on sterile MS
medium supplemented with 3 mM NaCl (standard),
100 mM NaCl or 200 mM NaCl and left for a month in a
growth chamber (20°C; 16 h photop eriod). At the end o f
the experiment, complete plantlets were collected for
RNA extraction.
Quantitative comparison of gene expression in grape
tissues
Relative transcript quantification of isolated genes was
achieved by real time RT-PCR, using the Brilliant
®
SYBR
®
Green QPCR Master Reagent Kit (Stratagene) and the
Mx3000P detection system (Stratagene) as described in
the manufacturer ’ s manual. Primers qPCR_VvMYB30fw
(5’-CTCAAGTCCCTCTCAC AATG-3’)andqPCR_VvM
YB30rev (5’ -TGTCAATTAGGTCTTCTTGTTC-3’),
qPCR_VvMYB60fw (5’-TTGAGTACGAAAACCTGAAT-
GAT-3’ ) and qPCR_VvMYB60rev (5’ -GGAGGGTT
GTGCTTCTTCTGAT-3’) were used for amplification
and qPCR quantification of VvMYB30 (81 bp) and
VvMYB60 (121 bp), respectively. Amplification of the UBI-
QUITIN (99 bp) or GLYCERALDEHYDE 3-PHOSPHATE
DEHYDROGENASE (G3PDH) genes was used for normal-
ization [44], depending on their expression variations for
each experimental condition. PCR conditions, standard
quantification curves for each gene and relative gene

expression calculations were conducted according to
Matus et al. [45].
Plasmid constructs, generation and analysis of
Arabidopsis transgenic lines
To generate the pVvMYB30:GUS construct, a region of
2,173 bp upstream of the translational start codon was
amplified from grape genomic DNA (Pinot noir,
PN40024), using primers VvMYB30F3 (5’-AAGCTTCT-
GACGCAGTTTTCAACCATC-3’), containing a HindIII
site, and VvMYB30R4 (5’ -TCTAGAGGTGGCCTCCCC
TTGGCT-3’), containing an XbaI site. The HindIII-XbaI
fragment was cloned upstream of the uidA coding seq-
uence in the pBI101.3 binary vector (Stratagene). Similarly,
the 2,239 bp putative pVvMYB60:GUS promoter was
amplified with p rimers Vv60F3 (5’ -AAGCTTATGAGA
GGTCGTATAAGTA-3’), containing a HindIII site, and
Vv60R3 (5’-TCTAGAGGCCTTCCTATGGCTT-3’), con-
taining an XbaI site, and the PCR fragment was cloned in
the pBI101.3 vector. The VvMYB30 full length cDNA, was
obtained by amplification of PN40024 leaf cDNA with the
primers VvMYB30F1 (5’-GGATCCATGGGGAGGCCA
CCTTG-3’), co ntainin g a BamHI site and VvMYB30R3
(5’ -GATATCTAGAAGAGCTGAGCAGTGTCCT-3’ ),
containing an EcoRV s ite. The full length VvMYB60
cDNA was amplified with the primer Vv60L2F4 (5’-GGA
TCCATGGGAAGGCCTCCTTGCTG TG-3’), containing
Galbiati et al. BMC Plant Biology 2011, 11:142
/>Page 11 of 14
a BamHI site and the primer Vv60L2R4 (5’-GAGCTCT-
CAGAATATTGGAGAGAGTTGATCC-3’), containing a

SacI site. Amplified cDNAs were sequenced and then
cloned in a modified version of the pPZP221 binary vector,
containing the 1.3 kb AtMYB60 promoter and the nos ter-
minator (Galbiati, unpublished). All constructs were intro-
duced in Arabidopsis (Col-0) by Agrobacterium-mediated
transformation as described [22]. Transformed lines were
selected on antibiotic containing media, and the presence
of the transgene was confirmed by PCR. For analysis of
transgene expression, total RNA was isolated with the
RNeasy Mini Kit (Qiagen) and reverse-transcribed with
the RT Superscript II kit (Invitrogen). Semi-quantitative
RT-PCRs were performed for 25 cycles with primer pairs:
Vv30F2 (5’-GGATCCATGGGAAGGCCTCCTTGCT-3’ )
and Vv30R2 (5’-AAGTCTGACAGTGATGAGAGGAGC-
3’); Vv60F2 (5’-CTCCTTGCTGTGATAAAGTTGGTAT-
3’ ) and Vv60R2 (5’ -ATTCAGGTTTTCGTACTCAA-
GAATG-3’). The cont rol AtACTIN2 gene (At3g18780)
[46] was amplified using primers AtACT2F (5’ -GTGT
TGGACTCTGGAGATGGTGTG-3’)andAtACT2R(5’-
GCCAAAGCAGTGATCTCTTTGCTC-3’). Homozygous
T3 lines were selected for GUS staining and functional
complementation analyses.
Arabidopsis growth, ABA treatment and analysis of GUS
expression
Seeds were surface-st erilized overnight in a sealed cham-
ber in the pre sence of 100 ml of commercial bleac h and
3 ml of 37% HCl, and germinated in Petri dishes contain-
ing Murashige and Skoog medium, 1% w/v sucrose and
0.8% w/v agar. Plants were g rown under lon g-day condi-
tions (16 h light/8 h dark, at 100 μmol m

-2
sec
-1
)at22°C
in a cont rolled growth chamber. For ABA treatments,
plants were t ransferred to liquid MS medium with 3% w/
v sucrose and 0.5 g/l MES, supplemented with 100 μM
ABA ( +/- cis, trans ABA ; SIGMA) , dissolve d in 100%
ethanol, or with an equal am ount of 100% ethanol (mock
solution). For d etection of GUS activity, tissues were
incubated for 6 hr, at 37°C, in 0.5 mg/ml X-glucuronic
acid, 0.1% Triton X-100, and 0.5 mM ferrocyanidine in
100 mM phosphate buffer (pH 7). Tissues were cleared
with 70% ethanol and examined using a Leica M205 FA
stereoscope o r a Leica DM2500 optical microscope.
qPCR analysis of GUS expression was performed as
described for the grape samples, using prim ers
qPCR_GUSF1 (5’ -TACGGCAAAGTGTGGGTCAATA
ATCA-3’ )andqPCR_GUSR1(5’ -CAGGTGTTCGGC
GTGGTGTAGAG-3’). GUS expression was normalized
using the control AtACTIN2 gene (At3g18780) [46],
amplified with primers qPCR_AtACT2fw (5’-TGCTTCT
CCATTTGTTTGTTTC-3’ ) and qPCR_AtACT2rev (5 ’-
GGCATCAATTCGATCACTCA-3’).
Stomatal aperture and water loss measurements
Stomatal assay s were performed on a baxial epidermis
strips, incubated in 30 mM KCl, 10 mM MES-KOH, pH
6.5, at 22°C, and exposed to light (300 μmol m
-2
sec

-1
) for 4
h. Measurements of stomatal aperture were performed
using a Leica DM2500 optical microscope and the LAS
Image Analysis softwa re. For drought experiments, se eds
were germinated in individual pots each containing the
same amount of pre-wetted soil. Plants were regularly irri-
gated for 20 days. Before wa tering was terminated, p ots
were covered with tin foil to minimize evaporation from
soil. Pots were weighed every other day at the same time
for 18 days. At the end of the treatment, pots were dried
for three days at 65°C to determine the dry weight. Water
content was estimated as [ (Wt
n
-DW)/(Wt
0
-DW)] × 100,
where Wt
n
= total weight of the pot at day n; DW = dry
weight of the pot and Wt
0
= total weight of the pot at day 0.
Additional material
Additional file 1: Deduced gene structure of AtMYB60, VvMYB30 and
VvMYB60. Boxes represent exons, while black lines represent introns. The
location of the ATG start codon is indicated (black arrow). Gene organization
and size of exons and introns were deduced by comparing the sequence of
amplified genomic and cDNA fragments. Yellow and green boxes represent
exon sequences coding for the R2 and R3 repeat, respectively.

Additional file 2: Phenotypic changes in grapevine plantlets grown
in the presence of growing NaCl concentration. Pictures were taken
one month after the beginning of the treatment.
Additional file 3: Activity of the grape VvMYB360 and VvMYB60
promoters in flowers and siliques from Arabidopsis lines carrying
promoter:GUS fusions.(A ) GUS expression in pVvMYB30:GUS flowers
was localized in carpels and stigmatic tissues (arrow). (B) Most pVvMYB60:
GUS flowers did not show GUS activity, with the exception of two
independent lines which disclosed staining in the distal part of the
anther filament (arrow). (C) pVvMYB60:GUS siliques did not show GUS
expression in developing seeds (Bars = 1 mm).
Additional file 4: Occurrence of [A/T]AAAG motifs in the 300 bp
regulatory region located upstream of the translational start codon
of the AtMYB60, VvMYB30, VvMYB60 and VvSIRK genes. [A/T]AAAG
nucleotides on the + strand are highlighted in yellow, whereas [A/T]
AAAG nucleotides on the - strand are highlighted in pale blue. The
predicted TATA box is in italic and highlighted in green, the ATG codon
is highlighted in dark blue. Sequences encompassing clusters of [A/T]
AAAG motifs (see text for definition) are in bold and underlined.
Additional file 5: Generation and selection of the transgenic lines
used for the complementation of the atmyb60-1 Arabidopsis
mutant (atmyb60-C60 and atmyb60-C30).(A) and (B), schematic
representation of the constructs used in the complementation test (not
to scale). (C) and (D), RT-PCR analysis of transgene expression (VvMYB60
and VvMYB30) in three independent homozygous T3 transformed
atmyb60-1 lines. (), lane 1 = atmyb60-C60-1; lane 2 = atmyb60-C60-2; lane
3=atmyb60-C60-3; lane 4 = atmyb60-1; lane 5 = dH
2
O. (D), lane 1 =
dH

2
O; lane 2 = atmyb60-C30-1; lane 3 = atmyb60-C30-2; lane 4 =
atmyb60-C30-3; lane 5 = atmyb60-1. The Arabidopsis AtACTIN2 gene
(At3g18780) was used as a control.
Acknowledgements
We thank Michael Handford (Universidad de Chile) for critically reviewing
the manuscript. This work was partially supported by FONDECYT 1100709,
Galbiati et al. BMC Plant Biology 2011, 11:142
/>Page 12 of 14
the Chilean Fruit Consortium, CORFO-Innova 07Genoma01, Millennium
Nucleus for Plant Functional Genomics (P06-009-F), by the Italian “Progetto
AGER, bando Viticoltura da Vino” (SERRES, 2010-2105) and by Fondazione
Umberto Veronesi per il Progresso delle Scienze, Milano, Italy.
Author details
1
Dipartimento di Scienze Biomolecolari e Biotecnologie, Università degli
Studi di Milano, Via Celoria 26, 20133 Milano, Italy.
2
Fondazione Filarete, Viale
Ortles 22/4, 20139, Milano, Italy.
3
Pontificia Universidad Católica de Chile,
Departamento de Genética Molecular y Microbiología. Alameda 340.
Santiago, Chile.
4
Centre for Research in Agricultural Genomics (CRAG), 08193
Barcelona, Spain.
5
Istituto di Biologia e Biotec nologia Agraria, CNR; Milano,
Italy.

Authors’ contributions
MG and JTM contributed to the conception of the study, drafted the
manuscript, carried out the grape genome search and cloning of MYB60 like
genes and their promoter sequences. MG, PF, FR, LC and EC, produced and
analysed the Arabidopsis transgenic lines described in the work. JTM carried
out the phylogenetic study and, together with PC and CM, tested VvMYB60
and VvMYB30 expression in Vitis vinifera organs and experimental conditions.
CT and PAJ were involved in revising the manuscript critically for important
intellectual content and gave final approval of the version to be published.
All authors read and approved the final manuscript.
Received: 23 June 2011 Accepted: 21 Octob er 2011
Published: 21 October 2011
References
1. Chaves M, Zarrouk O, Francisco R, Costa J, Santos T, Regalado A,
Rodrigues M, Lopes C: Grapevine under deficit irrigation: hints from
physiological and molecular data. Ann Bot 2010, 105(5):661-676.
2. Downey M, Dokoozlian N, Krstic M: Cultural practice and environmental
impacts on the flavonoid composition of grapes and wine: A review of
recent research. Am J Enol Vitic 2006, 57(3):257-268.
3. Lovisolo C, Hartung W, Schubert A: Whole-plant hydraulic conductance
and root-to-shoot flow of abscisic acid are independently affected by
water stress in grapevines. Funct Plant Biol 2002, 29(5):1349-1356.
4. Rodrigues ML, Chaves MM, Wendler R, David MM, Quick P, Leegood R,
Stitt M, Pereira JS: Osmotic adjustment in water stressed grapevine
leaves in relation to carbon assimilation. Aust J Plant Physiol 1993,
20(3):309-321.
5. Flexas J, Barón M, Bota J, Ducruet J, Gallé A, Galmés J, Jiménez M, Pou A,
Ribas-Carbó M, Sajnani C, et al: Photosynthesis limitations during water
stress acclimation and recovery in the drought-adapted Vitis hybrid
Richter-110 (V. berlandieri × V. rupestris). J Exp Bot 2009, 60(8):2361-2377.

6. Escalona J, Flexas J, Medrano H: Stomatal and non-stomatal limitations of
photosynthesis under water stress in field-grown grapevines. Aust J Plant
Physiol 1999, 26(5):421-433.
7. Schroeder J, Kwak J, GJ GA: Guard cell abscisic acid signalling and
engineering drought hardiness in plants. Nature 2001, 410(6826):327-330.
8. Cominelli E, Galbiati M, Tonelli C: Transcription factors controlling
stomatal movements and drought tolerance. Transcription 2010, 1(1):1-5.
9. Xie Z, Wang L, Sack F, Grotewold E: Role of the stomatal development
regulators FLP/MYB88 in abiotic stress responses. Plant J 2010,
64(5):731-739.
10. Cominelli E, Galbiati M, Vavasseur A, Conti L, Sala T, Vuylsteke M,
Leonhardt N, Dellaporta SL, Tonelli C: A guard-cell-specific MYB
transcription factor regulates stomatal movements and plant drought
tolerance. Curr Biol 2005, 15(13):1196-1200.
11. Velasco R, Zharkikh A, Troggio M, Cartwright DA, Cestaro A, Pruss D,
Pindo M, FitzGerald LM, Vezzulli S, Reid J, et al: A High Quality Draft
Consensus Sequence of the Genome of a Heterozygous Grapevine
Variety. PloS ONE 2007, 2(12):e1326.
12. Matus JT, Aquea F, Arce-Johnson P: Analysis of the grape MYB R2R3
subfamily reveals expanded wine quality-related clades and conserved
gene structure organization across Vitis and Arabidopsis genomes. BMC
Plant Biol 2008, 8:(83).
13. Kranz HD, Denekamp M, Greco R, Jin H, Leyva A, Meissner RC, Petroni K,
Urzainqui A, Bevan M, Martin C, et al:
Towards functional characterisation
of
the
members of the R2R3-MYB gene family from Arabidopsis
thaliana. Plant J 1998, 16(2):263-276.
14. Wang F, Lian H, Kang C, Yang H: Phytochrome B is involved in mediating

red light-induced stomatal opening in Arabidopsis thaliana. Mol Plant
2010, 3(1):246-259.
15. Li L, Yu X, Thompson A, Guo M, Yoshida S, Asami T, Chory J, Yin Y:
Arabidopsis MYB30 is a direct target of BES1 and cooperates with BES1
to regulate brassinosteroid-induced gene expression. Plant J 2009,
58(2):275-286.
16. Raffaele S, Vailleau F, Leger A, Joubes J, Miersch O, Huard C, Blee E,
Mongrand S, Domergue F, Roby D: A MYB transcription factor regulates
very-long-chain fatty acid biosynthesis for activation of the
hypersensitive cell death response in Arabidopsis. Plant Cell 2008,
20(3):752-767.
17. Seo P, Park C: MYB96-mediated abscisic acid signals induce pathogen
resistance response by promoting salicylic acid biosynthesis in
Arabidopsis. New Phytol 2010, 186(2):471-483.
18. Seo P, Xiang F, Qiao M, Park J, Lee Y, Kim S, Lee Y, Park W, Park C: The
MYB96 transcription factor mediates abscisic acid signaling during
drought stress response in Arabidopsis. Plant Physiol 2009, 151(1):275-289.
19. Agarwal M, Hao Y, Kapoor A, Dong CH, Fujii H, Zheng X, Zhu JK: A R2R3
type MYB transcription factor is involved in the cold regulation of CBF
genes and in acquired freezing tolerance. J Biol Chem 2006,
281(49):37636-37645.
20. Ding Z, Li S, An X, Liu X, Qin H, Wang D: Transgenic expression of MYB15
confers enhanced sensitivity to abscisic acid and improved drought
tolerance in Arabidopsis thaliana. J Genet Genomics 2009, 36(1) :17-29.
21. Liang Y, Dubos C, Dodd I, Holroyd G, Hetherington A, Campbell M:
AtMYB61, an R2R3-MYB transcription factor controlling stomatal
aperture in Arabidopsis thaliana. Curr Biol 2005, 15(13):1201-1206.
22. Clough S, Bent A: Floral dip: a simplified method for Agrobacterium-
mediated transformation of Arabidopsis thaliana. Plant J 1998,
16(6):735-743.

23. Plesch G, Ehrhardt T, Mueller-Roeber B: Involvement of TAAAG elements
suggests a role for Dof transcription factors in guard cell-specific gene
expression. Plant J 2001, 28(4):455-464.
24. Galbiati M, Simoni L, Pavesi G, Cominelli E, Francia P, Vavasseur A, Nelson T,
Bevan M, Tonelli C: Gene trap lines identify Arabidopsis genes expressed
in stomatal guard cells. Plant J 2008, 53(5):750-762.
25. Pratelli R, Lacombe B, Torregrosa L, Gaymard F, Romieu C, Thibaud JB,
Sentenac H: A grapevine gene encoding a guard cell K(+) channel
displays developmental regulation in the grapevine berry. Plant Physiol
2002, 128(2):564-577.
26. Yanhui C, Xiaoyuan Y, Kun H, Meihua L, Jigang L, Zhaofeng G, Zhiqiang L,
Yunfei Z, Xiaoxiao W, Xiaoming Q, et al: The MYB transcription factor
superfamily of Arabidopsis: expression analysis and phylogenetic
comparison with the rice MYB family. Plant Mol Biol 2006,
60(1):107-124.
27.
Dubos
C, Stracke R, Grotewold E, Weisshaar B, Martin C, Lepiniec L: MYB
transcription factors in Arabidopsis. Trends Plant Sci 2010, 15(10):573-581.
28. Waterhouse A: Wine phenolics. Ann N Y Acad Sci 2002, 957:21-36.
29. Blanke M, Pring R, Baker E: Structure and elemental composition of grape
berry stomata. J Plant Physiol 1999, 154:477-481.
30. Gambetta G, Matthews M, Shaghasi T, McElrone A, Castellarin S: Sugar and
abscisic acid signaling orthologs are activated at the onset of ripening
in grape. Planta 2010, 232(1):219-234.
31. Oh J, Kwon Y, Kim J, Noh H, Hong S, Lee H: A dual role for MYB60 in
stomatal regulation and root growth of Arabidopsis thaliana under
drought stress. Plant Mol Biol 2011, 77(1-2):91-103.
32. Winter D, Vinegar B, Nahal H, Ammar R, Wilson G, Provart N: An “Electronic
Fluorescent Pictograph” browser for exploring and analyzing large-scale

biological data sets. PLoS One 2007, 2:e718.
33. Sieburth LE, Meyerowitz EM: Molecular dissectionvof the AGAMOUS
control region shows that cis elements for spatial regulation are located
intragenically. Plant Cell 1997, 9(3):355-365.
34. Kim M, Kim H, Shin J, Chung C, Ohlrogge J, Suh M: Seed-specific
expression of sesame microsomal oleic acid desaturase is controlled by
combinatorial properties between negative cis-regulatory elements in
the SeFAD2 promoter and enhancers in the 5’-UTR intron. Mol Genet
Genomics 2006, 276(4):351-368.
35. Mustroph A, Zanetti M, Jang C, Holtan H, Repetti P, Galbraith D, Girke T,
Bailey-Serres J: Profiling translatomes of discrete cell populations resolves
Galbiati et al. BMC Plant Biology 2011, 11:142
/>Page 13 of 14
altered cellular priorities during hypoxia in Arabidopsis. PNAS 2009,
106(44):18843-18848.
36. Kim DW, Lee SH, Choi SB, Won SK, Heo YK, Cho M, Park YI, Cho HT:
Functional conservation of a root hair cell-specific cis-element in
angiosperms with different root hair distribution patterns. Plant Cell
2006, 18(11):2958-2970.
37. Rogiers S, Gree D, Hutton R, Landsberg J: Does night-time transpiration
contribute to anisohydric behaviour in a Vitis vinifera cultivar? J Exp Bot
2009, 60(13):3751-3763.
38. Deluc L, Quilici D, Decendit A, Grimplet J, Wheatley M, Schlauch K,
Mérillon J, Cushman J, Cramer G: Water deficit alters differentially
metabolic pathways affecting important flavor and quality traits in
grape berries of Cabernet Sauvignon and Chardonnay. BMC Genomics
2009, 8:212.
39. Schultz H: Differences in hydraulic architecture account for near-
isohydric and anisohydric behaviour of two field-grown Vitis vinifera L.
cultivars during drought. Plant Cell Environ 2003, 26(8):1393-1405.

40. Allegre M, Heloir MC, Trouvelot S, Daire X, Pugin A, Wendehenne D,
Adrian M: Are grapevine stomata involved in the elicitor-induced
protection against downy mildew? Mol Plant Microbe Interact 2009,
22(8):977-986.
41. Pou A, Flexas J, Alsina Mdel M, Bota J, Carambula C, de Herralde F,
Galmes J, Lovisolo C, Jimenez M, Ribas-Carbo M, et al: Adjustments of
water use efficiency by stomatal regulation during drought and
recovery in the drought-adapted Vitis hybrid Richter-110 (V. berlandieri
× V. rupestris). Physiol Plant 2008, 134(2):313-323.
42. Tamura K, Dudley J, Nei M, Kumar S: MEGA4: Molecular Evolutionary
Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 2007,
10(8):1596-1599.
43. Reid K, Olsson N, Schlosser J, Pengù F, Lund S: An optimized grapevine
RNA isolation procedure and statistical determination of reference
genes for real-time RT-PCR during berry development. BMC Plant Biol
2006, 6:27.
44. Downey M, Harvey J, Robinson S: Synthesis of flavonols and expression of
flavonol synthase genes in the developing grape berries of Shiraz and
Chardonnay (Vitis vinifera L.). Aust J Grape Wine Res 2003, 9(2):110-121.
45. Matus JT, Loyola R, Vega A, Pena-Neira A, Bordeu E, Arce-Johnson P,
Alcalde JA: Post-veraison sunlight exposure induces MYB-mediated
transcriptional regulation of anthocyanin and flavonol synthesis in berry
skins of Vitis vinifera. J Exp Bot 2009, 60(3):853-867.
46. Nishimura T, Yokota E, Wada E, Shimmen T, Okada K: An Arabidopsis ACT2
Dominant-Negative Mutation, which Disturbs F-actin Polymerization,
Reveals its Distinctive Function in Root Development. Plant Cell Physiol
2003, 44(11):1131-1140.
doi:10.1186/1471-2229-11-142
Cite this article as: Galbiati et al.: The grapevine guard cell-related
VvMYB60 transcription factor is involved in the regulation of stomatal

activity and is differentially expressed in response to ABA and osmotic
stress. BMC Plant Biology 2011 11:142.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Galbiati et al. BMC Plant Biology 2011, 11:142
/>Page 14 of 14