luận văn Toxicity assessment of small molecules using the zebrafish as a model system

VIETNAM NATIONAL UNIVERSITY, HANOI
INSTITUTE OF MICROBIOLOGY AND BIOTECHNOLOGY
and
UNIVERSITY OF LIÈGE
---------------------

Đinh Duy Thành

TOXICITY ASSESSMENT OF SMALL MOLECULES USING THE
ZEBRAFISH AS A MODEL SYSTEM

Subject:

Biotechnology

Code:

60.42.02.01

MASTER’S THESIS

SUPERVISORS:

Prof. Marc Muller
Dr. Nguyễn Lai Thành

Hà Nội - 2014


ACKNOWLEDGEMENT
This thesis would not have been possible without all the support,

guidance, inspiration, and patience of the following people and
organisations during the course of my study. It is a privilege to
convey my gratefulness to them in my humble acknowledgements.
First and foremost, I own my deepest gratitude to Prof. Marc
Muller, who gave me the opportunity to pursue my own interests
as a trainee in the GIGA-Research. Your wisdom, guidance,
support, and endurance enable me to develop and improve my
expertise in both laboratory works and scientific writing.
Moreover, you did motivate me through my inner pressures as
well as outer obstacles.
I offer my thankfulness to my co-supervisor, Dr. Nguyễn Lai
Thành, for continuously encouraging me to explore my own ideas.
Your knowledge, gentleness, and trust have inspired me and other
students to keep following the scientific path.
Special thanks to Dr. Nguyễn Huỳnh Minh Quyên, Prof. Jacques
Dommes, the Institute of Microbiology and Biotechnology (VNUIMBT), and the University of Liège (ULg) for organising this
Master Program in Biotechnology. It is also an honour for me to

i


study with devoted professors and lectures within the course.
They not only gave me the knowledge but also a new vision to
perceive the Science of Life.
It is my great pleasure to thank Benoist, Yoann, and Audrey in
the Toxicology team as well as the Mullerians and members of
the BMGG: Thomas, Marie, David, and all others. Your supports
and helps during my stay in Liège crucially contributed to the
completion of my research. I would also like to express my
thanks to my friends and colleagues: Lung, Tuấn, An, Loan, and

others for their cares and encouragements in life and work.
My research trip was co-sponsored by the Wallonia-Brussels
International (WBI) and the Wallonia-Brussels delegation to
Vietnam. I would like to thank you for your commitment to
supporting scientific innovations as well as strengthening the
collaborations between the two laboratories and between our
countries.
Last, but by no means least, my sincerest admiration and
gratitude are dedicated to my dear family, particularly my
beloved wife for unconditionally trusting and pushing me to
overcome all kinds of difficulty I encounter in the past, present,
and future.

ii


TABLE OF CONTENTS
TABLE OF CONTENTS .......................................................................................... i
LIST OF TABLES AND FIGURES ........................................................................v
ABBREVIATIONS ................................................................................................ vii
PREFACE ..................................................................................................................1
Chapter 1: BACKGROUND INFORMATION .....................................................2
1.1. Small molecules: safety concerns...................................................................2
1.1.1. Pharmaceuticals and personal care products (PPCPs) ..........................3
1.1.2. Food additives ..........................................................................................4
1.1.3. Household chemicals ................................................................................5
1.2. The Zebrafish embryo toxicity test (ZET) ......................................................6
Chapter 2: METHODS ...........................................................................................11
2.1. Substances .....................................................................................................11
2.2. Zebrafish maintenance .................................................................................12

2.3. Chemical exposure and embryo observation ...............................................12
2.4. Behavioural analysis .....................................................................................14
2.5. Gene expression analysis ..............................................................................14
2.5.1. Reverse transcription and quantitative polymerase chain reaction ......14
2.5.2. Transgenic fluorescent lines ...................................................................16
2.6. Statistical analysis .........................................................................................16
2.7. Quality control ..............................................................................................17
Chapter 3: RESULTS AND DISCUSSION ..........................................................18

iii


3.1. Morphological and lethal effects ..................................................................18
3.2. Locomotor defects .........................................................................................29
3.3. Specific transgene expression in living embryos .........................................33
3.4. Reverse transcriptive – qPCR .......................................................................38
Chapter 4: CONCLUSIONS ..................................................................................41
REFERENCES ........................................................................................................43

iv


LIST OF TABLES AND FIGURES
Tables
Table 2-1: List of studied chemicals ................................................................................... 11
Table 2-2: Lethality endpoints ............................................................................................ 13
Table 2-3: Quantitative PCR primer set ............................................................................. 15
Table 3-1: Concentration ranges selected for the main study........................................... 18
Table 3-2: Lethal concentrations, effective concentrations, teratogenic indices, and
typical defects of studied substances .................................................................................. 25

Figures
Figure 1.1: Orthologous genes shared among the zebrafish, human, mouse and chicken
genomes (reprinted from Howe et. al. [33]) ......................................................................... 7
Figure 1.2: Literature analysis using the Scopus database in February 2014 .................. 8
Figure 1.3: Comparisons between the ZET test and the classical acute fish toxicity test
(reprinted from Lammer et. al. [40]) .................................................................................. 10
Figure 2.1: Normal morphological stages of zebrafish development at 28.5 C (photos
excerpted from Kimmel et.al. [39]). Scale bars = 250 M. ................................................ 13
Figure 3.1: Morphological phenotypes in hatched zebrafish larvae ................................ 19
Figure 3.2: Concentration-response curves and frequency of typical phenotypes caused
by tested substances............................................................................................................. 22
Figure 3.3: LC50, EC50 Hill slope values of tested chemicals ......................................... 27
Figure 3.4: Correlation between LC50s resulting from this study and those obtained
using the procedure described in the OECD 236 guideline [59] ...................................... 28
Figure 3.5: Larval motion measurements during the dark/light cycles ........................... 30
Figure 3.6: Comparative analysis of larval activity ........................................................... 31
Figure 3.7: Motoneuron visualisation in 2 dpf hb9:GFP embryos and larvae ................ 33

v


Figure 3.8: Vascularisation in 2 dpf Tg[fli1:EGFP] embryos and larvae ....................... 36
Figure 3.9: Amplification plots of two reference candidates for this study...................... 38
Figure 3.10: Relative expression of five tested genes using ef1α as internal control
(mean  SD) ........................................................................................................................ 39
Figure 3.11: Expression profiles of five substances on the selected genes ...................... 40

vi

ABBREVIATIONS
DCA

3,4-Dichloroaniline

DMSO

Dimethyl sulfoxide

dpf

Day post fertilisation

EtOH

Ethanol

hpf

Hour post fertilisation

MSG

Monosodium glutamate

OECD

Organisation for Economic Co-operation and
Development

PPCPs

Pharmaceuticals and Personal Care Products

qPCR

Quantitative polymerase chain reaction

QY

Quinoline yellow

SB

Sodium Benzoate

TTZ

Tartrazine

ZET

Zebrafish embryo toxicity test

vii


PREFACE
The human population are increasingly exposed to various chemicals whose

beneficial or deleterious properties often remain unexplored. The rising public
concern about hazardous substances existing in foods and consumer products has
forced legislators to tighten chemical management policy that requires extensive
toxicity testing. However, assessment of chemical toxicity is a challenging task,
especially in terms of reliability and efficiency. Ethical issues over the use of animal
testing also add further complication to the task.
The zebrafish (Danio rerio) embryo is an emerging model system for
chemical testing that is attracting scientific and legal attention. Its advantages
including rapid development, high availability, and easy observation have made the
model amenable to high-throughput assays. Moreover, as a complex and
independent organism retaining the “non-animal” status, the zebrafish embryo is the
ideal vertebrate testing model.
Inspired by the promising applications of the zebrafish embryo model in
toxicology research, with the objectives of developing analysis techniques and
applying them in testing of different small molecular compounds, we decided to
carry out the project “Toxicity assessment of small molecules using the zebrafish
as a model system”.

1


Chapter 1: BACKGROUND INFORMATION
1.1. Small molecules: safety concerns
Chemicals have become an integral part of modern daily life. They play an
important role in almost all industries and economic sectors. Consumer goods of our
everyday-use are either containing chemicals, or involving them during production.
Global chemical production has increased from 1 million tonnes in 1930 to 400
million tonnes in 2001 [25], with more than 143,000 substances in the European
market*. It is undeniable that these chemicals are progressively benefiting people’s
life and economy.

However, many chemicals are also posing potential deleterious effects on
human and environment health, especially those with small molecular size (<900
Daltons). Amongst the most well-known examples is the thalidomide scandal which
involved thousands of cases of stillborn and extreme congenital deformity [38], or
the carcinogenic benzene [73] which may have claimed thousands of deaths around
the world. Another case is DDT, the insecticide whose extensive use and high
accumulation have greatly threatened both wildlife species and human health [83].
A common theme in these three instances is that large-scale application of these
chemicals was conducted without having sufficient knowledge on their adverse
impacts, and measures to restrict the uses were taken too late to prevent irreversible
damages.
Ironically, despite efforts to achieve the world governments’ agreement to
use and produce chemicals “…in ways that do not lead to significant adverse effects
on human health and the environment…” by 2020 using scientific assessment
procedures [85], the number of compounds and the complexity of the issue lead to
the situation that unrecognised or unacknowledged toxic compounds in domestic

*

Source: accessed February 2014

2


products are still present. Therefore, the human population are still exposed to a
daily mixture of chemicals whose potential harmful effects remain largely unclear.
1.1.1. Pharmaceuticals and personal care products (PPCPs)
Pharmaceuticals are chemicals used for diagnosis, prevention and treatment
of disease, or improvement of health condition in human and animal. The definition
is extended to excipients and adjuvants included in actual formulations. Personal

care products, including shampoo, cosmetics, and other products formulated for
personal hygiene and beautification, contain a multitude of substances: solvents,
preservatives, disinfectants, fragrances, etc. Sometimes a product may fall in both
categories such as sunscreen or the so-called “dietary supplement”. Humans expose
to PPCPs through everyday activities e.g. bathing, making-up, or essential medical
care. Furthermore, PPCPs can be excreted (mainly pharmaceuticals) or directly
released (personal care products) to the wastewater system and – without
appropriate treatment – introduced to the environment [23, 60, 88], thus becoming
an emerging source of aquatic contaminants [11, 19].
Although designed for a specific mode of action and usually tested for safety,
these compounds can also have numerous effects on nonspecific targets and cause
undesired outcomes, infamously termed “side effects”, in the target organism.
Likewise, non-target organisms can possess receptors or metabolic processes nonhomologous to the target organisms’, hence unexpected effects may result from
unintentional exposure. The problem becomes even more complex when taking
various metabolites and transformation products derived from PPCPs into account.
While it sounds intricate to systematically scrutinise the possible adverse
effect of these compounds on human and environmental health, insufficient
examination prior to market release may turn out to be costly, sometimes deadly.
Severe incidents include the diethylene glycol-containing medicine “Elixir
Sulfanilamide” which claimed 107 deaths in 1937 [8], the preservative benzyl
alcohol which caused neurologic deterioration and death in low-birth-weight infants

3


[12], and the association between the antibiotic chloramphenicol and the so-called
“gray baby syndrome” [7]. On the other hand, there are concerns over hazardous
effects of some PPCP substances upon human health such as the commonly-used
antimicrobial triclosan [18], or the phthalate family of plasticisers [89].
1.1.2. Food additives

Food additives are substances which may intentionally become a component
of food or affect their characteristics. Annual direct consumption of food additives
(excluding common ones such as spices, sugars, salt, honey, pepper, mustard, etc.)
is 5 lbs (approx. 2.27 kg) per person [30]. In Europe, each approved additive is
assigned with an “E number”. Since the 1970s, scientific and public concerns have
arisen surrounding developmental neurotoxic effects of food additives. Various
studies have been conducted to investigate the potential risks of common additives,
especially their relationship with childhood attention deficit hyperactivity disorder
(ADHD) [43, 51]. In the 2000s, two studies drew public attention: The first one was
undertaken by McCann et al. on 297 children (the so-called “Southampton study”)
[51], and demonstrated that consumption of additive mixtures may relate to
hyperactivity in children (two mixtures were used in the study: Mix A included
E102/E110/E122/E124/E211, and Mix B contained E104/E110/E122/E129/E211);
The second one, the “Liverpool study” performed by Lau et. al., showed that
synergistic interaction between food additives (two combinations: E104/E951 and
E133/L-glutamic acid) may affect differentiation and viability of mouse NB2a
neuroblastoma cells in vitro [43].
On the other hand, recent environmental studies revealed that food additives
are also emerging as water contaminants. For instance, the antioxidants butylated
hydroxyanisole (BHA, E320) and butylated hydroxytoluene (BHT, E321) are widely
reported to accumulate in freshwater environments [54] while several sweeteners
are shown to contaminate waste water as well as surface water [42]. Moreover,

4


some substances, such as propyl gallate (E310) [92], are potentially toxic for
aquatic ecosystems.
Internationally, policymakers are still arguing over the threat caused by food
additives and policies for controlling them remain diverse among countries [70].

Nevertheless, there is a common acceptance for monitoring this group of chemicals:
“All food additives must be kept under continuous observation and must be reevaluated whenever necessary in the light of changing conditions of use and new
scientific information" as stated by the European Commission Council [26].
1.1.3. Household chemicals
A large group of everyday toxins originates from household products.
Phthalates [89] occurring in plastic wares, paint, and glue were reported to have
developmental and reproductive toxicity. Bisphenol A (BPA) residues from various
polycarbonate products were shown to have endocrine-disruptive potential, BPA
was outlawed from manufacturing of baby bottles in EU and Canada [49]. Cleaning
agents may contain a pool of solvents, detergents, fragrances, disinfectants, etc.,
many of which may cause allergy, asthma, endocrine disruption, or interfere with
immunological pathways [22, 69].
The substances mentioned above are just some examples of deleterious small
molecules that are posing threats in everyday life. Motivated by uprising concerns
around the safety of these compounds, numerous governmental agencies and nongovernmental organisations have developed their own database of harmful
chemicals: the US-EPA (Environmental Protection Agency) list of Extremely
hazardous substances; the Danish EPA’s List of Undesirable Substances (LOUS);
the SIN (“Substitute it Now”) list by the International Chemical Secretariat; the
European Chemical Agency’s (ECHA) substances of very high concern (SVHC)
list, etc. Themed with “no data, no market”, legislators in the developed world have
set strict chemical management programs requiring thorough multi-level and multimodel toxicity tests [40].

5


1.2. The Zebrafish embryo toxicity test (ZET)
There are a lot of challenges to the chemical toxicity testing strategy in the
21st century [16]. Firstly, the tremendous number of registered chemicals, together
with newly synthesised ones (for instance, the US-NIH’s PubChem database of
small molecules contains over 48 million unique structures*, out of a theoretical

estimation of 1060), requires very fast and high-throughput screening assays [40,
62]. This does not take into account the infinite possible combinations of
compounds, which may cause unpredictable synergistic effects. Secondly, there is
no perfect model available to predict effects on humans while the closest models
(mammals) cannot be used on a large scale due to ethical, practical, and budgetary
issues. In silico and in vitro strategies are limited to one or several aspects and are
not able to represent the entire complexity within a whole organism. Small
invertebrates such as Drosophila or C. elegans are good for high-throughput in vivo
assays, but their body structures and genetic systems are too different from
vertebrates. Adult small vertebrates such as zebrafish (Danio rerio) or medaka
(Oryzias latipes) are good candidates due to their high similarity with higher
animals, however their use may still be ethically questionable.
The zebrafish embryo is a promising toxicology model that may overcome
these difficulties. First, although being a complete and independent life form, the
zebrafish embryo up to the free feeding stage (4~5 days post fertilisation – dpf) is
generally not considered as an animal, hence can be used without raising ethical
issues. Second, zebrafish are easy to maintain and embryo yields are very large (50300 embryo/pair/week). Third, the developmental process of a zebrafish embryo
represents that of other vertebrates with highly similar embryogenesis and
organogenesis, but much faster, which can be observed clearly through the
transparent embryo [39]. Moreover, being among the earliest sequenced and
annotated genomes, the well-known zebrafish genome shows much similarities with
*

Source: accessed February 2014

6


higher vertebrates including human [33], especially in structure and function of
some genes belonging to the CYP family which are involved in drug metabolism in

mammals [74]. Additionally, as an aquatic vertebrate, the zebrafish embryo model
can provide predictive value not only for human health risk but also for ecotoxicity
assessment.

Figure 1.1: Orthologous genes shared among the zebrafish, human, mouse and chicken
genomes (reprinted from Howe et. al. [33])

Therefore, the last two decades have witnessed an exponential increase of
interest in toxicity testing using zebrafish embryos among scientists (Figure 1.2A)
as well as legislators: The International Organization for Standardization (ISO) has
standardized the zebrafish embryo test for waste water quality assessment in 2007
[34], while the Organisation for Economic Co-operation and Development (OECD)
has recently approved the zebrafish embryo toxicity test guidelines (ZET) for
chemical toxicity testing [59]. As can be seen in Figure 1.2B, applications of the
test

cover

many

topics

and

serve

multiple

purposes,

including

Pharmaco/Toxicology, Environmental science, Medicine, Materials science, etc.

7


Figure 1.2: Literature analysis using the Scopus database* in February 2014
A. Numbers of publications from 1990 to 2013 containing the term set (rerio OR
zebrafish OR "zebra fish") AND (embryo* *toxic*) in Title/Abstract/Keywords (1390
in total); B. Relative proportions of these publications categorised by subject areas.
*

www.scopus.com

8


ZET assays can be performed using various endpoints [63, 86], each of
which can be any “...biological or chemical process, response, or effect, assessed by
a test.” [57]. The simplest procedure is survival and morphological observation
during and after chemical exposure at different stages, after which concentrationresponse curves can be created and toxicological indices can be obtained such as
LC50 (median lethal concentration, defined as the chemical concentration required
to kill half of the individuals at the end of the test) or EC50 (half maximal effective
concentration, the concentration at which 50% of the individuals exhibit response).
Obviously, for any chemical, selecting different endpoints will probably result in
different EC50 values.
Additionally, the ZET practitioner can use specific staining procedures to
observe changes in biological processes, such as apoptosis, blood circulation, bone
formation, or oxidative stress, in a whole animal setting [31, 63, 78]. Gene

expression can be assessed by RT-PCR or in situ hybridisation [68, 84], or even at
the whole genome level by microarray or deep sequencing approaches [4].
Immunofluorescent staining can reveal changes in protein translation or
modification [55], while behavioural tests can indicate nerve and musculoskeletal
damage [67]. Moreover, researchers can use transgenic zebrafish lines to study
protein expression and organ formation [6, 44, 91], morpholino antisense injection
is also utilised to study gene function and response [70], advanced in vivo gene
targeting methods such as TALEN and CRISPR [28] are also developed, providing
even more efficient tools for researchers.
Until now, the test is largely employed for screening of chemicals, drugs,
nanomaterial, etc. [63, 78, 80]. Comparison between the ZET test and other
classical or novel tests were also investigated, proving highly correlated data and
predictive value (Figure 1.3) [20, 31, 40]. Various human disease models have been
generated in zebrafish, providing cost-effective systems for drug developers [4, 46].
The ZET test is also combined with other specific methods such as xenografting
[66] to study and screen e.g. anti-cancer drug.

9


Figure 1.3: Comparisons between the ZET test and the classical acute fish toxicity test
(reprinted from Lammer et. al. [40])
Left: relationship between ZET and acute zebrafish toxicity (21 chemicals).
Right: comparison of ZET to acute fish (all OECD species) toxicity for 70 chemicals.

1.3. Aim of this study
This study was conducted to assess toxicity of several small molecules using
the zebrafish embryo as a model system. We aimed to apply a panel of several test
methods, from simple observation of morphological and lethal effects to
behavioural test and assessment of gene expressions, to evaluate toxicity of several

substances representing different physico-chemical properties. Our panel was
designed to focus on embryonic neurobehavioural and vascular development, in
addition to overall toxicity assessment. Tested compounds were selected including
standard ones with known toxicity for validation of our approach, and controversial
food additives that were reported to affect human health.

10


Chapter 2: METHODS
2.1. Substances
Analytical-grade substances of different chemical classes were selected for
this study (Table 2-1). Stock solutions were prepared by dissolving the pure
chemicals in E3 medium then diluted to the desired concentrations in E3 medium.
Table 2-1: List of studied chemicals
Chemical
(other names)

Stock
solution

Company

Chemical formula

Molecular
weight

Common
use

Ethanol
(EtOH)

100 %

VWR
Prolabo

46.07

Solvent

Dimethyl
sulfoxide
(DMSO)

100 %

VWR
Prolabo

78.14

Solvent

3,4Dichloroaniline
(DCA)

50 mg/L

Sigma
Aldrich

162.02

Toxicant
(positive)
control

Sodium
benzoate
(SB, E211)

200 mg/L

Sigma
Aldrich

144.10

Food
preservative

200 g/L

Sigma
Aldrich

187.13

(169.12
nonhydrated*)

Flavouring
enhancer

100 g/L

Sigma
Aldrich

534.36

Food
colouring
agent

200 g/L

Sigma
Aldrich

375.35 to
477.39*

Food
colouring
agent

Monosodium

L-glutamate
(MSG, E621)
monohydrate
Tartrazine
(TTZ, E102)
Quinoline
yellow
(QY, E104)
*

Approximately
calculated
by
/>
11


2.2. Zebrafish maintenance
Adult fish maintenance: Zebrafish wild type strain AB (ZIRC, USA), and
transgenic strains Tg[fli1:EGFP](ZIRC) [44] and Tg[hb9:GFP] [6] were
maintained within the Zebrafish Facility in GIGA-Research, University of Liège.
Fish were reared in a Techniplast recirculating system under 14:10-h light/dark
photocycle.
Breeding: The day before breeding, males and females were placed in
breeding chambers with a separator to prevent undesired spawning. The next
morning, fish were placed in fresh system water and the separator was removed to
allow mating. Eggs were collected after two hours and placed into E3 medium
(5 mM NaCl, 0.17 mM KCl, 0.4 mM CaCl2, and 0.16 mM MgSO4) containing
0.01‰ methylene blue. The point of divider removal and mating start was marked
as zero hour-post-fertilisation (0 hpf), the breeding date was also marked as day

zero (0 dpf)
Embryo sorting: At around 3-4 hpf, eggs were screened under a stereoscope
to remove unfertilised and/or abnormal ones. Healthy embryos that showed normal
cleavage were distributed into 6-well plates at 25 embryos/well for subsequent
experiments.
2.3. Chemical exposure and embryo observation
All test substances were assessed for lethality and developmental toxicity to
zebrafish embryos. After sorting, E3 medium in each well was replaced with test
solution containing the appropriate concentration of test compound in E3 and
incubated at 28C, test solutions were renewed daily until 4 dpf. Before each
renewal, embryos and/or larvae were rinsed twice in E3 and observed under a
stereoscope, all embryonic morphology and lethality were recorded. At 3- and
4 dpf, the larvae were photographed using an SZX10 stereomicroscope coupled
with an XC50 camera (Olympus). Teratogenicity was assessed by determining the
percentage of embryos/larvae with any morphological defect over surviving ones.

12


Phenotypes were compared with those described previously by Kimmel et. al. [39]
(Figure 2.1). A list of lethality endpoints during exposure is shown in Table 2-2.

Figure 2.1: Normal morphological stages of zebrafish development at 28.5 C (photos
excerpted from Kimmel et.al. [39]). Scale bars = 250 M.
Table 2-2: Lethality endpoints

Exposure length
1 day
Coagulated/disintegrated embryo

2 days

3 days

4 days

+

+

+

+

Non-detachment of the tail

+

Lack of heartbeat

+

13


For each substance, a preliminary experiment was carried out to bracket
lethal and teratogenic concentration ranges, followed by the main experiment
testing five to seven concentrations chosen within the defined range.
All experiments were carried out at least in triplicate on n=50 embryo per
test/condition including control. Data was calculated to determine indices such as

median lethal concentrations (LC50), median effective concentration (EC50),
effective concentration 10% (EC10), and the teratogenic index (TI, defined as the
ratio between LC50 and EC50) as well as concentration-response equations.
2.4. Behavioural analysis
Five chemicals were chosen for testing of delayed behavioural effects on 6
dpf zebrafish larvae: EtOH, DMSO, DCA, SB, and MSG. Embryos were exposed to
EC10 of each substance until 4 dpf. Chemicals were then washed away and the
larvae were raised in E3 until 6 dpf. 24 larvae from each test (including control)
were put into individual wells in a 96-well plate and analysed using the ZebraBox
(ViewPoint, Lyon, France). Each larva’s activity (fraction of active time) and
velocity (distance moved per time unit during active phases) were determined
according to the manufacturer’s instruction by recording movement during 30second intervals for 60 minutes of 10/10-min light/dark cycle (three cycles in total).
Each test was performed three times. Activity and velocity data are presented
after normalisation against those of the corresponding control.
2.5. Gene expression analysis
2.5.1. Reverse transcription and quantitative polymerase chain reaction
0 dpf embryos were treated in EC10 of each of five substances: EtOH,
DMSO, DCA, MSG, and SB until 4 dpf, then washed and raised in E3 solution until
6 dpf. One pool of each treatment and control was analysed. Total RNA from 70100 treated or control larvae fixed in Trizol (Invitrogen, Cergy Pontoise, France)

14


was isolated using the RNeasy extraction kit (Qiagen, Venlo, Netherlands) and
measured

using

a

NanoDrop®

ND-1000

Spectrophotometer

(NanoDrop

Technologies). One g RNA per sample was reverse-transcribed using the iScript™
cDNA Synthesis Kit (Bio-Rad, California, USA) in a reaction volume of 20 L.
Table 2-3: Quantitative PCR primer set
Gene

Marking

Forward primer

- actin Housekeeping gene CAGACATCAGGGAGTGATGG
ef1α
hsp70
foxd3

Housekeeping gene ACATGCTGGAGGCCAGCTC
Stress indicator

CCGAAGAGAAGCGACTTGAC

Autonomic nervous
CTTACCTTGGGTTGCTCCAG
system development

mbpa

Myelin sheath

vegfr2

Blood vasculature
and angiogenesis

Reverse primer
ATGGGGTATTTGAGGGTCAG
TACCCTCCTTGCGCTCAATC
GCGATTCCTTTTGGAGAAGAC
TCGATATCCACATCGTCAGC

CCGTCGTGGAGACGTCAA

CGAGGAGAGGACACAAAGCT

TCCACAACTGCTTCCTGATG

CACACGACTCAATGCGTACC

Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit
(Bioline; Meridian Life Science) and the reaction was followed in an ABI PRISM®
7900HT Sequence Detection System (Applied Biosystems). Each reaction was run
in triplicate, consisting of 0.2 L of synthesised cDNA, 0.53 M of each primer and
7.5 µl reaction mix (containing reaction buffer and thermostable polymerase) in a
total volume of 15 L. The thermal cycle was: 2 min at 50°C, 10 min at 95°C and

40 cycles of 15 sec at 95°C and 20 sec at 62°C. A panel of six genes was tested as
described in Table 2-3.
An endogenous reference was selected between two housekeeping genes
based on their amplification profile in the different conditions. Relative
quantification of the other genes was performed using the Ct method [64] and
presented as fold-change in comparison to the untreated control.

15


2.5.2. Transgenic fluorescent lines
Tg[fli1:EGFP] and Tg[hb9:GFP] embryos were exposed to substances from
4 hpf until 2 dpf, then washed and observed under a MZ16FA fluorescent
stereomicroscope (Leica). Each transgene consisted of a promoter (fli1 or hb9)
controlling a fluorescent reporter cDNA and recapitulated the expression of its
corresponding endogenous gene within the organism. Phenotypic images for each
substance were captured under both normal and fluorescent conditions.
2.6. Statistical analysis
Basic and batch-wise calculations for behavioural analysis and Ct method
were performed using Microsoft Excel 2010 tables. All statistical analyses including
regressions and comparison tests were carried out using Graphpad Prism v.5.04 for
Windows.
Percentages of dead/defective embryos were plotted against the logtransformed test concentrations of each substance. Sigmoidal concentrationresponse curves were obtained by fitting those data to the four-parameter equation:

where top and bottom respectively represents the lowest and highest y-value
(%dead/defective), XC50 is either LC50 or EC50 concentration, and HillSlope
describes the steepness of the curve at the inflection point. LC50, EC50 and EC10
values for each substance were extracted from their corresponding equation.
Differences in locomotion/gene expression data between treated and control
groups were confirmed by parametric or non-parametric tests based on normality

test results. When Gaussian requirement was met, one-way ANOVA analysis was
employed, followed by individual t-test between each treated group and the control
group, otherwise non-parametric tests were used. Significance was considered when
P-values were lower than 0.05 for all analyses.

16


2.7. Quality control
Several pools of adult fish were bred individually for each assay. After
sorting, embryos from pools with high fertility (≥80%) were mixed and used for
subsequent experiments. The experiment was validated only when the control
survival rate was ≥90% at 4 dpf. For behavioural tests, only larvae showing no
morphological defect were selected to measure. During cDNA synthesis and qPCR
procedure, each sample was paralleled by a corresponding non-reverse transcriptase
control to check for the presence of contaminating genomic DNA.

17