Methods in enzymology, volume 556

METHODS IN ENZYMOLOGY
Editors-in-Chief

JOHN N. ABELSON and MELVIN I. SIMON
Division of Biology
California Institute of Technology
Pasadena, California

ANNA MARIE PYLE
Departments of Molecular, Cellular and Developmental
Biology and Department of Chemistry Investigator
Howard Hughes Medical Institute
Yale University

Founding Editors

SIDNEY P. COLOWICK and NATHAN O. KAPLAN


Academic Press is an imprint of Elsevier
225 Wyman Street, Waltham, MA 02451, USA
525 B Street, Suite 1800, San Diego, CA 92101–4495, USA
125 London Wall, London, EC2Y 5AS, UK
The Boulevard, Langford Lane, Kidlington, Oxford OX5 1GB, UK
First edition 2015
Copyright © 2015 Elsevier Inc. All rights reserved.
No part of this publication may be reproduced or transmitted in any form or by any means,
electronic or mechanical, including photocopying, recording, or any information storage and
retrieval system, without permission in writing from the publisher. Details on how to seek
permission, further information about the Publisher’s permissions policies and our
arrangements with organizations such as the Copyright Clearance Center and the Copyright

Licensing Agency, can be found at our website: www.elsevier.com/permissions.
This book and the individual contributions contained in it are protected under copyright by
the Publisher (other than as may be noted herein).
Notices
Knowledge and best practice in this field are constantly changing. As new research and
experience broaden our understanding, changes in research methods, professional practices,
or medical treatment may become necessary.
Practitioners and researchers must always rely on their own experience and knowledge in
evaluating and using any information, methods, compounds, or experiments described
herein. In using such information or methods they should be mindful of their own safety and
the safety of others, including parties for whom they have a professional responsibility.
To the fullest extent of the law, neither the Publisher nor the authors, contributors, or editors,
assume any liability for any injury and/or damage to persons or property as a matter of
products liability, negligence or otherwise, or from any use or operation of any methods,
products, instructions, or ideas contained in the material herein.
ISBN: 978-0-12-801521-6
ISSN: 0076-6879
For information on all Academic Press publications
visit our website at store.elsevier.com


CONTRIBUTORS
Roslin J. Adamson
Biomembrane Structure Unit, Department of Biochemistry, University of Oxford, Oxford,
United Kingdom
Susana Andrade
Institute for Biochemistry, and BIOSS Centre for Biological Signalling Studies,
Albert-Ludwigs-University Freiburg, Freiburg im Breisgau, Germany
Tonia Aristotelous
Division of Biological Chemistry and Drug Discovery, College of Life Sciences, University

of Dundee, Dundee, United Kingdom
Aidin R. Balo
Department of Biochemistry, University of Toronto, Toronto, Ontario, Canada
Jeffrey M. Becker
Microbiology Department, University of Tennessee
Imre Berger
School of Biochemistry, University of Bristol, Bristol, United Kingdom; European
Molecular Biology Laboratory, and Unit for Virus Host-Cell Interactions, University of
Grenoble Alpes-EMBL-CNRS, Unite´ mixte de Recherche, Grenoble, France
Frank Bernhard
Institute of Biophysical Chemistry, Centre for Biomolecular Magnetic Resonance, J.W.
Goethe-University, Frankfurt-am-Main, Germany
Nicolas Bertheleme
Department of Life Sciences, Imperial College London, London, United Kingdom
Rajinder P. Bhullar
Department of Oral Biology, College of Dentistry, University of Manitoba, Winnipeg,
Manitoba, Canada
Kory M. Blocker
Department of Chemical and Biomolecular Engineering, Tulane University, New Orleans,
Louisiana, USA
Christoph Boes
The Medical Research Council, Mitochondrial Biology Unit, Cambridge, United Kingdom
Mathieu Botte
European Molecular Biology Laboratory, and Unit for Virus Host-Cell Interactions,
University of Grenoble Alpes-EMBL-CNRS, Unite´ mixte de Recherche, Grenoble, France
Zachary T. Britton
Department of Chemical and Biomolecular Engineering, University of Delaware, Newark,
Delaware, USA

xv

xvi

Contributors

Bernadette Byrne
Department of Life Sciences, Imperial College London, London, United Kingdom
Nico Callewaert
Unit of Medical Biotechnology, Department of Medical Protein Research; Inflammation
Research Center, VIB-UGhent, and Department of Biochemistry and Microbiology,
Laboratory for Protein Biochemistry and Biomolecular Engineering, Ghent University,
Ghent, Belgium
Lydia N. Caro
Department of Biochemistry, University of Toronto, Toronto, Ontario, Canada
Raja Chakraborty
Department of Oral Biology, College of Dentistry, and Biology of Breathing Group,
Children’s Hospital Research Institute of Manitoba, University of Manitoba, Winnipeg,
Manitoba, Canada
Prashen Chelikani
Department of Oral Biology, College of Dentistry, and Biology of Breathing Group,
Children’s Hospital Research Institute of Manitoba, University of Manitoba, Winnipeg,
Manitoba, Canada
Katrien Claes
Unit of Medical Biotechnology, Department of Medical Protein Research; Inflammation
Research Center, VIB-UGhent, and Department of Biochemistry and Microbiology,
Laboratory for Protein Biochemistry and Biomolecular Engineering, Ghent University,
Ghent, Belgium
Benjamin Cle´menc¸on
Institute of Biochemistry and Molecular Medicine (IBMM), and Swiss National Centre of

Competence in Research (NCCR) TransCure, University of Bern, Bern, Switzerland
Ian Collinson
School of Biochemistry, University of Bristol, Bristol, United Kingdom
Patricia M. Dijkman
Biomembrane Structure Unit, Department of Biochemistry, University of Oxford, Oxford,
United Kingdom
Simon Dowell
Department of Molecular Discovery Research, GlaxoSmithKline, Hertfordshire,
United Kingdom
Volker D€
otsch
Institute of Biophysical Chemistry, Centre for Biomolecular Magnetic Resonance,
J.W. Goethe-University, Frankfurt-am-Main, Germany
Ashvini K. Dubey
National Centre for Biological Sciences, TIFR, Bangalore, and Department of
Biotechnology, University of Mysore, Mysore, India


Contributors

xvii

Oliver Einsle
Institute for Biochemistry, and BIOSS Centre for Biological Signalling Studies,
Albert-Ludwigs-University Freiburg, Freiburg im Breisgau, Germany
Matthias Elgeti
Institut f€
ur Medizinische Physik und Biophysik (CC2), Charite´-Universita¨tsmedizin Berlin,
Berlin, Germany
Oliver P. Ernst

Department of Biochemistry, and Department of Molecular Genetics, University of
Toronto, Toronto, Ontario, Canada
Klaus Fendler
Department of Biophysical Chemistry, Max Planck Institute of Biophysics, Frankfurt am
Main, Germany
James D. Fessenden
Department of Anesthesia, Perioperative and Pain Medicine, Brigham and Women’s
Hospital, Boston, Massachusetts, USA
Michael Fine
Institute of Biochemistry and Molecular Medicine (IBMM), and Swiss National
Centre of Competence in Research (NCCR) TransCure, University of Bern, Bern,
Switzerland
Eshan Ghosh
Department of Biological Sciences and Bioengineering, Indian Institute of Technology,
Kanpur, India
Ashwini Godbole
National Centre for Biological Sciences, TIFR, Bangalore, India
Alan D. Goddard
School of Life Sciences, University of Lincoln, Lincoln, United Kingdom
Adrian Goldman
Department of Biochemistry, Helsinki University, Helsinki, Finland, and School of
Biomedical Sciences, Faculty of Biological Sciences, University of Leeds, Leeds,
United Kingdom
Mouna Guerfal
Unit of Medical Biotechnology, Department of Medical Protein Research; Inflammation
Research Center, VIB-UGhent, and Department of Biochemistry and Microbiology,
Laboratory for Protein Biochemistry and Biomolecular Engineering, Ghent University,
Ghent, Belgium
Yvonne Hackmann
Biochemistry Center, Heidelberg University, Heidelberg, Germany

Matthias A. Hediger
Institute of Biochemistry and Molecular Medicine (IBMM), and Swiss National Centre of
Competence in Research (NCCR) TransCure, University of Bern, Bern, Switzerland


xviii

Contributors

Erik Henrich
Institute of Biophysical Chemistry, Centre for Biomolecular Magnetic Resonance,
J.W. Goethe-University, Frankfurt-am-Main, Germany
Peter W. Hildebrand
Institut f€
ur Medizinische Physik und Biophysik (CC2), Charite´-Universita¨tsmedizin Berlin,
Berlin, Germany, and AG ProteInformatics
Franz Y. Ho
Department of Biochemistry, Groningen Biomolecular Sciences and Biotechnology Institute
& Zernike Institute for Advanced Materials, University of Groningen, Groningen, The
Netherlands
Klaus Peter Hofmann
Institut f€
ur Medizinische Physik und Biophysik (CC2), Charite´-Universita¨tsmedizin Berlin,
and Zentrum f€
ur Biophysik und Bioinformatik, Humboldt-Universita¨t zu Berlin, Berlin,
Germany
Andrew L. Hopkins
Division of Biological Chemistry and Drug Discovery, College of Life Sciences, University
of Dundee, Dundee, United Kingdom
Veli-Pekka Jaakola

Novartis Institutes of Biomedical Research, Basel, Switzerland
Lisa Joedicke
Biochemistry Center, Heidelberg University, Heidelberg, Germany
Zachary Lee Johnson
Department of Biochemistry, Duke University Medical Center, Durham, North Carolina,
USA
Martin S. King
The Medical Research Council, Mitochondrial Biology Unit, Cambridge, United Kingdom
Joanna Komar
School of Biochemistry, University of Bristol, Bristol, United Kingdom
Punita Kumari
Department of Biological Sciences and Bioengineering, Indian Institute of Technology,
Kanpur, India
Edmund R.S. Kunji
The Medical Research Council, Mitochondrial Biology Unit, Cambridge, United
Kingdom
Wei L€
u
Institute for Biochemistry, Albert-Ludwigs-University Freiburg, Freiburg im Breisgau,
Germany
Michael Lafontaine
Department of Structural Biology, Institute of Biophysics and Center of Human and
Molecular Biology (ZHMB), Saarland University, Homburg, Germany


Contributors

xix

C. Roy D. Lancaster

Department of Structural Biology, Institute of Biophysics and Center of Human and
Molecular Biology (ZHMB), Saarland University, Homburg, Germany
Seok-Yong Lee
Department of Biochemistry, Duke University Medical Center, Durham, North Carolina,
USA
Zhijie Li
Department of Biochemistry, University of Toronto, Toronto, Ontario, Canada
Kenneth Lundstrom
PanTherapeutics, Lutry, Switzerland
Mohana Mahalingam
Department of Anesthesia, Perioperative and Pain Medicine, Brigham and Women’s
Hospital, Boston, Massachusetts, USA
M.K. Mathew
National Centre for Biological Sciences, TIFR, Bangalore, India
Patrick M. McNeely
Department of Chemical and Biomolecular Engineering, University of Delaware, Newark,
Delaware, USA
Rohan Mitra
National Centre for Biological Sciences, TIFR, Bangalore, India
Christophe J. Moreau
Institut de Biologie Structurale (IBS), University of Grenoble Alpes; CNRS, IBS, LabEx
ICST, and CEA, IBS, Grenoble, France
Fred Naider
Chemistry Department, College of Staten Island, City University of New York
Andrea N. Naranjo
Department of Chemical and Biomolecular Engineering, University of Delaware, Newark,
Delaware, USA
Iva Navratilova
Division of Biological Chemistry and Drug Discovery, College of Life Sciences, University
of Dundee, Dundee, United Kingdom

Kumari Nidhi
Department of Biological Sciences and Bioengineering, Indian Institute of Technology,
Kanpur, India
Katarzyna Niescierowicz
Institut de Biologie Structurale (IBS), University of Grenoble Alpes; CNRS, IBS, LabEx
ICST, and CEA, IBS, Grenoble, France
Chikwado A. Opefi
Department of Biological Sciences, University of Essex, Colchester, Essex, United Kingdom


xx

Contributors

Vale´rie Panneels
Biochemistry Center, Heidelberg University, Heidelberg, Germany
Bert Poolman
Department of Biochemistry, Groningen Biomolecular Sciences and Biotechnology Institute
& Zernike Institute for Advanced Materials, University of Groningen, Groningen, The
Netherlands
Palakolanu S. Reddy
National Centre for Biological Sciences, TIFR, Bangalore, India
Philip J. Reeves
Department of Biological Sciences, University of Essex, Colchester, Essex, United Kingdom
Rosana Ina´cio dos Reis
Biomembrane Structure Unit, Department of Biochemistry, University of Oxford, Oxford,
United Kingdom
Jean Revilloud
Institut de Biologie Structurale (IBS), University of Grenoble Alpes; CNRS, IBS, LabEx
ICST, and CEA, IBS, Grenoble, France

James M. Rini
Department of Biochemistry, and Department of Molecular Genetics, University of
Toronto, Toronto, Ontario, Canada
Anne S. Robinson
Department of Chemical and Biomolecular Engineering, Tulane University, New Orleans,
Louisiana, and Department of Chemical and Biomolecular Engineering, University of
Delaware, Newark, Delaware, USA
Adriana Rycovska-Blume
Department of Biophysical Chemistry, Max Planck Institute of Biophysics, Frankfurt am
Main, Germany
Tuulia Saarenpa¨a¨
Department of Biochemistry, Helsinki University, Helsinki, Finland
Christiane Schaffitzel
School of Biochemistry, University of Bristol, Bristol, United Kingdom; European
Molecular Biology Laboratory, and Unit for Virus Host-Cell Interactions, University of
Grenoble Alpes-EMBL-CNRS, Unite´ mixte de Recherche, Grenoble, France
Patrick Scheerer
Institut f€
ur Medizinische Physik und Biophysik (CC2), Charite´-Universita¨tsmedizin Berlin,
Berlin, Germany, and AG Protein X-ray Crystallography & Signal Transduction
Philipp Schneider
Institute of Biochemistry and Molecular Medicine (IBMM), and Swiss National Centre of
Competence in Research (NCCR) TransCure, University of Bern, Bern, Switzerland
Arun K. Shukla
Department of Biological Sciences and Bioengineering, Indian Institute of Technology,
Kanpur, India


Contributors

xxi

Shweta Singh
Department of Life Sciences, Imperial College London, London, United Kingdom
Irmgard Sinning
Biochemistry Center, Heidelberg University, Heidelberg, Germany
Steven O. Smith
Department of Biochemistry and Cell Biology, Stony Brook University, Stony Brook,
New York, USA
Martha E. Sommer
Institut f€
ur Medizinische Physik und Biophysik (CC2), Charite´-Universita¨tsmedizin Berlin,
Berlin, Germany
Randy B. Stockbridge
Department of Biochemistry, Howard Hughes Medical Institute, Brandeis University,
Waltham, Massachusetts, USA
Michal Szczepek
Institut f€
ur Medizinische Physik und Biophysik (CC2), Charite´-Universita¨tsmedizin Berlin,
Berlin, Germany
Dale Tranter
Department of Biological Sciences, University of Essex, Colchester, Essex, United Kingdom
Ming-Feng Tsai
Department of Biochemistry, Howard Hughes Medical Institute, Brandeis University,
Waltham, Massachusetts, USA
Ned Van Eps
Department of Biochemistry, University of Toronto, Toronto, Ontario, Canada
Michel Vivaudou
Institut de Biologie Structurale (IBS), University of Grenoble Alpes; CNRS, IBS, LabEx
ICST, and CEA, IBS, Grenoble, France

Anthony Watts
Biomembrane Structure Unit, Department of Biochemistry, University of Oxford, Oxford,
United Kingdom
Bing Xu
Department of Oral Biology, College of Dentistry, and Biology of Breathing Group,
Children’s Hospital Research Institute of Manitoba, University of Manitoba, Winnipeg,
Manitoba, Canada
Carissa L. Young
Department of Chemical and Biomolecular Engineering, University of Delaware, Newark,
Delaware, USA


PREFACE
Integral membrane proteins constitute a significant portion of the entire proteome in different organisms. They mediate a wide range of signal recognition and communication processes across the cell membranes. These
proteins are one of the most important classes of drug targets, and more than
half of the currently marketed drugs are aimed at membrane proteins. In
spite of their crucial physiological roles, structural characterization, especially high-resolution structure determination, of membrane proteins lags
significantly behind that of soluble proteins. There are numerous challenges
encountered at every step in the process of membrane protein crystallography such as recombinant protein expression, homogenous purification, and
crystallization. These two volumes of Methods in Enzymology aim to provide
a comprehensive coverage of various steps involved in the process of membrane protein structural characterization through general protocols and case
examples.
The very first step in the process of structural studies of membrane proteins is their recombinant expression in heterologous hosts for large-scale
protein production. In Section I of Volume I, we provide a collection of
chapters that describe either a step-by-step protocol or a general overview
for recombinant expression of various types of membrane proteins in different expression hosts. These chapters cover recent advances in conventional
E. coli-based expression of membrane proteins, yeast-based expression systems for large-scale production of eukaryotic membrane proteins, and cell
culture-based membrane protein overexpression in insect cells and mammalian cells. Furthermore, several chapters in this section also discuss relatively
uncommon but promising strategies for expressing membrane proteins, e.g.,
Drosophila melanogaster, Xenopus oocytes, and Wolinella succinogenes.

Biochemical and functional characterization of recombinant membrane
proteins is important to ensure their native-like behavior before structural
studies can be undertaken. Section II of Volume I encompasses several chapters
that cover various methods for characterizing membrane proteins such as
reconstitution in lipid environment, cross-linking, fluorescence, and
spectroscopy-based approaches to investigate conformational changes and surface plasmon resonance-based strategies to study ligand–protein interactions.
Once the recombinant membrane protein expression has been
established and functional characterization reveals native-like properties,
xxiii


xxiv

Preface

the next steps are to solubilize and purify them efficiently in functional
forms. In Section I of Volume II, we present a collection of chapters that
provide generally applicable protocols and discussions on efficient solubilization and purification of recombinant membrane proteins. One of the
major challenges in membrane protein crystallization is their conformational
flexibility and limited polar surface area to make crystal contacts. In
Section II of Volume II, three chapters describe general protocols and successful examples of generating antibody fragments against membrane proteins using phage display technology to address these challenges.
Although crystallography of membrane proteins provides highresolution structural information, it yields only a static snapshot of the protein architecture. Therefore, dynamic studies of membrane proteins are
highly invaluable to obtain a complete understanding of their function.
Chapters 13–16 in Section III of Volume II highlight various biophysical
approaches such as electron paramagnetic resonance and nuclear magnetic
resonance methodologies that yield dynamic insights into the structure
and function of membrane proteins.
One of the major goals in membrane protein structural studies is their
crystallization for high-resolution structure determination by X-ray crystallography. Chapters 17–22 in Section IV of Volume II present streamlined
protocols and discussions on various methods for protein crystallization

including a case example of protein crystallography by X-ray free-electron
laser, the latest development in the area of protein crystallography.
Similar to dynamic methodologies, computational approaches can also
provide extremely valuable insights into membrane protein functions. In
Section V of Volume II, authors present case examples of computational
approaches that were applied to better understand three different classes
of membrane proteins.
Overall, these two volumes provide an extensive and unique coverage of
various aspects in membrane protein studies and they will be extremely useful to researchers engaged in the area of membrane proteins.
ARUN K. SHUKLA


CHAPTER ONE

Engineering Escherichia coli for
Functional Expression of
Membrane Proteins
Franz Y. Ho, Bert Poolman1
Department of Biochemistry, Groningen Biomolecular Sciences and Biotechnology Institute & Zernike
Institute for Advanced Materials, University of Groningen, Groningen, The Netherlands
1
Corresponding author: e-mail address:

Contents
1. Introduction
1.1 Green fluorescent protein as a folding reporter
1.2 Antibiotic resistance marker protein for selection
2. Preparation of Erythromycin-Sensitive E. coli Strain
3. Preparation of Expression Plasmid
3.1 Construction of expression vector for target protein–GFP–ErmC fusion

3.2 Expression test
4. Selecting Cells for Better Expression
5. Characterizing Evolved Strains
5.1 Basic characterizations
5.2 Plasmid curing
5.3 Functional assays
6. Summary
Acknowledgments
References

4
6
7
8
10
10
11
14
15
15
16
16
17
18
18

Abstract
A major bottleneck in the characterization of membrane proteins is low yield of functional protein in recombinant expression. Microorganisms are widely used for recombinant protein production, because of ease of cultivation and high protein yield.
However, the target proteins do not always obtain their native conformation and
may end up in a nonfunctional state, in insoluble aggregates. For screening of functional

protein, it is thus important to readily discriminate aggregated, mistargeted protein
from globally well-folded, membrane-inserted protein. We developed a robust strategy
for expression screening of functional proteins in bacteria, which is based on directed
evolution. In this strategy, the C-terminus of the target membrane protein is tagged
with two additional protein domains in tandem. The first one is green fluorescent protein (GFP), which functions as a reporter of the global folding state of the fusion protein.
The other one is the erythromycin resistance protein (23S ribosomal RNA adenine N-6
Methods in Enzymology, Volume 556
ISSN 0076-6879
/>
#

2015 Elsevier Inc.
All rights reserved.

3


4

Franz Y. Ho and Bert Poolman

methyltransferase, ErmC), which confers a means to select for enhanced expression. By
gradually increasing the antibiotic concentration in the medium, we force the cells to
evolve in a way that allows more functional target-GFP–ErmC to be expressed. The
acquired genomic mutations can be generic or membrane protein specific. This strategy is readily adopted for the expression of any protein and ultimately yields a wealth of
genomic data that may provide insight into the factors that limit the production of
given classes or types of proteins.

1. INTRODUCTION
Integral membrane proteins contribute 15–30% of the open-reading

frames found in the genomes of organisms from all domains of life
(Bendtsen, Binnewies, Hallin, & Ussery, 2005; Wallin & von Heijne,
1998). However, our understanding of function–structure relationships of
membrane proteins is low compared to water-soluble proteins (Granseth,
Seppa¨la¨, Rapp, Daley, & Von Heijne, 2007). There are many difficulties
in studying membrane proteins, and the challenge already starts with the
expression of the genes and production of the proteins in a functional state.
Recombinant expression in heterologous hosts is the most versatile strategy,
but difficult to produce proteins often cause toxicity to the cells and end up
themselves in insoluble aggregates (Bill et al., 2011). Expression conditions
can be optimized but this is a laborious process (Francis & Page, 2010).
Large-scale production of proteins is commonly achieved using microorganisms, because of the ease of growth and many genetic and biochemical
tools are available. Several factors determine the production level and functionality of the proteins, such as (i) the toxicity the proteins evoke to the host
cells (Wagner et al., 2007), (ii) the posttranslational modifications required
for structure and/or functionality (Grisshammer & Tate, 1995), (iii) the difference in codon usage between the recombinant gene and the expression
host (Angov, Hillier, Kincaid, & Lyon, 2008), (iv) limitations of protein synthesis precursors such as tRNA and amino acids (Marreddy et al., 2010; Puri
et al., 2014), (v) overloading of foldase and chaperone activities (Tate,
Whiteley, & Betenbaugh, 1999), (vi) saturation of the membrane protein
insertion machinery (Loll, 2003; Wagner, Bader, Drew, & de Gier,
2006), and (vii) uncoordinated protein biosynthesis kinetics (Bill et al.,
2011; De Marco, 2013). Membrane proteins have a complex biogenesis
pathway, requiring chaperones and machineries for membrane insertion,
protein folding, and oligomerization, but often the limiting factor(s)
leading to low or nonfunctional expression is not understood. Rather than


Engineering Escherichia coli for Functional Expression

5

screening numbers of expression conditions, it is easier to improve the production by evolving the host.
In this method, we describe a simple procedure for engineering
Escherichia coli by forcing the cells to produce more desired protein by fusing
a folding indicator and antibiotic resistance marker to its C-terminus
(Fig. 1A). The same strategy has been proven successful for the overexpression of membrane proteins in both the Gram-positive bacterium
Lactococcus lactis and the Gram-negative bacterium E. coli (Gul, Linares,
Ho, & Poolman, 2014; Linares, Geertsma, & Poolman, 2010).

A

B

25

50

20

45

ErmC
GFP

40

15

35

10

30
5
25
0

C

10

−5

10

−4

−3

10

L-Arabinose

C

D
L-Arabinose

(% w/v)
−3
−2

10−5 10−4 10

10

Fluorescence (a.u.)

N

Lactose transport activity
(nmol per mg protein per min)

Target protein

L-Arabinose

2.0 × 10 −5 2.0 × 10 −4

10

−2

−1

0

10

(% w/v)

(% w/v)

1.0 × 10 −3 1.5 × 10 −3 4.0 × 10 −3 2.0 × 10 −1

10−1

In-gel
fluorescence

Anti-His
immunoblot

Figure 1 (A) Cartoon of fusion protein used for strain selection. The folding reporter GFP
and the selection marker encoding the 23S ribosomal RNA adenine N-6methyltransferase (ErmC) are fused in tandem at the C-terminus of the target membrane protein. N and C indicate the N- and C-terminus of the fusion protein.
(B) Transport activity of LacSΔIIA fused with GFP in E. coli MC1061 cells. The expression
of LacSΔIIA was controlled by the concentration of L-arabinose. (C) Expression of
LacSΔIIA–GFP fusion was analyzed by SDS-PAGE. Upper panel: in-gel fluorescence;
lower panel: anti-His immunoblot. White and black arrows indicate the folded and
misfolded fusion protein, respectively. (D) Confocal microscopy images of E. coli
MC1061 cells expressing LacSΔIIA–GFP to different levels; the L-arabinose concentration
is indicated above the panels. Upper panel: close-up of cells to indicate the distribution
of the fluorescence (scale bar, 2 μm). Lower panel: overview of the culture (scale
bar, 10 μm). Panels (B–D) are modified with permission from Geertsma, Groeneveld,
Slotboom, and Poolman (2008); copyright (2008) by the National Academy of Sciences USA.


6

Franz Y. Ho and Bert Poolman

1.1 Green fluorescent protein as a folding reporter
Protein folding can start right after the nascent chain is formed, but in case of
membrane proteins, it is delayed as translation and membrane insertion are
coupled and folding is completed after the last transmembrane segments have
left the translocon (Luirink, von Heijne, Houben, & de Gier, 2005). In multidomain proteins, domains are tethered by either structured or disordered
linkers and the rate of folding of individual domains can differ (Arviv &
Levy, 2012; George & Heringa, 2002; Jappelli, Luzzago, Tataseo,
Pernice, & Cesareni, 1992; Zhang & Ignatova, 2009). In the present method,
green fluorescent protein (GFP) is used as a global folding reporter, which
requires fusion of the fluorescent protein to the C-terminus of the target
membrane protein. Thus, the synthesis of the membrane protein precedes
that of the fluorescent protein. The folding of a membrane protein is typically
faster than the folding and maturation of GFP, which takes about 30–90 min
(Evdokimov et al., 2006; Reid & Flynn, 1997; Waldo, Standish,
Berendzen, & Terwilliger, 1999). Therefore, when the target membrane
protein is misfolded, it is likely to drag the not yet fully synthesized, folded,
and/or matured GFP into an aggregated state. In contrast, when the target
membrane protein is properly folded, the GFP β-barrel is formed and the
chromophore will mature. Proper folding of the protein protects the chromophore from quenching by water dipoles, paramagnetic oxygen, or
cis–trans isomerization (Tsien, 1998). The maturation process involves a
series of covalent rearrangements of the amino acids that form the tripeptide
chromophore (Ser/Thr65, Tyr66, and Gly67) within an α-helix that is
buried inside the hollow β-barrel. When the chromophore matures, GFP
becomes SDS resistant, and the protein migrates faster in SDS-PAA than
the fully denatured polypeptide. The apparent difference in migration is
about 10 kDa, and this difference is also observed when GFP is fused to
another protein (Geertsma, Groeneveld, et al., 2008). Thus, when a membrane protein is well folded, the C-terminal GFP will fully mature, and the
whole fusion protein migrates faster on SDS-PAA than the misfolded membrane protein–GFP fusion. By analyzing protein expression on immunoblots, one can easily discriminate the well-folded and misfolded proteins
(Drew, Lerch, Kunji, Slotboom, & de Gier, 2006; Geertsma, Groeneveld,
et al., 2008). Moreover, the fluorescence reports the absolute amount of

folded fusion protein, which can be observed not only in gel but also
in vivo (Drew et al., 2006; Linares et al., 2010).
We and others have observed that the in vivo activity of transport proteins
correlates with the corresponding in-cell and in-gel GFP fluorescence of the


Engineering Escherichia coli for Functional Expression

7

fusion proteins (Geertsma, Groeneveld, et al., 2008; Hibi et al., 2008;
Schlegel et al., 2012). In brief, the glutamate transporter GltP from E. coli
and lactose transporter LacSΔIIA from Streptococcus thermophilus have been
fused to the N-terminus of GFP and expressed in E. coli. The measured
transport rate of glutamate or lactose matches the GFP fluorescence intensity
both in vivo and in SDS-PAA gels (Fig. 1), which is observed over a wide
range of expression levels (Geertsma, Groeneveld, et al., 2008). This indicates that the fluorescence intensity of GFP can be used as a read-out of the
in vivo activity of the target membrane protein. However, since the chromophore maturation requires aerial oxygen, the culture has to be well aerated
when the protein is being expressed (see figure 1C in Linares et al., 2010).
We emphasize that the fluorescence of GFP reports the global folding of the
target molecule, but the membrane-inserted protein is not necessarily functional in every aspect. Factors like final folding steps, oligomerization, membrane lipid composition, and others can impact the observed activity
(Grisshammer & Tate, 1995).

1.2 Antibiotic resistance marker protein for selection
One of the key features of our strain engineering system is the tagging of the
target membrane protein–GFP fusion with an antibiotic resistance marker at
the C-terminus. Thereby, cells expressing folded, membrane-inserted, fluorescent fusion protein have a growth advantage when cultivated in the presence of the antibiotic. We have tested several antibiotic resistance markers,
such as chloramphenicol acetyltransferase, tetracycline efflux protein,
aminoglycoside phosphotransferase, and 23S ribosomal RNA adenine
N-6-methyltransferase (ErmC). Of these antibiotic resistance markers, the

water-soluble ErmC has the most favorable properties and did not strongly
affect the expression or activity of the membrane proteins to which it was
fused. Contrary to ErmC, all the other antibiotic resistance markers function
as oligomers, which is likely to impact the protein to which they are fused
(Gul et al., 2014).
Proteome-wide topology studies in E. coli and S. cerevisiae indicate that
$80% of the integral membrane proteins have their C-termini at the cytosolic side (Cin topology) (Daley et al., 2005; Kim, Mele´n, Osterberg, & Von
Heijne, 2006; Von Heijne, 2006). Our strategy of using GFP as folding
reporter and ErmC to select for increased expression is not readily applicable
to proteins with the C-terminus on the outside, since GFP is not fluorescent
when localized in the periplasm of, e.g., E. coli. The localization of the


8

Franz Y. Ho and Bert Poolman

C-terminus of the target protein is readily predicted by various online protein topology prediction programs (Bernsel et al., 2008; Hennerdal &
Elofsson, 2011). Thus, our selection system is based on expressing membrane protein fused with C-terminal inside GFP and ErmC.

2. PREPARATION OF ERYTHROMYCIN-SENSITIVE
E. COLI STRAIN
Compared to Gram-positive bacteria such as L. lactis, enterobacteriaceae
including E. coli are intrinsically resistant to erythromycin (Andremont,
Gerbaud, & Courvalin, 1986). Therefore, we engineered the erythromycin sensitivity of the MC1061 strain by knocking out the acriflavine resistance B (acrB) gene. AcrB is a member of the resistance nodulation cell
division (RND) superfamily and forms the AcrAB-TolC tripartite drug
efflux system. It recognizes a wide variety of toxic compounds, including
antibiotics, and transports these compounds out of the cell (Pos, 2009;
Tal & Schuldiner, 2009). In our initial experiments, we used drug efflux
mutants prepared in the BW25113 strain (Gul et al., 2014). However,

E. coli MC1061 (araD139, Δ(araA-leu)7697, ΔlacX74, galUÀ, galKÀ, hsrÀ,
hsm+, strA; Casadaban & Cohen, 1980) is generally a better host for membrane protein expression, and thus we inactivated acrB gene in this strain by
targeted gene knock-out.
Gene inactivation can be achieved by various methods. We used the
recombination-mediated genetic engineering method (recombineering)
to create E. coli MC1061ΔacrB, which is simple and efficient for introducing
site-specific mutations. It utilizes the bacteriophage λ homologous recombination proteins, called RED, to modify the genome of E. coli by using linear double-stranded (ds) DNA fragments of around 50 nucleotides that are
homologous to the target locus (Datsenko & Wanner, 2000). Here, we
describe the background and procedure of “recombineering” briefly; for
the detailed protocol, we refer to Sawitzke et al. (2007) and Thomason,
Sawitzke, Li, Costantino, and Court (2014).
Primer sequences (Table 1) for amplification of the DNA fragment, used
for knocking out the acrB coding sequence, are designed according to Baba
et al. (2006). Capital letters in the primer sequences are complementary to
the sequences adjacent to the chromosomal acrB, while the small letters are
sequences priming to pKD13. This plasmid carries a kanamycin resistance
gene cassette flanked by Flp recognition targets (FRT) at both ends, which
is recognized by yeast Flp recombinase (Datsenko & Wanner, 2000). Using


Engineering Escherichia coli for Functional Expression

9

Table 1 Primers for inactivation of acrB gene
Primer
Sequence (50 to 30 )

Forward

TTACGCGGCCTTAGTGATTACACGTTGTATCAATGAT
GATCGACAGTATGgtgtaggctggagctgcttc

Reverse

TCAGCCTGAACAGTCCAAGTCTTAACTTAAACAGGAG
CCGTTAAGACATGctgtcaaacatgagaattaa

the primers listed in Table 1, the PCR-amplified DNA fragment for
recombineering contains the kanamycin resistance marker gene flanked
by FRT sites, with 50-nucleotide-long extensions corresponding to
upstream and downstream of the chromosomal acrB coding region. After
replacing the acrB gene by the FRT-flanked kanamycin resistance gene cassette, one can remove the marker by temporally expressing Flp to excise it
from the genome, leaving only a short sequence of FRT as a scar. In principle, any antibiotic resistance gene without FRT sequences can be used for
replacing the genomic sequence, if removal of the antibiotic marker is
unnecessary (Sawitzke et al., 2007).
1. Transform pKD46 in E. coli MC1061; pKD46 is a temperature-sensitive
plasmid with coding sequences for λ RED proteins.
2. Grow the transformed cells at 30 °C and shake the culture at 200 rpm.
Induce the expression of λ RED proteins by the addition of 0.2% (w/v)
L-arabinose.
3. Collect cells during mid-log phase and prepare electrocompetent cells.
4. Amplify the DNA fragment by PCR that corresponds to the acrB locus.
5. Transform the cells with the amplified DNA fragment by
electroporation.
6. Select colonies on LB agar supplemented with 25 μg/ml kanamycin and
confirm the genome modification by colony PCR.
7. Remove pKD46 plasmid by growing the cells on nonselective medium
(LB agar without antibiotics) at 37 °C.
8. Test the erythromycin sensitivity of the parent and ΔacrB strain; the recommended concentration range is 1–500 μg/ml.

E. coli MC1061 grows normal up to 100 μg/ml of erythromycin, whereas
the ΔacrB strain is already sensitive at 5 μg/ml; other strains may have different erythromycin sensitivity. If the growth of ΔacrB cells in the presence
of 5 μg/ml erythromycin is minimal after overnight incubation, the strain
can be used for host evolution (Gul et al., 2014). Erythromycin sensitivity
of MC1061 before and after acrB inactivation is shown in Fig. 2.


10

Fraction of surviving cells

Franz Y. Ho and Bert Poolman

Erythromycin (µg/ml)

Figure 2 Sensitivity of E. coli strain MC1061 to erythromycin before and after inactivation of the acrB gene. Open squares: MC1061; black rhombus: MC1061ΔacrB. The error
bars show standard deviation (SD) from three independent measurements.

3. PREPARATION OF EXPRESSION PLASMID
3.1 Construction of expression vector for target
protein–GFP–ErmC fusion
There are wide varieties of plasmids, which can be used for protein expression in E. coli. In the current method, we prefer the araBAD expression system for production of membrane proteins. It uses the PBAD promoter, a
tightly regulated bacterial promoter system, which gives minimal expression
in the absence of inducer and toxicity by misfolded protein is readily controlled. Furthermore, the dynamic range of expression upon induction by
L-arabinose can be more than three orders of magnitude (Guzman, Belin,
Carson, & Beckwith, 1995).
Genes encoding EGFP and ErmC are first cloned at the 30 end of the
multiple-cloning site of the pBAD vector, after which the coding sequence
of the target protein is inserted at the 50 end in frame with the gene for the
GFP–ErmC tandem. Another concern is the linker tethering the target

membrane protein and the GFP. We tested the effect of the linker length
and the folding reporter efficiency of the C-terminal fused GFP. We used
a flexible (GGGS)n peptide sequence and observed no difference in
whole-cell fluorescence from no linker to (GGGS)5 in case the fusion protein itself has already up to 32 amino acids between the last transmembrane
segment and the GFP (Linares et al., 2010). Furthermore, for purification
and immunodetection of the proteins, we routinely add a 10Â His tag at


Engineering Escherichia coli for Functional Expression

11

the C-terminus of the fusion protein; and for functional and structural studies, we engineer a TEV protease recognition peptide sequence in the linker
region between the target protein and GFP (Geertsma, Groeneveld, et al.,
2008; Gul et al., 2014).
The expression plasmid can be converted into the ligation-independent
cloning (LIC) compatible system, which facilitates the cloning procedure.
For the details of designing and conversion of plasmids into LIC compatible
vectors, we refer to Geertsma & Poolman, 2007.
1. Design primers for amplifying codon optimized gfp (GenBank:
KF410615; we use gfp+ that encodes EGFP; Scholz, Thiel, Hillen, &
Niederweis, 2000) and ermC from Staphylococcus aureus (GenBank:
JF968525; Weisblum, 1995). The 10Â His tag coding sequence can
be prepared by annealing complementing oligonucleotides. They have
to be in-frame after construction.
2. Clone the coding sequences of gfp, ermC, and the 10Â His in the
multiple-cloning site.
3. Clone the coding sequence of the target gene into the multiple-cloning
site. Make sure that all the sequences are in frame.

3.2 Expression test
Before selecting cells with increased expression, it is important to first find
the optimal induction condition for the fusion protein. At least two parameters should be tested: the inducer concentration and the temperature of
expression. In general, the fraction of properly folded protein is higher at
low induction level and at low growth temperature, since excessive transcription and translation usually overload the chaperone and translocation
systems. The optimal induction condition has to be determined experimentally, but we routinely perform the experiments at 20 °C and L-arabinose
concentrations of 0.01–0.001% (w/v). The expression test is also useful after
the selection process, i.e., to find the best performing clones and to benchmark their expression performance.
3.2.1 Bacterial culture for protein expression and determination of
whole-cell fluorescence
1. Transform E. coli cells with pBAD bearing the gene for the target membrane protein fused with GFP (with or without ErmC).
2. Pick a single colony and inoculate into LB medium supplemented with
100 μg/ml ampicillin (to maintain the pBAD vector), and grow the culture overnight at 37 °C with shaking at 200 rpm for adequate aeration.


12

Franz Y. Ho and Bert Poolman

3. Inoculate 1% (v/v) of overnight culture into fresh LB medium, supplemented with 100 μg/ml ampicillin, and grow the cells to A600 of
0.5–0.6 (1 cm light path) at 37 °C.
4. When the cells reach A600 of 0.5–0.6, induce protein expression by
adding L-arabinose to the culture. Keep a fraction of cells for detection
of un-induced expression. Initially, a broad range of induction conditions is tested, which can include varying the L-arabinose concentration,
induction time, and growth temperature (Table 2).
5. At the end of the cultivation, measure the optical density of the cultures
at 600 nm.
6. Collect cells by centrifugation at 5000 Â g for 15 min, and wash the cells
by resuspension in 0.5Â of culture volume of 50 mM potassium phosphate (KPi), pH 7 (wash buffer). Repeat the washing step and resuspend
the cells in 0.2 Â of the original culture volume of wash buffer.

7. After the second wash, remove the supernatant and resuspend cells in
wash buffer to equal protein content (e.g., 3–5 mg/ml total protein,
given to the fact that A600 of 1 corresponds to about 0.3 mg/ml total
protein).
8. Aliquot 100 μl of cell suspension (in triplicate) into wells of a 96-well plate,
which is suitable for fluorescence measurements (black wells with transparent bottom). Use a fluorescence plate reader with suitable excitation
and emission filters for GFP (488 nm excitation, 510 nm emission).
9. Measure the optical density of the cell suspension in the wells. These
values are used for normalizing the fluorescence counts and subsequent
gel-based analysis.

Table 2 Parameters of expression optimization
Parameters
Recommendation

Expression
temperature

16–37 °C are commonly used
e.g., 16, 20, 25, 30, and 37 °C

Time

1 h to overnight
e.g., 1, 2, 4, 6 h, or overnight

Inducer
concentration

10À4–10À1% (w/v) L-arabinose for the araBAD system; strains

that catabolize L-arabinose require higher concentrations of the
inducer (Guzman et al., 1995; Horazdovsky & Hogg, 1989)
20 μM to 0.4 mM IPTG for the lac promoter; strains that lack
the lacY gene generally require a higher concentration of IPTG


Engineering Escherichia coli for Functional Expression

13

3.2.2 Gel-based analysis of the expressed fusion constructs
Although whole-cell fluorescence indicates the amount of globally folded
membrane protein–GFP–ErmC fusion, the fluorescence signal can be misleading when part of the fusion protein is degraded and soluble GFP is measured. Therefore, it is necessary to confirm the full length of the fusion
proteins by SDS-PAGE. Moreover, folded and misfolded fusion proteins
can be discriminated by SDS-PAGE followed by Western blotting
(Geertsma, Groeneveld, et al., 2008). The choice of lysis buffer depends
on the target proteins and subsequent purification steps; 50 mM potassium
phosphate, pH 7, supplemented with 1 mM MgCl2, 10% glycerol, 25 μg/ml
DNaseI, and 1 mM PMSF is usually a good starting point.
1. Resuspend cells corresponding to 3–5 mg/ml in lysis buffer.
2. Break the cells by either beating with 0.1 μm glass beads (at 4 °C) or by
probe sonication in an ice-water bath (control sonication power to prevent foaming and heating of the sample).
3. Mix 40 μl of cell lysate with 10 μl 5 Â Laemmli buffer (Laemmli, 1970),
incubate the mixture at 37–50 °C for 5 min (temperature should be
lower than 65 °C, as otherwise the GFP will denature).
4. Separate 5–15 μl of each samples by SDS-PAGE; samples should contain
20–100 μg of total cell protein.
5. After electrophoresis, rinse the gel with water and capture its fluorescence on a proper imaging system, such as ImageAnalyzer LAS from
FujiFilm or Typhoon from GE Healthcare. In the fluorescence image,
only properly matured GFP and thus overall folded fusion proteins

are detected.
6. Use the same gel, transfer the separated proteins onto PVDF membrane
by semidry electrotransfer (Bjerrum & Scha¨fer-Nielsen, 1986;
Gershoni, 1988).
7. After the transfer, visualize the protein expression by Western blotting,
using an anti-His antibody and an appropriate secondary antibody
(Gershoni, 1988).
8. Both folded and misfolded proteins are visible on the Western blot.
Different culture and induction conditions can be compared at this stage,
and optimal starting conditions for expression screening are chosen. An
example of an expression test is shown in Fig. 3. In the example, the cAMP
receptor 1 (cAR1) from Dictyostelium was expressed in E. coli BW25113B
and NG3 at different inducer (L-arabinose) concentrations. The NG3 strain
was obtained by selecting for enhanced production of the glutamate transporter GltP in the BW25113B strain as described in this method. It carries


14

Franz Y. Ho and Bert Poolman

Whole-cell fluorescence (a.u.)

A

L-Arabinose

(% w/v)

B
L-Arabinose

(% w/v)

In-gel
fluorescence

Anti-His tag
immunoblot

Figure 3 Example of expression test. (A) In vivo cell fluorescence of E. coli BW25113B
cells (open square) and its evolved derivative NG3 (closed circle) expressing the
Dictyostelium discoideum cAMP receptor 1–GFP–ErmC fusion protein at different
L-arabinose concentrations. The fluorescence intensity is normalized by cell density
and error bars show the standard deviation (SD) of three independent measurements.
(B) In-gel GFP fluorescence and immunoblots detected by anti-His tag antibody of the
same gels are shown. Black and white arrows indicate the positions of the nonfluorescent (misfolded) and fluorescent (folded) protein species, respectively.

genomic mutations in the hns, ung, and cpxA genes when compared to the
parental BW25113B strain (Gul et al., 2014).

4. SELECTING CELLS FOR BETTER EXPRESSION
Improved expression strains are selected by directed evolution. The
target protein is fused to GFP and ErmC. If the target protein is misfolded,
it will drag GFP and ErmC in a nonfunctional state and growth will be


Engineering Escherichia coli for Functional Expression

15

limited by the presence of erythromycin in the medium. Evolved cells that
produce more folded protein will be more resistant to erythromycin and
outcompete the parental strain. By culturing cells in the presence of inducer
to trigger protein expression and gradually increasing the erythromycin concentration, one selects for better performing cells in terms of protein expression. We use GFP to identify among the erythromycin-resistant strains those
that produce the highest fluorescence, and thus fusion protein that is inserted
into the membrane rather than misfolded protein with some ErmC activity.
1. Pick a single colony and inoculate into LB medium supplemented with
100 μg/ml ampicillin (or appropriate antibiotics to maintain the plasmid). Grow overnight at 37 °C with vigorous agitation (200 rpm).
2. Dilute the overnight culture in 1–100 ratio. Grow at 37 °C to
A600 $0.4, and then lower the cultivation temperature to 25 °C; we
occasionally perform the selection at 17 °C.
3. Induce protein expression at A600 0.5–0.6, by adding L-arabinose to a
final concentration of 0.01% (w/v).
4. After 2 h, inoculate fresh LB-ampicillin medium with the induced culture at 2% (v/v); keep L-arabinose at 0.01% for protein expression, and
add erythromycin at 5 μg/ml for selection. Continue the cultivation for
48 h.
5. Transfer 2% of the culture into fresh medium with the same supplements
but an elevated concentration of erythromycin, e.g., 10 μg/ml, and continue growth for 48 h.
6. Repeat step 5 and increase the erythromycin concentration consecutively from 10 μg/ml to 20, 50, 100, and 200 μg/ml.
7. Optionally, one can continue the subculturing at 200 μg/ml erythromycin by repeating step 5 for one to five times.
8. At the end of the selection, the cells are plated onto LB agar supplemented with 100 μg/ml ampicillin, 0.01% (w/v) L-arabinose, and
the highest concentration of erythromycin reached.
9. Pick the most fluorescent colonies from the plate for further analysis.

5. CHARACTERIZING EVOLVED STRAINS
5.1 Basic characterizations
5.1.1 Plasmid copy number, DNA sequencing, and transcript levels
Recombinant protein yield can be increased by altered copy number or
mutations within the plasmid. We estimate changes in plasmid copy number
from gels or more precisely by quantitative PCR (Skulj et al., 2008). So far,

16

Franz Y. Ho and Bert Poolman

we have never found changes in plasmid copy number or mutations in the
plasmid. Whole-genome sequencing using next generation sequencing
technologies (ultradeep sequencing) revealed multiple mutations in the
genomes of E. coli and L. lactis (Gul et al., 2014; Linares et al., 2010).
The transcription level of the target protein can be determined by qRTPCR (Ba´ez-Viveros et al., 2007).

5.2 Plasmid curing
The evolved E. coli cells are subsequently cured from the expression plasmid,
which is done by subculturing cells at 5–7 °C above the optimal growth
temperature (42–44 °C) (Trevors, 1986). Depending on the properties of
the plasmid (copy number, stability), the cells may have to be subcultured
up to 50 times. Cells which are sensitive to the marker antibiotic are isolated.
1. Inoculate evolved strains in LB medium without the plasmid marker
antibiotic; i.e., ampicillin in case of pBAD vectors.
2. Grow the cells at 37 °C with vigorous agitation until late log phase.
3. Transfer the cells to fresh LB medium at a 5–10% (v/v) inoculum, continue cultivation nonselectively at 42–44 °C with vigorous agitation.
4. Repeat step 3 and screen colonies until the cells are sensitive to
ampicillin.
5. Purify isolated colonies and characterize the strains, following transformation with fresh plasmid. The evolved expression hosts can now be
tested for the expression of different target proteins.

5.3 Functional assays
The function of the expressed protein can sometimes already be tested
in vivo. For example, it is possible to test the function of transport proteins

by measuring the import or export of radiolabeled substrate (Geertsma,
Groeneveld, et al., 2008). Similarly, it is possible to probe binding of ligands
to a receptor in vivo when high-affinity ligands are available (Brodersen,
Honore´, Pedersen, & Klotz, 1988; Detmers et al., 2000; Silhavy,
Szmelcman, Boos, & Schwartz, 1975). Ultimately, one will have to purify
the protein and determine if the protein isolated from the evolved host has
genuine activity. For membrane transport proteins, we have previously
described various simple methods to test their activity either in membrane
vesicles or proteoliposomes (Geertsma, Nik Mahmood, et al., 2008;
Mulligan et al., 2009; Poolman et al., 2005).