Tách dòng và biểu hiện cecropin trong các hệ vector khác nhau


vector khác nhau





huyên ngành; 




Abstract:  





Keywords: ; ; Cecropin; Kháng kháng sinh; Sinh y


Content
Nhân ngày i 7/4/2011, t
: không hà  m

sinh   p giúp nhân
 sinh.

 kháng s
  
 Tro

y  tách chi t côn trùng d nên

AMPs nói chung và cecropin nói riê

                 


  côn trùng  Vi Na
“Tách dòng và biểu hiện cecropin trong các hệ vector khác nhau”

 



CHƢƠNG 1 - TỔNG QUAN TÀI LIỆU
  
 [63, 79]. Khi
  
la  
 


    nhân
ni 7/4/2011
là nguy




cecropin quý giá (

 
 
 .  
n không
 
 .
v 

 
 . 












 . 














 , 


 , 




, 







 . , 













 . cecropin 


cecropin 
cecropin E. coli 
Tách dòng và biểu hiện cecropin trong các hệ
vector khác nhau”. cecropin B 



cecropin B cecropin 

E. coli.


Tách dòng và biểu hiện cecropin tái tổ hợp trong các hệ vector khác nhau

 nh giá ng







CHƢƠNG 2 - NGUYÊN LIỆU VÀ PHƢƠNG PHÁP NGHIÊN CỨU
2.1. Nguyên liệu
2.1.1. Các hệ vector
- Các vecmang gen cecropin 

+ pJET1.2-cecH: vector pJET1.2 mang gen cecropin     r 
Drosophila melanogaster
+ pJET1.2-cecN: vector pJET1.2 mang gen cecropin    nBombyx
mori
+ pCR2.1-cecT: vector pCR2.1 mang gen cecropin B 
- Vector nhân dòng: pBluescript II KS(+) (kí h
-     -4T-    e, vector pET-28a và
vector pET-
2.1.2. Các chủng vi khuẩn
- E. coli DH5 
- E. coli BL21 (DE3) và E. coli 

2.1.3. Các cặp mồi


Bảng 5. T các 
Tên mồi
Trình tự mồi (5’-3’)
Vai trò của cặp mồi
Oligo 1
aattcatcgatggatgaatttctcaaggatatttttct
tcgtgttcgctttggttctggctttgtcaacagtttcg
cecropin
Oligo 6
tcgaggctagcttatcctagcgctttggcttcgcct

aaaaccgcgatcgctggtccagccttgac
pJET1.2 F
cgactcactatagggagagcggc
    gen cecropin 
pJET1.2-cecropin
pJET1.2 R
aagaacatcgattttccatggcag
T7
aatacgactcactatag
Nhân    gen cecropin
pBS-cecropin,
pCR2.1-cecropin
M13/pUC
reverse
caggaaacagctatgac
pGEX-
Bam-cec
actggatccatgaatttctcaaggatatttttcgtgtt
cgctttggttctggct
Nhân    cecropin 
-4T-1
pGEX F
gggctggcaagccacgtttggtg
Nhân    gen cecropin
trong vector tái   -
cecropin
pGEX R
cctctgacacatgcagctcccgg
pET28a-
Eco-cec

atagaattcatgtcccctatact
Nhân    cecropin 
-28a
pET32b-
Nco-cec
attccatggcaatgaatttctcaaggatatttttcgtgtt
Nhân    cecropin 
o vector pET-32b
pET 28
ggtgatgtcggcgatatagg
 
 -28a-cecropin và pET-32b-
cecropin
pET 28 T7
gctagttattgctcagcgg
2.1.4. Gel sắc ký ái lực Glutathione Sepharose 4B, Ni-NTA agarose

tathione Sepharose 4B (GE
He     lu       -transferase
(GST). Glutathi      là agarose 4% thông qua    
GST, các protein
 
  -

2+



2.1.5. Các hóa chất và thiết bị
 Hóa chất:

-         Taq DNA polymerase (Fermentas),
AmpliTaq Gold® DNA polymerase (Applied Biosystems)
-     Fermentas, New England Biolabs), enzyme T4 DNA ligase
(Fermentas, Invitrogen)
- Protease: thrombin (GE Healthcare), enterokinase (New England Biolabs)
- % trypton, 0.5% ca
men, 0.5% NaCl
- Kit  QIAquick PCR Purification Kit (QIAGEN)
-                 
phosphate pH 7.4 (3.1 g NaH
2
PO
4
.H
2
O, 10.9 g Na
2
HPO
4,
thêm H
2
PBS (150 mM
NaCl, 20 mM sodium phosphate), PBS lysis (150 mM NaCl, 20 mM sodium phosphate, 1 mM
PMSF, 1% Triton-X100), GST elution (50 mM Tris-HCl pH 8, 20 mM glutathione reduced), His
lysis (50 mM NaH
2
PO
4
, 300 mM NaCl, 10 mM imidazole, 1 mM PMSF, 1% Triton-X100), His
wash (50 mM NaH

2
PO
4
, 300 mM NaCl, 20 mM imidazole), His elution (50 mM NaH
2
PO
4
, 300
mM NaCl, 250 mM imidazole), EK buffer (20 mM Tris-HCl pH 8, 50 mM NaCl, 2 mM CaCl
2
)
-        IPTG, X-gal, PMSF, Triton X-100, SDS, ure,
isopropanol, ethanol, methanol, Coomassie Brilliant Blue, sodium bicarbonate, Tris base, HCl,
acrylamide,  

 Thiết bị:
     -Khoa
-Phòng thí ng-Protein

2.2. Phương pháp
2.2.1. Sơ đồ nghiên cứu
   9.

Hình 9. 

2.2.1.1. Tách dòng (subclone) các gen cecropin từ các vector nhân dòng sang vector biểu
hiện
Các gen cecH, cecN và cecT nhân dòng sang các vector
 thông qua vector nhân dòng     
10.

Hình 10. .

CHƢƠNG 3 - KẾT QUẢ
 
1. -4T-1
(pGEX-cecH, pGEX-cecN, pGEX-cecT-cecH, pET 28a-
cecN, pET 28a-cecT-cecH, pET 32b-cecN, pET 32b-
cecT).
2. Biu hin thành công:
a. i dng dung hp vi GST trong c 2 chng t bào
biu hin E. coli BL21 (DE3) và E. coli JM109.
b. i dng dung hp vi 2 Tag His+GST trong chng t bào
biu hin E. coli BL21 (DE3).
c. i dng dung hp vi Trx trong chng t bào biu
hin E. coli BL21 (DE3).
3. c trng thái biu hin ca các cecropin dung hp:
a. GST-cecH, GST-cecN, GST-cecT; His+GST-cecH, His+GST-cecN  dng
th vùi.
b. Trx-cecH, Trx-cecN, Trx-cecT  dng tan.
4. Làm tan thành công các cecropin dung hp vi GST dng th vùi bng SDS 0.5% và
ure 8 M.
5. Tinh sch thành công các cecropin dung hp vi Trx (Trx-cecH, Trx-cecN, Trx-cecT)
và cecropin dung hp vi GST (GST-cecH, GST-cecN, GST-cecT) sau khi làm tan
bng ure 8 M. Hiu sut tinh sch cecropin dung hp vi Tag Trx cao hn hn so vi
Tag GST.
6. u x c cecropin dung hp bng protease thrombin (cecropin dung hp
vi GST).








1. Chuu kin gii phóng cecropin khi GST và Trx bng
là thrombin và enterokinase.
2. Loi b  thu các cecropin tinh sch.
3. Th hot tính kháng khun ca 3 loi cecropin: cecH, cecN và cecT trên các chng vi
sinh vt kim nh. T  nh giá s khác bit v hot tính kháng khun ca 3 cecropin này
 s khác bit v hot tính ca cùng 1 cecropin nhng theo hai cách làm tan bin tính và
không bin tính.

References
Tiếng Việt
1.GARP- Phân tích thực trạng: Sử dụng kháng
sinh và kháng kháng sinh ở Việt Nam
2.     Tách dòng cecropin từ nhộng Bombyx mori và biểu hiện
cecropin tái tổ hợp trong Escherichia coli

Tiếng Anh
3.Current strategies for the use of
affinity tags and tag removal for the purification of recombinant proteins Protein
Expression and Purification, 48, pp. 1-13.
4.Boman H. G. Annual Review of
Immunology, 13, pp. 61-92.
5.Boman H. G., Faye I., Gan R., Gudmundsson G. H., Lidholm D. A., Lee J. Y., Xanthopoulos
    ty-      Mem. Inst.
Oswaldo Cruz, 82(3), pp. 115-124.
6.          

Analytical Biochemistry, 316, pp. 223-231.
7.Nature Biotechnology, 17, pp. 1165-1169.
8.Brogden K.         Pasteurella
haemolytica, Escherichia coli, and Klebsiella pneumoniae Infection and
Immunity, 60, pp. 5182-5189.
9.Brogden K.     pore formers or metabolic inhibitors in
Nature, 3, pp. 238-250.
10. Brogden K. A., Ackermann M., McCray P. B., Jr., Tack B. F.  Antimicrobial
peptides in animals and their role in host defencesInternational Journal of Antimicrobial
Agents, 22, pp. 465-478.
11.       
Current Opinion in Immunology, 18, pp. 24-30.
12. Bulet P., Charlet M., Hetru C. (2003), Innate Immunity, Humana Press, Totowa, pp. 89-107.
13. Bulet P., Stöcklin R. antimicrobial peptides: Structures, properties and gene
rProtein and Peptide Letters, 12, pp. 3-11.
14. Bulet P., Stöcklin R., Menin L. (2004), Anti-microbial peptides: from invertebrates to
vertebratesImmunological Reviews, 198, pp. 169-184.
15. Callaway J. E., Lai J., Haselbeck B., Baltaian M., Bonnesen S. P., Weickmann J., Wilcox G.,
 is essential for broad-spectrum
Antimicrobial agents and Chemotherapy, 37(8), pp. 1614-1619.
16. Expression
of a cytotoxic cationic antibacterial peptide in Escherichia coli using two fusion partners
Protein Expression and Purification, 57, pp. 303-311.
17. 
The AAPS Journal, 8(3), pp. E572-E579.
18. Fei D., Wei X., Xueyin D., Xianxiu X. (1999), 
, Science in China, 42(5), pp. 494-500.
19. Science, 286, pp. 420-421.
20. Ganz T.    of antimicrob    , Integrative and
Comparative Biology, 43, pp. 300-304.

21. Peptide antibioticsLancet, 349, pp. 418-422.
22. Hancock R. E. W., Sahl Antimicrobial and host-defense peptides as new anti-
infective therapeutic strategiesNature Biotechnology, 24(12), pp. 1551-1557.
23. Holak T. A., Engstrom A., Kraulis P. J., Lindeberg G., Bennich H., Jones T. A., Gronenborn
A. M., Clore G. eptide cecropin
Biochemistry,
27(20), pp.7620-7676.
24. Hong R. W., Shchepetov M., 
the Escherichia coli response to the antimicrobial insect peptide Cecropin AAntimicrobia
agents and Chemotherapy, 47(1), pp. 1-6.
25. Biological
activities of cecropin B-thanatin hybrid peptidesThe journal of peptide research official
journal of the American Peptide Society, 66(6), pp. 382-386.
26. Hultmark D., Engstrom A., Bennich H., Kapur R., Boman H. G. (1982), Insect immunity:
isolation and structure of cecropin D and fourminor antibacterial components from cecropia
pupae European Journal Biochemistry, 127, pp. 207-217.
27. Jan P. S., Huang H. Y., Chen      
cationic peptide Cecropin B in transgenic tomato plants protects against bacterial diseases
Applied and Environmental Microbiology, 76(3), pp. 769-775.
28. Jenssen H., Hamill P., Hancock R.     Clinical
microbiology reviews, pp. 491-511.
29. Jin F., Xu X., Zhang W., Gu D. (2006), Expression and characterization of a housefly
cecropin gene in the methylotrophic yeast, Pichia pastoris Protein Expression and
Purification, 49(1), pp. 39-46.
30.        Novel properties of antimicrobial peptides
Acta Biochimica Polonica, 50(2), pp. 461-469.
31. Kang C. S., S-Amidated HinnavinII-
38-Asn produced from a Trx fusion construct in Escherichia coli The Journal of
Microbiology, 46(6), pp. 656-661.
32. Li L., Wang J. X., Zhao X. F., Kang C. J., Liu N., Xiang J. H., Li F. H., Sueda S., Kondo H.

cation, and characterization of the shrimp antimicrobial
peptide, Ch-penaeidin, in Pichia pastorisProtein Expression and Purification, 39, pp. 144-
151.
33. Li Y    roteins for fusion expression of antimicrobial
peptides in Escherichia coliBiotechnology and Applied Biochemistry, 54, pp. 1-9.
34. Liang Y., Wang J. X., Zhao X. F., Du X. J., Xue J. F. (2006), Molecular cloning and
characterization of cecropin from the ho Musca domestica), and its expression in
Escherichia coliDevelopmental and Comparative Immunology, 30, pp. 249-257.
35. Studies on the properties of Cecropin-
XJ expressed in yeast from Xinjiang silkwormWei Sheng Wu Xue Bao, 43(5), pp. 635-641.
36. Lu X. M., Jin X. B., Zhu J. Y., Mei H. F., Chu F. J., Wang Y., Expression
of the antimicrobial peptide cecropin fused with human lysozyme in Escherichia coli
Applied Microbiology and Biotechnology, 87(6), pp. 2169-2178.
37. McDermott A. M. (2004), urface
Ocul Surf., 2(4), pp. 229-247.
38. Mookherjee N., Hancock R. E. W. (2007), Cationic host defence peptides: innate immune
regulatory peptides as a novel aCellular and molecular life
sciences, 64(7-8), pp. 922-933.
39. Melo M. N., Ferre R., Castanho M. A. 
activity and high membrane-bound concentrationsNature Reviews, Microbiology, 7, pp.
245-250.
40. Mercado-Pimentel M. E., Jordan N. C.,   ffinity purication of
GST fusion proteins for immunohistochemical studies of gene expression Protein
Expression and Purification, 26, pp. 260-265.
41. 
Journal of Antimicrobial Chemotherapy, 37, pp. 1077-1089.
42. Moore A. J., Devine D. A., Bibby M.     
activity Peptide research, 7(5), pp. 265-269.
43. 
a potent antibacterial protein of Sarcophaga peregrina The Journal of Biological

Chemistry, 262, pp. 1665-1669.
44. -level expression of soluble protein in Escherichia coli
using a His
6
-Tag and Maltose-Binding-Protein double-   Protein
Expression and Purification, 10, pp. 309-319.
45. Sallum U. W., Chen T. T.     
Antimicrobial agents and Chemotherapy, 52(9), pp. 3006-3012.
46. Sambrook J., Russel D. W. (2001), Molecular cloning: A laboratory manual, 3
rd
Edition,
Cold Spring Habor laboratory Press, New York.
47. Sarmasik A., Warr G., Chen T. 
Marine Biotechnology, 4, pp. 310-322.
48. membrane interactions and mechanisms of membrane
destruction by amphipathic -, Biochimica et Biophysica Acta,
1758, pp. 1245-1256.
49. Schmitt P., Mercado L., Díaz M., Guzmán F., Arenas G., Marshall S. H. (2008),
f a novel antimicrobial peptide (CECdir-CECret)
from inclusion bodies after expression in Escherichia coliPeptides, 29, pp. 512-519.
50. Serón J. M., Contreras-Moreno J., Puertollano E., Cienfuegos G. A., Puertollano M. A.,
Pablo M. A. (2010)obial peptide cecropin A induces caspase-independent cell
, Peptides, 31, pp. 1494-1503.
51. Shahravan S. H., Qu X., Chan I., Shin J.       
enterokinase cleavage reaction to pro       Protein
Expression and Purification, 59(2), pp. 314-319.
52. -Royalisin
gene from Royal Jelly of Chinese Honeybee in Escherichia coli and its antibacterial
Journal of agricultural and food chemistry, 58, pp. 2266-2273.
53.               -level expression of

cecropin X in Escherichia coli International Journal of Molecular Sciences, 8, pp. 478-
491.
54. Structure-antibacterial, antitumor and hemolytic
activity relationships of cecropin A-magainin 2 and cecropin A-melittin hybrid peptides
The journal of peptide research official journal of the American Peptide Society, 53(1), pp.
82-90.
55.  
Nature, 292, pp. 246-
248.
56.         
Nature methods, 8(6), pp. iii-iv.
57. Strominger    Animal Antimicrobial Peptides: Ancient Players in Innate
ImmunityJournal of Immunol, 182, pp. 6633-6634.
58. Suttmann H., Retz M., Paulsen F., Harder J., Zwergel U., Kamradt J., Wullich B., Unteregger
       -family show
BioMed Central Urology, pp. 1-7.
59. 
of DENV-2 nonstructural protein 3 (NS3) and production of the polyclonal antibody for
Dengue Bulletin, 30, pp. 146-156.
60. Ueno S., Kusaka K., Tamada Y., Minaba M., Zhang H., Wang P. C., Kato Y. (2008),
 -terminal proregion of Nematode antimicrobial peptide Cecropin P4 precursor
       Bioscience Biotechnology
Biochemistry, 72(12), pp. 3281-3284.
61. Wachinger M., Kleinschmidt A., Winder D., Pechmann N.V., Ludvigsen A., Neumann M.,

replication of human immunodeficiency virus 1 by suppressi   
Journal of General Virology, 4, pp. 731-740.
62.            
Current Pharmaceutical Design, 9(16), pp. 1277- 1287.
63. BioTeach Journal, 2, pp. 88-

91.
64. Xiaobao J., Hanfang M., Xiaobo L., YanMa, Ai-hua Z., Yan W., Xuemei L., Fujiang C.,
     -inducing activity of the antimicrobial peptide
cecropin of Musca domestica in human hepatocellular carcinoma cell line BEL-7402 and the
Acta Biochim Biophys Sin, pp. 259-265.
65. ion protein in E.
coli Biochemistry and molecular biology international, 39(3), pp. 487-
492.
66. Xu X., Jin F., Yu X., Ji S., Wang J., Cheng H., 
purification of a recombinant antibacterial peptide, cecropin, from Escherichia coliProtein
Expression and Purification, 53, pp. 293-301.
67.      
Bombyx mori Biochemistry Jounal, 272, pp. 633-636.
68. Yang W., Cheng T., Ye M., Deng X., Yi H., Huang Y., Tan X., Han D., Wang B., Xiang Z.,
     Functional Divergence among Silkworm Antimicrobial Peptide
Paralogs by the Activities of Recombinant Proteins and the Induced Expression Profiles
PloS One, 6(3), pp. e18109.
69. Yu F., Wang J., Zhang P., Hong Y., Liu W. (2010), Fusion expression of cecropin B-like
antibacterial peptide in Escherichia coli and preparation of its antiserum Biotechnology
Letters, 32, pp. 669-673.
70. Zasloff M.       Nature, 415, pp.
389-395.
Trang Web
71. />df
72.
73.
74.
75.
76. Services/Applications/Protein-
Expression-and-Analysis/Protein-Expression-Systems-and-Vectors/Protein-Expression-

Systems.html
77. />ng-khang-thu-c-khang-sinh-1.292643#y2iCFxHSBTzz
78. />guide/protein-expression/
79.
80. www.who.int/world-health-day/2011/presskit/WHD2011-QA-EN.pdf