Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

Expression and secretion of interleukin-1b, tumour
necrosis factor-a and interleukin-10 by hypoxia- and
serum-deprivation-stimulated mesenchymal stem cells
Implications for their paracrine roles
Zongwei Li, Hua Wei, Linzi Deng, Xiangfeng Cong and Xi Chen
Research Center for Cardiac Regenerative Medicine, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing, China
Introduction
Ischaemic heart disease is a life-threatening condition
that may cause sudden cardiac failure and death.
Many researchers have investigated cell transplantation
as an alternative treatment for heart disease. Bone
marrow-derived mesenchymal stem cells (MSCs) are
easily obtainable and expandable, multipotent progeni-
tor cells [1] that have emerged as attractive candidates
for cellular therapies for heart and other organ-system
disorders [2]. Although several mechanisms have been
proposed for the cardioprotective effects of MSCs,
including cardiomyocyte regeneration, spontaneous cell
fusion and paracrine action [3], there is a growing
Keywords
IL-10; IL-1b; mesenchymal stem cell;
paracrine; TNF-a
Correspondence
X. Chen; X. Cong, Research Center for
Cardiac Regenerative Medicine, The
Ministry of Health, Cardiovascular Institute
& Fu Wai Hospital, Chinese Academy of
Medical Sciences & Peking Union Medical
College, 167 Beilishilu, Beijing 100037,
China
Fax ⁄ Tel: +86 10 88398584

E-mail: ;

(Received 26 April 2010, revised 27 June
2010, accepted 10 July 2010)
doi:10.1111/j.1742-4658.2010.07770.x
To understand the potential paracrine roles of interleukin-1b (IL-1b),
tumour necrosis factor-a (TNF-a) and interleukin-10 (IL-10), the expres-
sion and secretion of these factors by rat bone marrow-derived mesenchy-
mal cells stimulated by hypoxia (4% oxygen) and serum deprivation
(hypoxia ⁄ SD) were investigated. We found that hypoxia ⁄ SD induced
nuclear factor kappa Bp65-dependent IL-1b and TNF-a transcription. Fur-
thermore, hypoxia ⁄ SD stimulated the translation of pro-IL-1b and its
processing to mature IL-1b, although the translation of TNF-a was
unchanged. Unexpectedly, the release of IL-1b and TNF-a from hypox-
ia ⁄ SD-stimulated mesenchymal cells was undetectable unless ATP or lipo-
polysaccharide was present. This result suggests that IL-1b and TNF-a are
not responsible for the paracrine effects of mesenchymal cells under ischae-
mic conditions. We also found that hypoxia ⁄ SD induced the transcription
and secretion of IL-10, which were significantly enhanced by lipopolysac-
charide and the proteasomal inhibitor MG132. Moreover, both the condi-
tioned medium from hypoxia ⁄ SD-stimulated mesenchymal cells (MSC-CM)
and IL-10 efficiently inhibited cardiac fibroblast proliferation and collagen
expression in vitro, suggesting that mesenchymal cell-secreted IL-10 pre-
vents cardiac fibrosis in a paracrine manner under ischaemic conditions.
Taken together, these findings may improve understanding of the cellu-
lar and molecular basis of the anti-inflammatory and paracrine effects of
mesenchymal cells.
Abbreviations
BrdU, 5-bromodeoxyuridine; DMEM, Dulbecco’s modified Eagle’s medium; ELISA, enzyme-linked immunosorbent assay; ERK, extracellular
signal-regulated kinase; hypoxia ⁄ SD, hypoxia and serum deprivation; IL, interleukin; IMDM, Iscove’s modified Dulbecco’s medium;

LPS, lipopolysaccharide; MSCs, mesenchymal stem cells; NF-jBp65, nuclear factor kappa Bp65; p38, p38 mitogen-activated protein kinase;
TNF-a, tumour necrosis factor-a.
3688 FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS
body of evidence supporting the hypothesis that para-
crine mechanisms mediated by MSC-secreted factors
play an essential role in the reparative process [4,5].
It has been reported that MSC-conditioned medium
under normoxic conditions significantly attenuates car-
diac fibroblast proliferation and type I and III collagen
expression, exerting paracrine anti-fibrotic effects.
However, researchers did not analyse the active compo-
nents of the conditioned medium [6]. Other researchers
have suggested that adrenomedullin and hepatocyte
growth factor are paracrine factors secreted by trans-
planted MSCs, decreasing myocardial fibrosis [7–9].
Whether other paracrine factors released by MSCs
mediate these cells’ anti-fibrotic effects remains largely
unknown.
Interleukin-1b (IL-1b) and tumour necrosis factor-a
(TNF-a) are present in the tissues or systemic circula-
tion in many inflammatory conditions. It has also been
reported that the expression of IL-1b and TNF-a in
MSCs can be augmented by exposure to hypoxia [5].
Furthermore, IL-1b can induce cardiomyocyte growth
but inhibits cardiac fibroblast proliferation in culture
[10]. By contrast, MSC transplantation in rat models
of myocardial infarction has anti-inflammatory effects,
decreasing protein production and gene expression for
IL-1b and TNF-a [11]. To address these paradoxes of
both pro- and anti-inflammatory effects, the secretion

of IL-1b and TNF-a from MSCs under ischaemic con-
ditions must be further characterized.
IL-10 is an anti-inflammatory cytokine that has been
reported to be involved in the immunomodulation
mediated by transplanted MSCs [12,13]. IL-10 is also a
potential anti-fibrotic factor in the liver and kidney
[14–16]. In addition, the protective effect of MSCs
against sepsis is dependent on IL-10, which is not
directly produced by the injected MSCs but rather by
endogenous macrophages [17]. However, it is not
known whether MSCs can secrete IL-10 under ischae-
mic conditions, resulting in a paracrine anti-fibrotic
effect in the heart.
To assess the paracrine effects of IL-1b, TNF-a and
IL-10 released by MSCs on cardiac remodelling under
ischaemic conditions, conditioned medium from MSCs
(MSCs-CM) was collected during hypoxia and serum
deprivation (hypoxia ⁄ SD). This medium was used to
treat cardiac fibroblasts, enabling observation of the
paracrine effects of MSCs. The expression and secre-
tion of IL-1b, TNF-a and IL-10 by hypoxia ⁄ SD-stimu-
lated MSCs were also investigated. Our data
demonstrate that MSCs-CM can inhibit cardiac fibro-
blast proliferation and collagen synthesis, with
< 30 kDa molecules as its major active components.
MSCs did not secrete IL-1b and TNF-a under
hypoxia ⁄ SD conditions, although MSC-secreted IL-10
hindered cardiac fibroblast proliferation and collagen
expression. These findings suggest that IL-10 may be
an important paracrine, anti-fibrotic mediator secreted

by MSCs.
Results
MSCs-CM inhibits cardiac fibroblast proliferation
and collagen synthesis
The effects of MSCs-CM on cardiac fibroblast prolifer-
ation and collagen synthesis were detected by [
3
H]-thy-
midine and [
3
H]-proline incorporation. As shown in
Fig. 1A, MSC-CM treatment significantly inhibited
[
3
H]-thymidine and [
3
H]-proline incorporation under
normoxic or hypoxic culture conditions. To further
clarify the molecular mass range of important active
factors in the MSCs-CM, the medium was divided into
AB
Fig. 1. MSCs-CM inhibits cardiac fibroblast proliferation and collagen synthesis. (A) The effects of MSCs-CM on the incorporation of [
3
H]-thy-
midine and [
3
H]-proline by cardiac fibroblasts under normoxic or hypoxic conditions. Each data point represents the mean ± SEM of at least
three independent experiments. ***P < 0.001 versus normoxic control (Cont) group; ###P < 0.001 and ##P < 0.01 versus hypoxic control
(Cont + h) group. (B) The effects of the > 30 kDa and < 30 kDa components of MSCs-CM on the incorporation of [
3

H]-thymidine and
[
3
H]-proline by cardiac fibroblasts under normoxic or hypoxic conditions. ***P < 0.001 versus Cont group; ###P < 0.001 versus Cont + h group.
Z. Li et al. Paracrine anti-fibrotic effects of MSCs in vitro
FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS 3689
> 30 and < 30 kDa components using a 30 kDa
molecular mass cut-off ultrafiltration membrane. Frac-
tionation revealed that the < 30 kDa components, but
not the > 30 kDa components, of the MSCs-CM
inhibited cardiac fibroblast proliferation and collagen
synthesis (Fig. 1B).
Hypoxia
⁄
SD induces NF-jB-dependent IL-1b and
TNF-a transcription
Because transcription of IL-1b and TNF-a can be aug-
mented in MSCs by hypoxia [5], and because the
molecular masss of IL-1b and TNF-a are both 17 kDa
(< 30 kDa), changes in IL-1b and TNF-a gene tran-
scription in hypoxia ⁄ SD-stimulated MSCs were exam-
ined. As shown in Fig. 2A, the increased transcription
of IL-1b and TNF-a occurred after 3 h of hypoxia ⁄ SD
with a gradual increase up to 6 h, after which tran-
scription decreased. We also found that transcription
of IL-1b and TNF-a was mainly induced by SD,
whereas hypoxia simply augmented this effect
(Fig. 2B).
It has been reported that the nuclear factor-jB (NF-
jB) signalling pathway plays an important role in reg-

ulating IL-1b and TNF-a transcription [18,19]. To
investigate the role of this pathway in hypoxia ⁄ SD-
induced transcription, MSCs were exposed to BAY
11-7082, an NF-jB pathway inhibitor, followed by
hypoxia ⁄ SD for 6 h. As shown in Fig. 2C, the tran-
scription of IL-1b and TNF-a was significantly attenu-
ated by BAY 11-7082. Interestingly, the proteasomal
inhibitor MG132 also abrogated hypoxia ⁄ SD-induced
IL-1b and TNF-a transcription.
Next, to clarify the mechanism by which the NF-jB
pathway induces IL-1b and TNF-a transcription, the
nuclear translocation of NF-jBp65 was assessed by
immunocytochemical staining. As shown in Fig. 2D,
NF-jBp65 was mainly distributed in the cytoplasm
of control cells. By contrast, hypoxia ⁄ SD treatment
significantly stimulated the nuclear translocation of
AB
CD
Fig. 2. Hypoxia ⁄ SD induces NF-jB-dependent IL-1b and TNF-a transcription. (A) MSCs were incubated under hypoxia ⁄ SD conditions for the
indicated number of hours, and the relative mRNA levels of IL-1b and TNF-a were determined by real-time PCR. The data are the mean ±
SEM of at least three independent experiments. *P < 0.05 and **P < 0.01 versus control group (0 h). (B) The relative mRNA levels for IL-1b
and TNF-a in MSCs after hypoxia, SD or hypoxia ⁄ SD for 6 h by real-time PCR. **P < 0.01 versus Cont group; #P < 0.05 versus SD group.
(C) MSCs were exposed to BAY 11-7082 or MG132, followed by hypoxia ⁄ SD for 6 h and detection of relative mRNA levels of IL-1b and
TNF-a by real-time PCR. *P < 0.05 and **P < 0.01 versus hypoxia ⁄ SD treatment group. (D) A representative pattern of the nuclear translo-
cation of NF-jBp65, as assessed by immunocytochemical staining of MSCs using anti-(NF-jBp65 primary Ig) (red) and nuclear labelling with
4¢,6-diamidino-2-phenylindone (blue).
Paracrine anti-fibrotic effects of MSCs in vitro Z. Li et al.
3690 FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS
NF-jBp65, indicated by strong immunostaining in the
nucleus. Pretreatment with BAY 11-7082 inhibited

hypoxia ⁄ SD-induced NF-jBp65 translocation, with
substantial levels of NF-jBp65 staining remaining in
the cytoplasm of most cells. These results demonstrate
that hypoxia ⁄ SD induces IL-1b and TNF-a transcrip-
tion, which are dependent on activation of the NF-jB
pathway.
Hypoxia
⁄
SD-induced IL-1b and TNF-a transcription
depend on the extracellular signal-regulated
kinase pathway
The extracellular signal-regulated kinase 1 ⁄ 2 (ERK1 ⁄ 2)
and p38 mitogen-activated protein kinase (p38) signal-
ling pathways play important roles in hypoxia ⁄
SD-induced apoptosis of MSCs [20,21] and may also
affect IL-1b and TNF-a transcriptional regulation [22].
To confirm this, 20 lm U0126 (Fig. S1A) was used to
inhibit the ERK1 ⁄ 2 pathway in MSCs, followed by
measurement of IL-1b and TNF-a mRNA levels by
real-time PCR. As shown in Fig. 3A, U0126 completely
abolished hypoxia ⁄ SD-induced IL-1b and TNF-a
transcriptional upregulation. When the MSCs were
exposed to 15 lm SB202190 (Fig. S1B), a p38-specific
inhibitor, hypoxia ⁄ SD-induced IL-1b transcription
was inhibited by 60%, although TNF-a transcription
was not affected (Fig. 3B). Like BAY 11-7082, U0126
could also inhibit NF-jBp65 nuclear translocation
(Fig. 3C), suggesting that hypoxia ⁄ SD-induced activa-
tion of the NF-jB signalling pathway depends on the
ERK1 ⁄ 2 signalling pathway.

Hypoxia
⁄
SD increases the translation of pro-IL-1b
but not TNF- a
Having demonstrated significant transcriptional upreg-
ulation, we next examined protein levels of IL-1b and
TNF-a in MSCs-CM. Unexpectedly, neither IL-1b nor
TNF-a was detectable in MSCs-CM using enzyme-
linked immunosorbent assay (ELISA) analysis. To
determine the reason for this lack of IL-1b and TNF-a
secretion by MSCs, changes in these factors’ transla-
tion in hypoxia ⁄ SD-stimulated MSCs were investi-
gated. As shown in Fig. 4A, hypoxia⁄ SD increased
pro-IL-1b translation in a time-dependent manner,
whereas TNF-a protein expression remained
unchanged at each time point. Furthermore, MG132,
BAY 11-7082 and U0126, all of which abrogated
hypoxia ⁄ SD-induced IL-1b and TNF-a transcription,
also abolished pro-IL-1b translational upregulation
(Fig. 4B,C) but failed to affect TNF-a translation
A
C
B
Fig. 3. IL-1b and TNF-a transcriptional
induction depends on the ERK1 ⁄ 2 pathway.
MSCs were exposed to the ERK1 ⁄ 2
inhibitor U0126 or the p38 inhibitor
SB202190, followed by hypoxia ⁄ SD for 6 h.
(A,B) Relative mRNA levels for IL-1b and
TNF-a, as determined by real-time PCR.

*P < 0.05 versus hypoxia ⁄ SD group.
(C) A representative pattern of the nuclear
translocation of NF-jBp65, as assessed by
immunocytochemical staining of MSCs
using an anti-(NF-jBp65 primary Ig) (red)
and nuclear labelling with 4¢,6-diamidino-2-
phenylindone (blue).
Z. Li et al. Paracrine anti-fibrotic effects of MSCs in vitro
FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS 3691
(Fig. 4B). These results demonstrate that in hypox-
ia ⁄ SD-stimulated MSCs, IL-1b mRNA can be effi-
ciently translated into pro-IL-1b protein, whereas the
translation of TNF- a mRNA is severely repressed.
Hypoxia
⁄
SD induces cleavage of pro-IL-1b into
mature IL-1b
Given that hypoxia⁄ SD induced significant transla-
tional upregulation of pro-IL-1b and that processing
of pro-IL-1b into mature IL-1b requires activating
cleavage of pro-caspase 1 [23], the cleavage of both
pro-IL-1b and pro-caspase 1 was examined in hypox-
ia ⁄ SD-stimulated MSCs. As shown in Fig. 5A, hypox-
ia ⁄ SD promoted the processing of pro-IL-1b into
mature IL-1b, with a stronger induction effect in the
presence of the endotoxin LPS. Consistent with these
data, hypoxia ⁄ SD also induced the cleavage of pro-
caspase 1, with stronger activation in the presence of
LPS (Fig. 5B).
Hypoxia

⁄
SD-stimulated MSCs require a second
signal for IL-1b and TNF-a release
Although significant cleavage of pro-IL-1b and pro-
caspase 1 occurred intracellularly in hypoxia ⁄ SD-stim-
ulated MSCs, mature IL-1b was undetectable in
MSCs-CM (Fig. 6A). However, significant release of
IL-1b by hypoxia ⁄ SD-stimulated MSCs in the presence
of ATP was detected. Furthermore, when both LPS
and ATP were present, hypoxia ⁄ SD-stimulated MSCs
released a larger amount of IL-1b (Fig. 6A). We also
examined TNF-a expression in hypoxia ⁄ SD-stimulated
MSCs in the presence of LPS. As shown in Fig. 6B,
LPS relieved the translational inhibition of TNF-a.
Moreover, TNF-a release by MSCs was detectable
after hypoxia⁄ SD treatment for 6 h in the presence of
LPS (Fig. 6C). These findings demonstrate that hypoxia ⁄
SD-stimulated MSCs require a second stimulatory
signal in order to secrete IL-1b and TNF-a.
Hypoxia
⁄
SD induces the transcription and
secretion of IL-10
Because of the lack of secretion of the inflammatory
cytokines IL-1b and TNF-a from hypoxia ⁄ SD-stimu-
lated MSCs, as well as the significant anti-inflamma-
tory effects of MSCs, expression and secretion of the
anti-inflammatory cytokine IL-10 by these cells was
investigated. As shown in Fig. 7A, hypoxia ⁄ SD
A

C
B
Fig. 4. Hypoxia ⁄ SD increases translation of
pro-IL-1b but not TNF-a. (A) Representative
western blots for pro-IL-1b and TNF-a
expression in MSCs stimulated by
hypoxia ⁄ SD for the indicated number of
hours. (B) Representative western blots
for pro-IL-1b and TNF-a expression in MSCs
in the presence and absence of
BAY 11-7082 or MG132. *, nonspecific
band. (C) Representative western blots for
pro-IL-1b expression in MSCs in the pres-
ence and absence of U0126. *, nonspecific
band.
A
B
Fig. 5. Hypoxia ⁄ SD induces cleavages of pro-IL-1b and pro-cas-
pase 1. MSCs were stimulated by hypoxia ⁄ SD in the presence or
absence of LPS for the indicated number of hours. (A) Representa-
tive western blots for pro-IL-1b and mature IL-1b in MSCs. (B) Rep-
resentative western blots for pro-caspase 1 and cleaved caspase 1
in MSCs.
Paracrine anti-fibrotic effects of MSCs in vitro Z. Li et al.
3692 FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS
induced significant IL-10 transcription after 3, 6 and
12 h. Moreover, the transcriptional induction of IL-10
by hypoxia ⁄ SD was abolished by the p38 inhibitor
SB202190 but was unexpectedly augmented by the pro-
teasomal inhibitor MG132 and by LPS (Fig. 7B).

Next, the secretion of IL-10 from hypoxia⁄ SD-stimu-
lated MSCs was examined by ELISA. As shown in
Fig. 7C, a small amount of IL-10 release from MSCs
was detected at the 6-h time point, and this release
was elevated at the 12-h time point. Furthermore,
IL-10 secretion was augmented by the presence of LPS
at each time point.
IL-10 inhibits cardiac fibroblast proliferation and
collagen expression
The molecular mass of IL-10 is 19 kDa, which is
< 30 kDa and thus part of the MSCs-CM fraction
that inhibited cardiac fibroblast proliferation and colla-
gen synthesis (Fig. 1B). To investigate the potential
contribution of IL-10 to the paracrine effects of MSCs,
the influence of IL-10 on cardiac fibroblast prolifera-
tion was characterized using a 5-bromodeoxyuridine
(BrdU) incorporation assay. As shown in Fig. 8A,B,
different IL-10 concentrations significantly inhibited
A
B
C
Fig. 6. Hypoxia ⁄ SD-stimulated MSCs
require a second signal for IL-1b and TNF-a
release. (A) The results of ELISA analysis of
supernatants from MSCs after hypoxia ⁄ SD
stimulation for 12 h in the presence and
absence of ATP and LPS. (B) Representative
western blots for TNF-a expression in MSCs
stimulated by hypoxia ⁄ SD in the presence
or absence of LPS for the indicated number

of h. *, nonspecific band. (C) The results of
ELISA analysis of supernatants from MSCs
after hypoxia ⁄ SD stimulation for 12 h in the
presence or absence of LPS.
A
C
B
Fig. 7. Hypoxia ⁄ SD induces expression and
secretion of IL-10. (A) Relative IL-10 mRNA
levels in MSCs stimulated by hypoxia ⁄ SD
for the indicated number of hours. Data are
the mean ± SEM of at least three indepen-
dent experiments. *P < 0.05 versus control
group (0 h). (B) Relative IL-10 mRNA levels
in MSCs after hypoxia ⁄ SD treatment for 6 h
in the presence and absence of various
reagents. *P < 0.05 versus control group;
##P < 0.01 versus hypoxia ⁄ SD treatment
group. (C) The results of ELISA analysis of
supernatants from MSCs after hypoxia ⁄ SD
stimulation for the indicated number of
hours in the presence or absence of LPS.
*P < 0.05 versus 6-h group; **P < 0.01
versus 12 h group.
Z. Li et al. Paracrine anti-fibrotic effects of MSCs in vitro
FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS 3693
BrdU incorporation into cardiac fibroblast under nor-
mal 10% fetal bovine serum or serum-free culture con-
ditions. IL-10 also decreased type I and III collagen
and a-smooth muscle actin mRNA levels in cardiac

fibroblasts (Fig. 8C). Moreover, IL-10 effectively limited
angiotensin II-induced type I and III collagen protein
expression (Fig. 8D). These results indicate that IL-10
can inhibit cardiac fibroblast proliferation and collagen
expression, suggesting a paracrine, anti-fibrotic role for
this factor.
Discussion
In this study, we focused on the paracrine effects of
MSCs on cardiac fibroblast proliferation and collagen
expression, as well as the possible paracrine roles of
IL-1b, TNF-a and IL-10 in cardiac fibrosis. First, our
results demonstrate that MSCs-CM have significant
anti-fibrotic effects, as indicated by decreased [
3
H]-thy-
midine and [
3
H]-proline incorporation by cardiac
fibroblasts. Moreover, we found that < 30 kDa compo-
nents of MSCs-CM play the dominant anti-fibrotic
role, suggesting that these anti-fibrotic factors may be
soluble small molecules. Second, our data show that
hypoxia ⁄ SD induces NF-jB-dependent IL-1b and TNF-
a transcriptional upregulation. However, these two fac-
tors are not secreted from hypoxia ⁄ SD-stimulated
MSCs unless a second signalling stimulus is present.
This finding suggests that the paracrine roles of TNF-a
and IL-1b after MSC transplantation may be negli-
gible. Third, we determined that hypoxia ⁄ SD induces
transcription and secretion of IL-10, which signifi-

cantly inhibits cardiac fibroblast proliferation and
collagen expression. MSC-secreted IL-10 may thus
play a role in the attenuation of cardiac fibrosis under
ischaemic conditions.
NF-jB is a ubiquitous protein transcription factor
that induces a variety of genes affecting the inflamma-
tory processes [24,25]. Normally, NF-jB is inactive
and coupled to IjB protein [26,27]. Based on our
study, we hypothesize that hypoxia ⁄ SD stimulates the
phosphorylation and ubiquitin-related degradation of
IjB. The active form of NF-jBp65 is then released
and translocated into the nucleus to activate the tran-
scription of IL-1b and TNF-a. In this report, hypox-
ia ⁄ SD-induced IL-1b and TNF-a transcription were
abolished by the ERK1 ⁄ 2 inhibitor U0126, suggesting
that hypoxia ⁄ SD-induced NF-jB activation is depen-
dent on ERK1 ⁄ 2 signalling. However, the p38 inhibi-
tor SB202190 only partly inhibited hypoxia ⁄ SD-
induced IL-1b transcription and failed to affect the
TNF-a mRNA levels. Activation of p38 may thus be
involved in the regulation of IL-1b mRNA stability by
a mechanism independent of NF-jB signalling.
Pro-IL-1b is synthesized in the cytosol of activated
cells without a signal sequence, precluding secretion
via the classical endoplasmic reticulum–Golgi route
[28]. Processing of pro-IL-1b into its active form
AB
CD
Fig. 8. MSC-secreted IL-10 is involved in the inhibition of cardiac fibrosis. (A) BrdU incorporation in cardiac fibroblasts grown in standard
DMEM at 24 h after IL-10 treatment at different concentrations. **P < 0.01 and ***P < 0.001 versus Cont group. (B) BrdU incorporation in

cardiac fibroblasts grown in DMEM with 10% fetal bovine serum at 24 h after IL-10 treatment at different concentrations. **P < 0.01 and
***P < 0.001 versus 10% fetal bovine serum treatment group. (C) The relative mRNA levels of collagen I, collagen III and a-smooth muscle
actin (a-SMA) in cardiac fibroblasts in the presence and absence of IL-10. *P < 0.05 and **P < 0.01 versus Cont group. (D) Representative
western blots for collagen I and III in the presence and absence of 0.1 l
M angiotensin II and IL-10.
Paracrine anti-fibrotic effects of MSCs in vitro Z. Li et al.
3694 FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS
requires caspase 1 [29], which is itself activated by a
molecular scaffold termed the inflammasome [23]. It is
generally accepted that such IL-1b generation and
secretion by monocytes occurs in two steps. First, an
inflammatory signal, such as the endotoxin LPS, pro-
motes the synthesis and cytoplasmic accumulation of
pro-IL-1b. A second signal, in the form of exogenous
ATP, triggers caspase 1-mediated processing of pro-IL-
1b and secretion of the mature cytokine [30,31]. In our
study, hypoxia ⁄ SD enhanced the transcription and
translation of pro-IL-1b as well as the cleavage of pro-
IL-1b into mature IL-1b. However, IL-1b was not
released from hypoxia ⁄ SD-stimulated MSCs unless
ATP or LPS was present.
Interestingly, although hypoxia ⁄ SD induced signifi-
cant TNF-a transcription, the translation of TNF-a
remained unchanged even when TNF-a transcription
was inhibited by MG132 or BAY 11-7082. The exact
reason for the translational repression of TNF-a is
unclear, but there are at least two possibilities: micro-
RNA-mediated TNF-a mRNA translational silencing
or TNF-a mRNA AU-rich element-mediated post-
transcriptional regulation involving AU-rich element-

binding proteins and processing bodies (P-bodies) [32].
Such AU-rich element-mediated translational repres-
sion of TNF-a may strongly correlate with IL-10 secre-
tion by MSCs [33].
LPS preconditioning enhances the efficacy of MSC
transplantation in a rat model of acute myocardial
infarction, resulting in superior therapeutic neovascu-
larization and decreased fibrosis [34]. Meanwhile, IL-10
has been reported to inhibit fibrosis in the liver [16],
kidney [15] and airway [35]. In this study, we found
that LPS significantly augmented hypoxia ⁄ SD-induced
IL-10 transcription and secretion. Furthermore, IL-10
effectively inhibited cardiac fibroblast proliferation and
collagen expression in vitro, suggesting that IL-10 has
the potential to prevent cardiac fibrosis. Thus, we
hypothesize that the enhanced anti-fibrotic effects of
LPS preconditioning may be because of increased
IL-10 secretion induced by LPS. MG132 also signifi-
cantly inhibited hypoxia ⁄ SD-induced MSC apoptosis
in vitro (data not shown) and enhanced IL-10 expres-
sion. Therefore, MG132 preconditioning may provide
another effective strategy of maximizing the viability,
paracrine effects and biological and functional proper-
ties of MSCs.
In conclusion, our work demonstrates that hypox-
ia ⁄ SD increases the transcription but not the secretion
of IL-1b and TNF-a, suggesting that the roles of these
factors in the paracrine effects of MSCs are negligible.
However, hypoxia ⁄ SD also enhances the transcription
and secretion of IL-10, which may be an important

mediator of the cells’ paracrine anti-fibrotic effects.
These findings help to improve our understanding of
the cellular and molecular basis of MSCs’ anti-inflam-
matory and paracrine effects.
Materials and methods
Materials
Iscove’s modified Dulbecco’s medium (IMDM), Dulbecco’s
modified Eagle’s medium (DMEM) and Trizol reagent were
purchased from Invitrogen (Carlsbad, CA, USA). M-MLV
reverse transcriptase was obtained from Promega (Madison,
WI, USA) and Power SYBR Green PCR Master Mix was
purchased from Applied Biosystems (Foster City, CA,
USA). SB202190, U0126, MG132, BAY 11-7082, LPS and
angiotensin II were obtained from Sigma (St. Louis, MO,
USA). The BrdU cell proliferation assay kit was acquired
from Calbiochem (Gibbstown, NJ, USA). ELISA detection
kits for IL-1b, TNF-a and IL-10 as well as antibodies
against IL-1b and TNF-a were obtained from R&D Sys-
tems (Minneapolis, MN, USA), whereas antibodies against
ERK, phospho-ERK1 ⁄ 2, p38 and phospho-p38 were pur-
chased from Cell Signalling Technology (Danvers, MA,
USA). Antibodies against NF-jBp65, caspase 1, collagen I,
collagen III and b-actin and horseradish peroxidise-conju-
gated secondary antibodies were manufactured by Santa
Cruz Biotechnology (Santa Cruz, CA, USA).
Cell culture, inhibitor treatment and conditioned
medium collection
Isolation and expansion of MSCs were conducted as previ-
ously reported [20]. Briefly, bone marrow was harvested
from the tibias and femurs of 80 g rats, plated in IMDM

supplemented with 15% heat-inactivated fetal bovine serum
and 100 UÆmL
)1
penicillin ⁄ streptomycin and incubated at
37 °C in a humidified tissue culture incubator containing
5% CO
2
. The medium was replaced 4 h after plating and
24 h later to remove nonadherent hematopoietic cells.
Adherent MSCs were further grown in medium, which was
replaced every 48 h. The MSCs used in subsequent experi-
ments had been passaged one to three times. All procedures
were approved by the Animal Care Committee of the
Cardiovascular Institute and Fu Wai Hospital ( Beijing, China).
For inhibitor-based studies, 15 lm SB202190 (p38 inhibi-
tor) [36,37], 20 lm U0126 (ERK1⁄ 2 inhibitor) [20], 10 lm
MG132 (proteasome inhibitor) or 5 lm BAY 11-7082
(NF-jB inhibitor) was preincubated with MSCs in com-
plete medium for 1 h. The cells were subsequently washed
in serum-free IMDM and exposed to hypoxia ⁄ SD in the
continued presence of inhibitor. Hypoxic conditions were
generated by incubating the MSCs at 37 °C in a sealed
hypoxic GENbox jar fitted with a catalyst to scavenge free
oxygen, as described previously [20].
Z. Li et al. Paracrine anti-fibrotic effects of MSCs in vitro
FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS 3695
MSC-CM was generated as follows. First, 80% confluent
cells were administered serum-free DMEM and incubated
for 6 h under hypoxic conditions. The medium was then
collected, clarified by centrifugation and divided into > 30

and < 30 kDa components using 30 kDa molecular mass
cut-off ultrafiltration membranes (Millipore, Billerica, MA,
USA) if necessary. As a control, plates containing medium
alone were also subjected to the same conditions.
Neonatal cardiac fibroblasts were isolated from Sprague–
Dawley rats (1–3 days old) and characterized as previously
described [38]. All experiments were performed on the sec-
ond or third passage of cardiac fibroblasts after starvation
in serum-free DMEM for 24 h. The cells were then treated
with control medium or MSCs-CM.
[
3
H]-Thymidine and [
3
H]-proline uptake assays
Cardiac fibroblasts were transferred to 24-well plates,
starved of serum for 24 h and then stimulated with stan-
dard medium or MSCs-CM for 24 h. [
3
H]-Thymidine or
[
3
H]-proline (Institute of High Energy Physics, Chinese
Academy of Sciences, Beijing, China) was added to each
well to a final concentration of 1 lCiÆmL
)1
during the last
6 h of incubation. Stimulation was terminated by rinsing
the cardiac fibroblasts three times with NaCl⁄ P
i

and then
adding ice-cold 10% trichloroacetic acid for 30 min. Cell
precipitates were washed three times with ice-cold NaCl ⁄ P
i
and then solubilized in 1% SDS with 0.1 m sodium hydrox-
ide overnight at room temperature. The radioactivity of
SDS-soluble protein was determined by liquid scintillation
spectrometry (Beckman Model LS6000-SC, Brea, CA, USA).
RNA extraction and real-time PCR analysis
Total RNA was extracted from MSCs using Trizol reagent
according to the manufacturer’s instructions. Next, cDNA
was generated from 2 lg of total RNA using M-MLV
reverse transcriptase and oligo(dT)18 primer. Real-time
PCR was performed in a total volume of 25 lL containing
0.5 lL RT product, 0.5 lm primers and 12.5 lL Power
SYBR Green PCR Master Mix. Glyceraldehyde-3-phos-
phate dehydrogenase mRNA amplified from the same sam-
ples served as an internal control. The relative expression
of each targeted gene was normalized by subtracting the
corresponding glyceraldehyde-3-phosphate dehydrogenase
threshold cycle (Ct) values using the DDCt comparative
method. The sequences of all primers used in this work are
as follows: IL-1b:5¢-GCTGTGGCAGCTACCTATGT-
CTTG-3¢ and 5¢-AGG TCGTCATCATCC CACGAG-3¢;TNF-a:
5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC
CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5 ¢-CAGACCC
ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA
CCCAAGTA-3¢; collagen I: TCCTGGCAATCGTGGTT
CAA and ACCAGCTGGGCCAACATTTC; collagen III:
TGGACAGATGCTGGTGCTGAG and GAAGGCCAG

CTGTACATCAAGGA; alpha smooth muscle actin
(a-SMA): AGCCAGTCGCCATCAGGAAC and CCGG
AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate
dehydrogenase: 5¢-GGCACAGTCAAGGCTGAGAATG-3¢
and 5¢-ATGGTGGTGAAGACGCCAGTA-3¢.
Immunocytochemical staining for NF-jBp65
MSCs in IMDM supplemented with 10% fetal bovine
serum were plated on six-well glass slides. When the cells
reached 70–80% confluence, they were preincubated with
U0126 or BAY 11-7082 as described above and exposed to
hypoxia ⁄ SD for 6 h. The cells were then fixed in 2% para-
formaldehyde in NaCl ⁄ P
i
for 30 min, washed twice with
NaCl ⁄ P
i
and permeabilized with 0.3% Triton X-100 in
NaCl ⁄ P
i
for 1 0 min. N ext, the MSCs were blocked in 2% goat
serum for 1 h and incubated with rabbit anti-(NF-jBp65
primary IgG) for 1–2 h. The cells were then washed and
incubated with rhodamine-labelled goat anti-(rabbit second-
ary IgG). After three NaCl ⁄ P
i
washes and incubation with
the nuclear stain 4¢,6-diamidino-2-phenylindone for 20 min,
the MSCs were washed in NaCl ⁄ P
i
for 10 min and

mounted in gelvatol for microscopic imaging.
Protein extraction and western blotting analysis
Lysates of stimulated cells were prepared and subjected to
SDS ⁄ PAGE as previously described [20]. Briefly, stimulated
cells were rinsed twice with ice-cold NaCl ⁄ P
i
and lysed in
ice-cold lysis buffer for 30 min. Cell lysates were then cen-
trifuged at 13 000 g for 10 min at 4 °C and their protein
concentrations were determined by the BCA Protein Assay.
Lysate amounts allowing equal protein loading between
lanes were determined and mixed with 5 · SDS sample buf-
fer, boiled for 5 min and separated by 10–15% SDS ⁄ PAGE
before transferring the proteins onto nitrocellulose mem-
branes by semi-dry transfer. After blocking in 5% skim
milk for 1 h, the membranes were rinsed and incubated
overnight at 4 °C with gentle shaking and with the appro-
priate diluted primary antibody in 5% BSA, 1 · Tris-buf-
fered saline (TBS) and 0.1% Tween-20 (TBS ⁄ T). Excess
antibody was then removed by washing the membranes
with TBS ⁄ T and subsequent incubation with horseradish
peroxidase-conjugated secondary antibody for 1 h at room
temperature. After further washes in TBS ⁄ T, the bands
were visualized using an enhanced chemiluminescence
detection kit and radiographic film exposure.
ELISA analysis of IL-1b, TNF-a and IL-10 secretion
by MSCs
The MSCs-CM was concentrated 20 · by ultrafiltration
using 10 kDa molecular mass cut-off ultrafiltration mem-
branes (Millipore) following the manufacturer’s instruc-

tions. Production of IL-1b, TNF-a and IL-10 by MSCs
Paracrine anti-fibrotic effects of MSCs in vitro Z. Li et al.
3696 FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS
was then determined by ELISA using the commercially
available kits mentioned earlier according to the manufac-
turer’s instructions. Absorbance was measured at 450 nm
using a microplate reader. Results were compared with a
standard curve constructed by titrating rat IL-1b, TNF-a
and IL-10.
BrdU incorporation assay
Cardiac fibroblasts were transferred to 96-well plates,
starved of serum for 24 h and stimulated with IL-10 for
24 h. DNA synthesis at 24 h was measured using a BrdU
ELISA kit. Briefly, the cells were incubated for 4 h at
37 °C with 20 lLÆwell
)1
of BrdU. The supernatant was then
removed and the cells were fixed in 200 lL Æwell
)1
of FixDe-
nat for 30 min at room temperature. Subsequently, anti-
BrdU Ig, horseradish peroxidase-conjugated goat anti-
(mouse IgG) and substrate solution were applied to the
wells. The absorbance of the samples was measured at
450 nm using a microplate reader.
Statistical analysis
Data are expressed as the mean ± SEM. Differences
among groups were tested by one-way analysis of variance
(ANOVA). Comparisons between two groups were
evaluated using Student’s t-test. A value of P < 0.05 was

considered statistically significant.
Acknowledgement
This study was supported by the National Natural
Science Foundation of China (30871024) and the Major
National Basic Research Program in the People’s
Republic of China (Program 973, 2007CB512108 &
2010CB529508).
References
1 Pittenger MF, Mackay AM, Beck SC, Jaiswal RK,
Douglas R, Mosca JD, Moorman MA, Simonetti DW,
Craig S & Marshak DR (1999) Multilineage potential
of adult human mesenchymal stem cells. Science 284,
143–147.
2 Porada CD, Zanjani ED & Almeida-Porad G (2006)
Adult mesenchymal stem cells: a pluripotent population
with multiple applications. Curr Stem Cell Res Ther 1,
365–369.
3 Wang XJ & Li QP (2007) The roles of mesenchymal
stem cells (MSCs) therapy in ischemic heart diseases.
Biochem Biophys Res Commun 359, 189–193.
4 Gnecchi M, He H, Liang OD, Melo LG, Morello F,
Mu H, Noiseux N, Zhang L, Pratt RE, Ingwall JS et al.
(2005) Paracrine action accounts for marked protection
of ischemic heart by Akt-modified mesenchymal stem
cells. Nat Med 11, 367–368.
5 Kinnaird T, Stabile E, Burnett MS, Lee CW, Barr S,
Fuchs S & Epstein SE (2004) Marrow-derived stromal
cells express genes encoding a broad spectrum of arteri-
ogenic cytokines and promote in vitro and in vivo arte-
riogenesis through paracrine mechanisms. Circ Res 94,

678–685.
6 Ohnishi S, Yasuda T, Kitamura S & Nagaya N (2007)
Effect of hypoxia on gene expression of bone marrow-
derived mesenchymal stem cells and mononuclear cells.
Stem Cells 25, 1166–1177.
7 Li L, Zhang S, Zhang Y, Yu B, Xu Y & Guan Z
(2009) Paracrine action mediates the antifibrotic effect
of transplanted mesenchymal stem cells in a rat model
of global heart failure. Mol Biol Rep 36, 725–731.
8 Li L, Zhang Y, Li Y, Yu B, Xu Y, Zhao S & Guan Z
(2008) Mesenchymal stem cell transplantation attenu-
ates cardiac fibrosis associated with isoproterenol-
induced global heart failure. Transpl Int 21, 1181–1189.
9 Tang J, Wang J, Guo L, Kong X, Yang J, Zheng F,
Zhang L & Huang Y (2010) Mesenchymal stem cells
modified with stromal cell-derived factor 1 alpha
improve cardiac remodeling via paracrine activation of
hepatocyte growth factor in a rat model of myocardial
infarction. Mol Cell 29 , 9–19.
10 Palmer JN, Hartogensis WE, Patten M, Fortuin FD &
Long CS (1995) Interleukin-1 beta induces cardiac myo-
cyte growth but inhibits cardiac fibroblast proliferation
in culture. J Clin Invest 95, 2555–2564.
11 Guo J, Lin GS, Bao CY, Hu ZM & Hu MY (2007)
Anti-inflammation role for mesenchymal stem cells
transplantation in myocardial infarction. Inflammation
30, 97–104.
12 Liu N, Chen R, Du H, Wang J, Zhang Y & Wen J
(2009) Expression of IL-10 and TNF-alpha in rats with
cerebral infarction after transplantation with mesenchy-

mal stem cells. Cell Mol Immunol 6, 207–213.
13 Semedo P, Palasio CG, Oliveira CD, Feitoza CQ,
Goncalves GM, Cenedeze MA, Wang PM, Teixeira VP,
Reis MA, Pacheco-Silva A et al. (2009) Early
modulation of inflammation by mesenchymal stem cell
after acute kidney injury. Int Immunopharmacol 9,
677–682.
14 Garantziotis S, Brass DM, Savov J, Hollingsworth JW,
McElvania-TeKippe E, Berman K, Walker JK &
Schwartz DA (2006) Leukocyte-derived IL-10 reduces
subepithelial fibrosis associated with chronically inhaled
endotoxin. Am J Respir Cell Mol Biol 35, 662–667.
15 Mu W, Ouyang X, Agarwal A, Zhang L, Long DA,
Cruz PE, Roncal CA, Glushakova OY, Chiodo VA,
Atkinson MA et al. (2005) IL-10 suppresses
chemokines, inflammation, and fibrosis in a model of
chronic renal disease. J Am Soc Nephrol 16, 3651–
3660.
Z. Li et al. Paracrine anti-fibrotic effects of MSCs in vitro
FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS 3697
16 Lan L, Chen Y, Sun C, Sun Q, Hu J & Li D (2008)
Transplantation of bone marrow-derived hepatocyte
stem cells transduced with adenovirus-mediated IL-10
gene reverses liver fibrosis in rats. Transpl Int 21,
581–592.
17 Nemeth K, Leelahavanichkul A, Yuen PS, Mayer B,
Parmelee A, Doi K, Robey PG, Leelahavanichkul K,
Koller BH, Brown JM et al. (2009) Bone marrow stro-
mal cells attenuate sepsis via prostaglandin E(2)-depen-
dent reprogramming of host macrophages to increase

their interleukin-10 production. Nat Med 15, 42–49.
18 Lu WQ, Qiu Y, Li TJ, Tao X, Sun LN & Chen WS
(2009) Timosaponin B-II inhibits pro-inflammatory
cytokine induction by lipopolysaccharide in BV2 cells.
Arch Pharm Res 32, 1301–1308.
19 Shao DZ & Lin M (2008) Platonin inhibits LPS-induced
NF-kappaB by preventing activation of Akt and
IKKbeta in human PBMC. Inflamm Res 57, 601–606.
20 Chen J, Baydoun AR, Xu R, Deng L, Liu X, Zhu W,
Shi L, Cong X, Hu S & Chen X (2008) Lysophospha-
tidic acid protects mesenchymal stem cells against
hypoxia and serum deprivation-induced apoptosis. Stem
Cells 26, 135–145.
21 Li Z, Wei H, Liu X, Hu S, Cong X & Chen X (2010)
LPA rescues ER stress-associated apoptosis in hypoxia
and serum deprivation-stimulated mesenchymal stem
cells. J Cell Biochem, doi:10.1002/jcb.22731.
22 Rutault K, Hazzalin CA & Mahadevan LC (2001)
Combinations of ERK and p38 MAPK inhibitors
ablate tumour necrosis factor-alpha (TNF-alpha)
mRNA induction. Evidence for selective destabilization
of TNF-alpha transcripts. J Biol Chem 276, 6666–6674.
23 Martinon F, Burns K & Tschopp J (2002) The inflam-
masome: a molecular platform triggering activation of
inflammatory caspases and processing of proIL-beta.
Mol Cell 10, 417–426.
24 Li Q & Verma IM (2002) NF-kappaB regulation in the
immune system. Nat Rev Immunol 2, 725–734.
25 Richmond A (2002) Nf-kappa B, chemokine gene tran-
scription and tumour growth. Nat Rev Immunol 2,

664–674.
26 Whiteside ST & Israel A (1997) I kappa B proteins:
structure, function and regulation. Semin Cancer Biol 8,
75–82.
27 Karin M & Ben-Neriah Y (2000) Phosphorylation
meets ubiquitination: the control of NF-[kappa]B
activity. Annu Rev Immunol 18, 621–663.
28 Rubartelli A, Cozzolino F, Talio M & Sitia R (1990)
A novel secretory pathway for interleukin-1 beta, a pro-
tein lacking a signal sequence. EMBO J 9, 1503–1510.
29 Thornberry NA, Bull HG, Calaycay JR, Chapman KT,
Howard AD, Kostura MJ, Miller DK, Molineaux SM,
Weidner JR, Aunins J et al. (1992) A novel heterodi-
meric cysteine protease is required for interleukin-1 beta
processing in monocytes. Nature 356, 768–774.
30 Perregaux DG, McNiff P, Laliberte R, Conklyn M &
Gabel CA (2000) ATP acts as an agonist to promote
stimulus-induced secretion of IL-1 beta and IL-18 in
human blood. J Immunol 165, 4615–4623.
31 Mehta VB, Hart J & Wewers MD (2001) ATP-stimulated
release of interleukin (IL)-1beta and IL-18 requires
priming by lipopolysaccharide and is independent of
caspase-1 cleavage. J Biol Chem 276 , 3820–3826.
32 Nguyen Chi M, Chalmel F, Agius E, Vanzo N, Khabar
KS, Jegou B & Morello D (2009) Temporally regulated
traffic of HuR and its associated ARE-containing
mRNAs from the chromatoid body to polysomes
during mouse spermatogenesis. PLoS ONE 4, e4900.
33 Kontoyiannis D, Kotlyarov A, Carballo E, Alexopou-
lou L, Blackshear PJ, Gaestel M, Davis R, Flavell R &

Kollias G (2001) Interleukin-10 targets p38 MAPK to
modulate ARE-dependent TNF mRNA translation and
limit intestinal pathology. EMBO J 20
, 3760–3770.
34 Yao Y, Zhang F, Wang L, Zhang G, Wang Z, Chen J
& Gao X (2009) Lipopolysaccharide preconditioning
enhances the efficacy of mesenchymal stem cells
transplantation in a rat model of acute myocardial
infarction. J Biomed Sci 16, 74–84.
35 Wilson MS, Elnekave E, Mentink-Kane MM, Hodges
MG, Pesce JT, Ramalingam TR, Thompson RW,
Kamanaka M, Flavell RA, Keane-Myers A et al. (2007)
IL-13Ralpha2 and IL-10 coordinately suppress airway
inflammation, airway-hyperreactivity, and fibrosis in
mice. J Clin Invest 117, 2941–2951.
36 Liu CH & Hwang SM (2005) Cytokine interactions in
mesenchymal stem cells from cord blood. Cytokine 32,
270–279.
37 Kitamura H & Okazaki M (2005) AG-041R, a novel
indoline-2-one derivative, stimulates chondrogenesis in a
bipotent chondroprogenitor cell line CL-1. Osteoarthri-
tis Cartilage 13, 287–296.
38 Chen J, Han Y, Zhu W, Ma R, Han B, Cong X, Hu S
& Chen X (2006) Specific receptor subtype mediation of
LPA-induced dual effects in cardiac fibroblasts. FEBS
Lett 580, 4737–4745.
Supporting information
The following supplementary material is available:
Fig. S1. Dose–response data for U0126 and SB202190.
This supplementary material can be found in the

online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
Paracrine anti-fibrotic effects of MSCs in vitro Z. Li et al.
3698 FEBS Journal 277 (2010) 3688–3698 ª 2010 The Authors Journal compilation ª 2010 FEBS