Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

The Saccharomyces cerevisiae vacuolar acid trehalase is
targeted at the cell surface for its physiological function
Susu He1,2,3, Kerstin Bystricky4,5, Sebastien Leon6, Jean M. Francois1,2,3 and Jean L. Parrou1,2,3
¸
1
2
3
4
5
6

University of Toulouse, INSA, UPS, INP & INRA, France
´
`
´ ´
INRA-UMR 792 Ingenierie des Systemes Biologiques et procedes, Toulouse, France
CNRS-UMR 5504, Toulouse, France
´
Laboratoire de Biologie Moleculaire Eucaryote, University of Toulouse, France
CNRS-UMR5099, Toulouse, France
´
Institut Jacques Monod, UMR7592 CNRS ⁄ Universite Paris Diderot, France

Keywords
acid trehalase; cell surface; fluorescence
microscopy; Saccharomyces cerevisiae;
secretion
Correspondence
J. M. Francois, University of Toulouse,
¸
INSA, UPS, INP & INRA, 135, Avenue de

Rangeuil, F-31077, Toulouse, France
Fax: +33 5 6155 9400
Tel: +33 5 6155 9492
E-mail:
(Received 6 May 2009, revised 9 June
2009, accepted 21 July 2009)
doi:10.1111/j.1742-4658.2009.07227.x

Previous studies in the yeast Saccharomyces cerevisiae have proposed a vacuolar localization for Ath1, which is difficult to reconcile with its ability to
hydrolyze exogenous trehalose. We used fluorescent microscopy to show
that the red fluorescent protein mCherry fused to the C-terminus of Ath1,
although mostly localized in the vacuole, was also targeted to the cell surface. Also, hybrid Ath1 truncates fused at their C-terminus with the yeast
internal invertase revealed that a 131 amino acid N-terminal fragment of
Ath1was sufficient to target the fusion protein to the cell surface, enabling
growth of the suc2D mutant on sucrose. The unique transmembrane domain
appeared to be indispensable for the production of a functional Ath1, and
its removal abrogated invertase secretion and growth on sucrose. Finally,
the physiological significance of the cell-surface localization of Ath1 was
established by showing that fusion of the signal peptide of invertase to
N-terminal truncated Ath1 allowed the ath1D mutant to grow on trehalose,
whereas the signal sequence of the vacuolar-targeted Pep4 constrained Ath1
in the vacuole and prevented growth of this mutant on trehalose. Use of
trafficking mutants that impaired Ath1 delivery to the vacuole abrogated
neither its activity nor its growth on exogenous trehalose.

Introduction
Trehalose [alpha-d-glucopyranosyl (1 fi 1) alpha-dgluocopyranoside] is a nonreducing disaccharide found
in many organisms including yeasts, fungi, bacteria,
plants and insects. Trehalose is one of the major storage
carbohydrates in the yeast Saccharomyces cerevisiae,

accounting for > 25% of cell dry mass depending on
the growth conditions and the life-cycle stage of the yeast
[1–3]. The accumulation of intracellular trehalose has
two potential functions. First, it constitutes an endogenous storage of carbon and energy during spore germination and in resting cells. Second, trehalose acts as a
stabilizer of cellular membranes and proteins [4–6].

In S. cerevisiae, trehalose is hydrolyzed to glucose
by the action of two types of trehalase: ‘neutral trehalases’ encoded by NTH1 and NTH2 [3,7], which are
optimally active at pH 7, and ‘acid trehalases’ encoded
by ATH1, which show optimal activity at pH 4.5 [8].
Although fungal acid trehalases, including those of the
yeast Candida albicans [9] and Kluyveromyces lactis
[10], have been reported to be localized at the cell surface, the localization of the S. cerevisiae acid trehalase
remains a matter of controversy. In 1982, Wiemken
and co-workers [11] first identified this protein in a
vacuole-enriched fraction obtained by density gradient

Abbreviations
EndoH, endoglycosidase H; GH, glycolsyl hydrolase; GP, green fluorescent protein; MVB, multivesicular body; TM, transmembrane.

5432

FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS


S. He et al.

centrifugation of a yeast protoplast preparation. The
vacuolar localization of acid trehalase was very
recently supported by in vivo imaging analyses using

green fluorescent protein (GFP)–Ath1 fusion constructs under the strong and constitutive TPI1 promoter [12]. Furthermore, Huang et al. used various
trafficking mutants to show that this acid trehalase
reaches its vacuolar destination via the multivesicular
body (MVB) pathway. However, this localization contrasts with the fact that this enzyme allows yeast to
grow on exogenous trehalose [13] and with measurable
Ath1 activity at the cell surface [14].
The purpose of this study was to revisit this controversy regarding the localization of Ath1 in light of its
biological function, combining cell biology and biochemical approaches. To this end, we investigated the
localization of Ath1 using strains expressing the red
fluorescent protein mCherry fused to the C-terminus of
Ath1. Integration of this construct at the ATH1 locus
had the advantage of expressing the protein at levels
comparable with those in wild-type cells, because it is
reported that overexpression may cause the mislocalization of proteins into the vacuoles [15], and also to
investigate the fusion protein under physiological conditions. The domain responsible for targeting Ath1 at
the cell surface and the role of the single transmembrane (TM) domain at the N-terminus of this protein
were investigated. The functional localization of Ath1
was further assessed by constructing various Ath1
hybrid proteins bearing different targeting signal peptides. Together, our results demonstrated that the
localization of Ath1 at the cell periphery is required
for growth on trehalose, whereas the vacuolar localization of this protein is not compatible with growth on
this carbon source.

Results
Ath1 is localized at the cell periphery
In a previous report, the localization of S. cerevisiae
Ath1 was visualized using a pGFPATH1 construct
that expressed a GFP fused to the N-terminus of Ath1
under the strong TPI1 promoter [12]. We obtained a
comparable result with a GFP–Ath1 construct that

was expressed under the control of the methioninerepressible MET25 promoter in a glucose medium
lacking methionine (Fig. 1A). However, western blotting using a GFP antibody on extracts from cells
expressing GFP–Ath1 revealed a major band migrating
at a position corresponding to  30 kDa, instead of
bands migrating at > 150 kDa (Fig. 1B). Fluorescence
in the vacuole may therefore be caused by free GFP

Functional localization of Ath1 in S. cerevisiae

which accumulated in this organelle because it has
been reported that targeting of GFP-fusion proteins to
the vacuolar lumen leads to their degradation by vacuolar proteases. However, this degradation process is
usually delayed, leading to the transient accumulation
of GFP-containing proteolytic fragments of  30 kDa,
and a sustained luminal vacuolar fluorescence [16].
Note that a similar result was reported by Huang et al.
[12], although they were also able to detect a band
corresponding to the native GFP–Ath1.
This proteolytic problem, coupled with the fact that
overexpression under a strong promoter has been
reported to mislocalize some proteins into vacuoles
[15], prompted us to re-examine the localization of
Ath1 by fusing of GFP to its C-terminus, and expressing the corresponding ATH1–GFP fusion gene under
the native promoter after integration at ATH1 locus.
Under this condition, we were able to observe a green
signal at the cell periphery, although most of the signal
was still localized in the lumen of the vacuole
(Fig. 1C). Similar results were obtained using the red
fluorescent protein mCherry, which was also integrated
at the ATH1 chromosomal locus, as well as with the

tag fused at the N-terminus of Ath1 (data not shown).
As for Ath1–GFP or GPF–Ath1 (see above), the
Ath1–mCherry fusion protein was fully functional as
indicated by the growth of this recombinant strain on
trehalose and by enzymatic measurement (see below).
Under live cell fluorescence microscopy, we observed a
strong signal in the vacuolar compartment together
with a clearly discernable signal at the cell periphery
(Fig. 1D). These results indicated that Ath1 may have
two localizations, one in the vacuole, in agreement
with previous studies [11,12], and another at the cell
periphery, in accordance with its ability to hydrolyze
exogenous trehalose [14]. We then verified the Ath1–
mCherry fusion protein by western blot. This analysis
made on extracts from yeast cells expressing the chimeric protein revealed a band at a size > 200 kDa with
the rabbit anti-DsRed sera (Fig. 1E). Because this signal disappeared upon endoglycosidase H (EndoH)
treatment, the glycosylation that was reported for this
protein [7] may explain this migration property at an
apparent size much higher than expected. However,
the expected band at a size of 164 kDa
(Ath1 + mCherry) was barely detected upon EndoH
treatment, and instead, a relatively strong band migrating at around 65 kDa could be identified (Fig. 1E).
As a second, independent way to support the localization of Ath1 at the cell periphery, we used the
invertase secretion system. Invertase is a secreted protein with a classical signal peptide at its N-terminus
(amino acids 1–19) for secretion at the cell periphery.

FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS

5433

Functional localization of Ath1 in S. cerevisiae

S. He et al.

Fig. 1. Cellular localization of Ath1. Yeast
cells in the exponential phase (D600  1.0)
expressing fusions of Ath1 to GFP or
mCherry were collected for live cell microscopy (A,C,D) and western blotting (B,E). Bar
length = 2 lm. (A,B) BY4742 ath1D transformed with pGFP–ATH1 under the MET25
promoter in YN glucose without methionine.
(A) (left) fluorescence, (right) DIC. (B) Immunoblot with anti-GFP of crude extract before
()) and after (+) N-deglycosylation by
EndoH; (C) BY4741 bearing ATH1–GFP
integrated at the ATH1 locus in YN
trehalose. (D,E) BY4741 bearing ATH1–
mCherry integrated at the ATH1 locus in YN
trehalose. (D) Microscopy and (E) immunoblot with the DsRed polyclonal antibody of
crude extract before ()) and after (+)
N-deglycosylation by EndoH. M, Molecular
mass marker; arrowhead, expected fulllength fusion protein at 150 kDa; asterisk,
degradation product.

Deletion of this signal peptide (suc2ic allele) prevents
secretion and results in the accumulation of the truncated form of the enzyme in the cell, impairing the
ability of S. cerevisiae to grow on sucrose or raffinose
as the sole carbon source. We generated an inframe
fusion of full-length ATH1 and suc2ic (pSC1–ATH1),
leading to the chimeric Ath1–Suc2 protein expressed
under the ATH1 promoter. As shown in Fig. 2, suc2D

mutant expressing this gene construct recovered

growth on sucrose, like the positive control expressing
the full-length secreted invertase under its own promoter (pLC1), whereas suc2D mutant transformed with
pSC1 lacking of signal peptide grew very poorly on
sucrose, probably using amino acids present in the
medium (Fig. 2B). Consistent with this, these cells also
recovered invertase activity in both crude extract and
intact cells (Fig. 3), albeit five times lower than that
measured in suc2D mutant transformed with pLC1.

Fig. 2. Complementation of the S. cerevisiae SEY6210 strain (suc2D mutant) with different Ath1–invertase chimera. (A) Schematic representation of the different gene fusion constructs. pSC1, negative control (invertase without signal peptide); pLC1, positive control (full-length invertase);
for the remaining constructs, the Suc2 signal peptide has been replaced by full-length ATH1 sequence (pSC1–ATH1) or N-terminal sequence
variants of ATH1 with decreasing size; (B) growth on YP medium with sucrose (complementation test) or glucose (control) for 5 days.

5434

FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS


S. He et al.

Functional localization of Ath1 in S. cerevisiae

cleavage of the disaccharide by an acid trehalase localized at the cell surface.
Searching for the minimal domain of Ath1 for
invertase secretion

Fig. 3. Invertase activity in the S. cerevisiae SEY6210 strain (suc2D
mutant) transformed with the various Ath1–invertase constructs.

The constructs are those shown in Fig. 2. Transformed cells were
cultivated in YP sucrose medium until the stationary phase before
measurement of invertase activity on intact cells and in crude
extract as described in Experimental procedures. Histograms show
the results of two independent experiments (mean ± SD).

Replacing the ATH1 promoter in pSC1–ATH1 with
the stronger SUC2 promoter resulted in an invertase
activity similar to that in pLC1 (data not shown). We
noticed that the invertase activity in a crude extract of
cells transformed with pLC1 was lower than that in
intact cells. This may be caused by incomplete lysis of
the cells or partial denaturation of proteins during
extraction and vortexing with glass beads
In addition to the cell biology data, we also revalidated our enzymatic assay of acid trehalase. Our current method is based on the measurement of the
activity in intact cells according to the procedure
employed to measure secreted invertase [17], in which
NaF is added to the incubation mixture to block glucose uptake. We verified that the use of NaF did not
cause any enzymatic artifact, for example, cell lysis or
the release of intracellular glucose. First, incubation of
intact cells from an exponential culture grown on
glucose that do not express acid trehalase because of
glucose repression [18] in a reaction mixture optimal
for neutral trehalase activity and containing NaF did
not lead to any glucose production from trehalose
(data not shown). This excluded the possibility of cell
leakage and the release of proteins or intracellular glucose under NaF treatment. Further validation of our
assay was the successful measurement of acid trehalase
activity on intact cells from a mutant completely defective for glucose uptake (hxt1-17D strain) [19] cultivated
on glycerol and ethanol as the carbon source, which

allowed ATH1 expression, even in the absence of NaF
(data not shown). These elements demonstrated that
the glucose measured in intact cells resulted from

Full-length Ath1–invertase fusion protein was targeted
at the cell surface, suggesting the existence of a secretion sequence in Ath1. As shown in Fig. 4, domain
prediction using the smart program [20,21] did not
reveal any classical signal peptide for secretion at the
N-terminus of Ath1. This in silico analysis only
revealed a short 23 amino acid TM domain near the
N-terminus, followed by three ‘glycosyl hydrolase’
(GH) domains (amino acids 132–415, 474–845 and
849–904) that together may constitute the catalytic
domain of Ath1 [22]. To map the minimal domain of
Ath1 that allows the secretion of this protein, various
DNA fragments of ATH1 were fused inframe with the
suc2ic allele (Fig. 2A). A series of plasmids, namely
pSC1–N that carried a fusion to the first 131 N-terminal amino acids of Ath1, pSC1–TM bearing a fusion
to the first 69 amino acids of Ath1, which includes the
TM domain, and pSC1–tm that only bears the first 46
amino acids of Ath1 excluding the TM domain, were
introduced into the suc2D mutant SEY6210. Transformants were tested for growth recovery on sucrose
(Fig. 2B) and for invertase activity (Fig. 3). As shown
in Fig. 2B, suc2D mutant cells transformed with pSC1–
N or pSC1–TM were able to grow on YP sucrose as
readily as pSC1–ATH1, whereas cells transformed with
pSC1–tm poorly grew on sucrose, as did cells bearing
the negative control pSC1.
Invertase activity was measured in intact cells and
crude extracts from suc2D mutant transformed with

these various constructs, compared with growth efficiency on sucrose (Figs 2 and 3). Cells transformed
with pSC1–N showed an activity nearly twofold higher
than that in cells expressing a fusion to the full-length
Ath1 (pSC1–ATH1). One explanation might be that
the full size Ath1 fused to internal invertase somehow

Fig. 4. Ath1 predicted functional domain using the SMART program.
Theoretical glycosylation sites (yellow triangles); N-terminal transmembrane segment (TM); N-term (GH_65N), central (GH_65m) and
C-term (GH_65C) domains from the CAZy glycoside hydrolase
family 65. The latter three domains likely constitute the catalytic
core of trehalase.

FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS

5435


Functional localization of Ath1 in S. cerevisiae

S. He et al.

impairs folding of the invertase domain and ⁄ or the
catalytic efficiency on its substrate. Despite this difference, as for pSC1–ATH1, the activity in intact cells
was comparable with that in cell extract, and both
transformed cells showed similar qualitative growth on
sucrose. The activity measured in intact cells expressing pSC1–TM was four times lower than that in the
crude extract, and two to four times lower than in
intact cells transformed with pSC1–ATH1 and
pSC1–N. Bearing in mind this low activity, pSC1–TM
transformed cells were found to grow slightly more

slowly on sucrose than cells transformed with pSC1–
ATH1. Further reduction at the N-terminus (i.e. with
pSC1–tm) resulted in residual invertase activity in the
crude extract, together with an inability to grow on
sucrose. Taken together, these results showed that a
minimal fragment of 69 amino acids encompassing the
unique TM domain of Ath1 was needed to promote
correct expression of the internal invertase, but was
not sufficient for efficient protein secretion, which was
achieved with a 131 amino acid N-terminus of Ath1.

Fig. 5. The N-terminal domain of Ath1 is needed for the localization
of mCherry at the cell periphery. Live cell microscopy of exponentially growing cells in YN trehalose medium of the BY4741 strain
transformed with pN–mCherry (A) or with path1DN–mCherry (B).

Removal of the N-terminus of Ath1 caused a
strict vacuolar localization
Because the 131 amino acid N-terminus of Ath1
appeared to be sufficient for invertase secretion, we
further investigated the targeting properties of this
fragment by using a mCherry fusion that was
expressed under the control of the ATH1 promoter
(pN–mCherry). Figure 5A shows a fluorescent signal
at the cell periphery and a stronger signal in the vacuole, similar to that observed using full-length Ath1
fused to mCherry (compare Figs 5A and 1D). This
result confirmed that the N-terminal part of Ath1 was
sufficient to target the recipient protein to these two
cellular compartments.
Reciprocally, we analyzed the consequences of deleting the first 100 codons of the ATH1 sequence
(path1DN) on red protein localization. When expressed

in a wild-type strain grown on trehalose, the Ath1DN–
mCherry fusion protein led to a fluorescent signal
exclusively in the vacuole (Fig. 5B). No discernable
signal could be detected at the cell periphery, even
after 10-fold longer exposure times. From this result,
we first verified that a BYath1D mutant transformed
with the centromeric plasmid pATH1 carrying the
wild-type ATH1 gene recovered wild-type characteristics, i.e. growth on trehalose as the sole carbon source
(not shown), and acid trehalase activity in both intact
cells and cell crude extracts (Fig. 6). However, when
this ath1D mutant was transformed by path1DN it was
not able to grow on trehalose (data not shown) and
5436

Fig. 6. Acid trehalase activity of ath1D mutant cells expressing various ATH1 constructs. The BY4741 ath1D mutant strain transformed
with gene constructs expressing different Ath1 variants was cultivated in YN glucose to late exponential phase (D600  8) with plasmid selection. The cells were then collected and transferred to
YPD medium until the stationary phase (D600  20) to allow ATH1
derepression. Acid trehalase activity was measured in intact
cells and crude extracts as described in Experimental Procedures.
Histograms show the results of two independent experiments
(mean ± SD).

had no Ath1 activity (Fig. 6). From these data, we
were able to confirm that the 131 amino acid N-terminal fragment contains important information for
cell-surface targeting, and we suggest that there may
be vacuolar targeting determinants in the catalytic
domain, as in the case of acid phosphatase [23].

FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS

S. He et al.

Substitution of the N-terminus of Ath1 by the
invertase signal peptide restored acid trehalase
activity and growth on trehalose
The exclusive, strong vacuolar signal observed in the
absence of the 100 amino acid N-terminus of Ath1,
together with the subsequent loss of catalytically active
trehalase (Ath1DN variant), suggested that the vacuolar fraction consisted mainly of inactive Ath1. We
therefore asked whether targeting of Ath1 to the cell
periphery could restore trehalase activity. We made
use of the invertase secretion property by fusing the
signal peptide of this protein to the N-terminus of the
Ath1DN variant Fig. 7A). When transformed in ath1D
mutant cells, the resulting plasmid pSPSUC2–
ATH1DN did allow recovery of the growth ability on
trehalose and the acid trehalase activity in both cell
crude extract and intact cells (Fig. 6). Moreover, the
ath1D mutant strain bearing this plasmid grew about
two times faster than wild-type BY4741 strain on synthetic trehalose medium (l = 0.10 versus 0.047;
Fig. 8). Localization of this hybrid protein was verified
by C-terminal fusion to mCherry. Setting our exposure
time as in Fig. 1, we found that the intensity of the
fluorescent signal at the cell periphery was significantly
higher than that of the full-length Ath1–mCherry protein (compare Figs 7B and 1D). However, the bulk of
the fluorescent signal still resided in the vacuolar compartment, which substantiated the idea that the catalytic domain of Ath1 contains some targeting signal
for the vacuole. Using western blot analysis, we found
a 65kDa proteolytic fragment that was already

Functional localization of Ath1 in S. cerevisiae

obtained with the Ath1–mCherry fusion protein
(Fig. 1C), but also a clearly detectable band corresponding to the SPSuc2–Ath1DN–mCherry chimeric
protein after EndoH treatment (173 kDa, Fig. 7C),
indicating better stability for this construct than for
native Ath1. Overall, these results suggest that secretion of Ath1 at the cell periphery is associated with the
stabilization and physiological function of this protein.
Constraining Ath1 to the vacuole impaired
growth on trehalose
Although Ath1 can be targeted to the cell periphery,
the vacuolar localization appeared to be the major destination for this protein, as illustrated by the strong
vacuolar signal obtained using fluorescence microscopy. To check the possible function of the vacuolar
pool of acid trehalase for growth on trehalose, we
sought a strategy to constrain all Ath1 in this intracellular compartment. To this end, we fused the signal
peptide of the vacuolar protein Pep4 [24] to the N-terminus of the truncated Ath1DN variant. Very interestingly, when transformed in ath1D mutant cells, the
plasmid pSPPEP4–ATH1DN did not allow recovery of
the growth on trehalose (Fig. 8), although the cells did
exhibit acid trehalase activity in the crude extract,
which accounted for  50% of the activity measured
in cells expressing SPSuc2–Ath1DN (data not shown).
As shown in Fig. 7D, microscopy analysis confirmed
that the SPPep4–Ath1DN–mCherry chimeric protein
was exclusively targeted to the vacuole when expressed
in the wild-type strain. This strongly indicated that the

Fig. 7. Cellular localization of the Ath1 catalytic core fused to different signal peptides.
(Panel I, A) Schematic representation of
SUC2, PEP4 and ATH1 nucleotide
sequences with emphasis on the 5¢-end

containing targeting information. Nucleotides
1-111 and 1-267 of SUC2 and PEP4, respectively, replaced nucleotides 1-300 of ATH1
giving the SPSUC2–Ath1DN and SPPEP4–
Ath1DN chimeras. (Panel II) BY4741 cells
were transformed with pSPSUC2–ath1DN–
mCherry and cultivated in YN trehalose
medium. Exponential growing cells were
collected for live cell microscopy (B), and
immunoblot on crude extract before ()) and
after (+) deglycosylation with EndoH using
DsRed polyclonal antibody (C). (D) BY4741
cells transformed with pSPPEP4–ath1DN–
mCherry were collected for live cell microscopy. M, molecular mass markers; arrowhead, expected full-length fusion protein;
asterisk, degradation product.

FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS

5437


Functional localization of Ath1 in S. cerevisiae

S. He et al.

Fig. 8. Growth complementation of the ath1D mutant strain on trehalose. After a preculture on a selective YN glucose medium, the
BY4741 ath1D mutant strain expressing the catalytic domain of
Ath1 (amino acids 301 to 1211) fused to signal sequence of Suc2
and Pep4, respectively, were transferred in YN trehalose medium
to evaluate growth complementation. BY4741, positive control;
ath1D, negative control.

vacuolar pool of acid trehalase has no role in trehalose
assimilation for cell growth.
As a complementary approach, we used mutants of
genes involved in the vacuolar sorting pathway, like
VPS4 which encodes a protein implicated in the delivery of proteins from the prevacuolar compartment to
the vacuole [25]. As shown in Fig. 9A, the intracellular
red fluorescent signal derived from Ath1–mCherry was
totally mislocalized in a vps4D mutant, being completely excluded from the lumen of vacuole. However,
the fluorescent signal at the cell periphery was still visible in this vps4D mutant and the relative Ath1 activity

between intact cells and crude extract was identical to
that of wild-type cells (Fig. 9B). The presence of the
Ath1–mCherry fusion protein was also monitored in
this mutant using the rabbit anti-DsRed sera. In
untreated extract, a band migrating at  200 kDa was
relatively comparable in this mutant and the wild-type
(data in Figs 9C and 1C can be compared because similar amount of protein were loaded). After EndoH
treatment, the expected 164 kDa band was visible,
whereas the abundance of the 65 kDa band was drastically reduced compared with that in Fig. 1C, indicating significantly decreased proteolysis of this protein
when preventing vacuolar targeting. Together, these
results confirmed that trehalase in the vacuole is likely
prompted to partial degradation and is not required
for cell growth on trehalose.
The TM domain is indispensable for Ath1
function
Previous studies have indicated that the short TM
domain located at the N-terminus of Ath1 contained
sufficient signaling information to deliver Ath1 to the
vacuole via the MVB pathway [12]. As already

observed when studying invertase fusions, the requirement for a minimal N-terminal fragment encompassing
the TM domain indicated the importance of this
domain in protein expression and secretion (see the
minimal construct pSC1–tm in Figs 2 and 3). We
confirmed this by studying pSC1–ath1DTM and
pSC1–NDTM, in which the TM domain was specifically deleted in the full-length ATH1–SUC2 gene

Fig. 9. Localization and activity of Ath1 in
vps4D mutant. Cells cultivated in YN trehalose medium to the exponential phase were
collected for live cell microscopy (A), and to
test the activity of acid trehalase in intact
cells or cell crude extracts (B), as described
in Experimental Procedures. Histograms
show the results of two independent experiments (mean ± SD). (C) Crude extract from
vps4D cells expressing Ath1–mCherry
immunoblotted with the DsRed polyclonal
antibody, before ()) and after (+)
deglycosylation with EndoH. M, molecular
mass markers. Bar = 2 lm.

5438

FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS


S. He et al.

fusion and in its truncated variant, respectively. When
transformed in suc2D mutant, these constructs did not
restore growth on sucrose or invertase activity

(Fig. 10A). Similarly, when using BYath1D mutant as
a recipient strain for functional complementation by
various Ath1 variants, the plasmid path1DTM, which
expressed an Ath1 protein lacking the TM domain,
was not able to complement growth deficiency of this
mutant on trehalose or yield measurable Ath1 activity
in this strain (data not shown). Finally, when using the
pNDTM–mCherry plasmid that expressed a fusion of
the N-terminal fragment lacking the TM domain to
mCherry, the fluorescence was observed in cytoplasmic
patches distinct from the vacuole (Fig. 10B).
The absence of Ath1 activity in crude extracts when
TM was deleted from the protein prompted us to verify whether removal of this short TM domain may
hamper expression of these constructs. For this purpose, Ath1 and its ath1DTM variant were tagged with
3HA at their N-terminus. The ath1 mutant transformed with pHA–ATH1 expressing the Ath1–HA
fusion protein recovered growth on trehalose, although
the chimeric protein could not be detected by western
blotting, probably because of its very low expression
level. We therefore replaced the ATH1 promoter with
the strong, inducible GAL1 promoter, leading to very
high Ath1 activity in cells transformed with pPGAL1–
HA–ATH1 (data not shown). By contrast, no activity

Functional localization of Ath1 in S. cerevisiae

was measured in cells transformed with pPGAL1–HA–
ath1DTM, although the gene construct was expressed
(data not shown). These results were confirmed by
western blot analysis using anti-HA IgG, which
revealed a band at  130 kDa (wild-type Ath1) after

EndoH treatment of protein extracts from cells
expressing pPGAL1–HA–ATH1; no band was detected
when the TM domain was missing from the protein
(Fig. 10C). These results supported the idea that
absence of the TM domain may lead to a deficiency in
protein production, which likely occurred during the
early steps of endoplasmic reticulum protein synthesis
and ⁄ or during folding.

Discussion
Vacuolar Ath1 is also found at the cell surface
Controversy concerning the localization of Ath1 has
been raised in two recent papers. In a previous study,
we suggested a localization for Ath1 at the cell surface
based on enzymatic data because most Ath1 activity
could be measured in intact cells [14], in a manner similar to that for the secreted invertase [17]. However,
Huang et al. [12] provided several arguments for a
strict vacuolar localization of Ath1, identifying the
MVB pathway as the main transport route for sorting
this protein into the vacuole. In this paper, we used

Fig. 10. Role of the single transmembrane (TM) domain in protein expression. (A) Left, schematic view of chimera proteins Ath1DTM–invertase and NDTM–invertase, respectively. Right, complementation tests of Suc2D mutant by these two constructions on YP sucrose agar for
5 days, and invertase activity (IA). (B) BY4741 cells transformed with plasmid pNDTM–mCherry were cultivated in YN trehalose medium to
the exponential phase and collected for live cell imaging. (C) The HA–ATH1 or HA–ATH1DTM gene constructs expressing Ath1 with or
without the TM sequence tagged with HA under the GAL1 promoter were transformed into ath1D mutant cultivated in YN galactose.
EndoH-treated crude extracts were immunoblotted with the anti-HA IgG. Lane 1, wild-type Ath1 (negative control); lane 2, HA–Ath1; lane 3,
HA–Ath1DTM. M, molecular mass markers.

FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS

5439


Functional localization of Ath1 in S. cerevisiae

S. He et al.

two independent methodologies, fluorescence microscopy and gene fusion to invertase, which together provided evidence that Ath1 is also targeted to the cell
surface. Using the GFP or the red fluorescent protein
mCherry fused to the C-terminus of Ath1, we clearly
observed a localization of Ath1 at the cell periphery,
although the bulk fluorescent signal was still seen in
the vacuole. A possible reason for the failure of Huang
et al. [12] to find Ath1 at the cell periphery may be
that these authors used a GFP–Ath1 construct that
was expressed from the strong constitutive TPI1 promoter, because we obtained similar results using GFP–
Ath1 expressed from another strong MET25 promoter.
However, we examined the localization of Ath1 in cells
expressing either Ath1–GFP or Ath1–mCherry cultivated on trehalose, whereas Huang et al. [12] investigated this localization problem using exponentially
growing cells on glucose. It can be proposed that the
correct localization of Ath1 is dependent on the substrate (in this case, trehalose), as shown for the control
of Fur4 permease by uracile [26]. When expressed
under its own promoter, as in our study, ATH1 is
repressed by glucose [18] and the localization of Ath1
can be examined only in the stationary phase. Thus,
the use of a glucose medium to study the localization
of Ath1 can be cautioned because it is not physiologically relevant for this protein. Further evidence for a
cell-surface localization of Ath1 was obtained by showing that expression of the Ath1–Suc2 protein fusion
allowed recovering suc2D mutant to grow on sucrose,
indicating that the full-length Ath1 protein was able to

drive the yeast internal invertase to the cell surface.
These cell biology data were further supported by the
revalidation of our enzymatic assay of acid trehalase
on intact cells, confirming that glucose measured in
NaF-treated intact cells results from the cleavage of
the disaccharide at the cell surface by an extracellular
‘acid trehalase’ pool [14].
The cell-surface localization accounts for growth
on trehalose
It is known that Ath1 hydrolyzes exogenous trehalose
to grow on this carbon source. Based on an exclusive
vacuolar localization for this protein, two models have
been proposed [27]. The first suggested that Ath1 is
transported to the plasma membrane where it binds to
trehalose located at the cell surface; both trehalose and
trehalase are then internalized by endocytosis into the
vacuole where hydrolysis takes place. According to
the results of Huang et al. [12], this model may be
discarded because transport of Ath1 via the MVB
pathway en route to the vacuole bypasses the plasma
5440

membrane. The second model considered that trehalose alone is delivered to the vacuole by endocytosis,
where it is hydrolyzed by the resident Ath1. However,
this model requires the identification of a trehalose
endocytosis process and this is difficult to reconcile
with mono- and disaccharides entering the cell by
sugar permeases [19], and yeast cells possessing a highaffinity trehalose transporter encoded by AGT1 [28].
Instead, we provide arguments that support a more
simple model [14], in which trehalose can be assimilated by either a Agt1–Nth1 pathway, implicating the

uptake and intracellular hydrolysis by neutral trehalase, or by direct hydrolysis of trehalose by the extracellular acid trehalase encoded by ATH1 into glucose,
which is thereafter taken up by the cells. These two
pathways only function in a MAL-positive strain such
as the CEN.PK background because expression of
AGT1 is MAL dependent. Because the sequenced
BY4741 strain is mal-negative, the assimilation of
exogenous trehalose can rely only on the Ath1-dependent pathway [14]. Moreover, this model is consistent
with what has been shown for fungal and plant acid
trehalases, which are all localized at the cell surface or
cell wall [22,29,30]. In addition to these data, other
results support this model. First, constraining acid trehalase in the vacuole by replacing its 100 amino acid
N-terminal fragment with the signal sequence of the
vacuolar Pep4 [24], a protein known to be specifically
targeted to the vacuole, prevented growth on trehalose.
Second, impairment of Ath1 delivery to the vacuole
using vps4D mutants defective in the MVB pathway
did not abrogate growth on trehalose or the activity of
Ath1 on intact cells.
Although Ath1 is present at the cell periphery, our
data,together with those from Huang et al. [12],
showed an apparent large accumulation of this protein
in the vacuole, as monitored by the fluorescence intensity from GFP- or mCherry-tagged protein. However,
this result contrasted with enzymatic data showing that
Ath1 activity measured in crude extract was only
20–40% higher than that measured in intact cells. One
explanation for this discrepancy can be found from
western blot analysis in which full-length Ath1 fused
to reporter mCherry was barely detected, whereas a
partially proteolysed Ath1 fragment was predominantly observed. Also, use of a vps4D strain impaired
Ath1 delivery to the vacuole and significantly reduced

its proteolysis. Similar observations were obtained with
the vps1D strain (S. He, unpublished), which was initially identified as a protein involved in transport from
the late-Golgi complex to the prevacuolar compartment [31] in the vacuole protein-sorting pathway. To
summarize, these results demonstrated that the vacuole

FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS


S. He et al.

Functional localization of Ath1 in S. cerevisiae

is not the obligate functional destination for Ath1, and
that partial proteolysis of Ath1 could take place in this
subcellular compartment. In contrast, targeting this
enzyme at the cell surface is indispensable for growth
of yeast cells on trehalose.
Ath1 domains relevant for cell-surface targeting
and protein function
The finding that Ath1 could be targeted at the cell
periphery raised questions about secretion determinants because domain-predicting tools did not identify
any sequence feature to explain Ath1 intracellular trafficking. Klionsky and co-workers [12] showed that the
short TM domain located at the N-terminus of Ath1
contained sufficient information to deliver Ath1 to the
vacuole via the MVB pathway. They reached this conclusion using a chimeric construct in which only the
TM domain was fused to GFP. Alternatively, we specifically removed the unique TM domain from fulllength Ath1 or from the 131 amino acid N-terminal
fragment fused to Suc2, and found that absence of this
TM domain abrogated the activity of invertase and
growth on sucrose. More remarkably, removal of TM
in Ath1 led to a complete loss of enzyme activity and

the inability of a HA antibody to detect the HA–
Ath1DTM construct. Because we were able to verify
that the absence of Ath1 protein was not caused by
inefficient ATH1 transcription (not shown), these
results suggested a critical function for the TM domain
in the translation and ⁄ or stabilization of Ath1 during
early secretion steps. This also fits with the mislocalization of the NDTM–mCherry chimera in cytosolic
patchy bodies, whose origin is currently unknown.
As indicated by hybrid Ath1–invertase fusions, a
131 amino acid N-terminal fragment was needed to
recover normal invertase secretion, whereas reducing
this N-terminal fragment to only 69 amino acids
decreased the secretion and activity of invertase at the
cell surface. Taking this result together with those

using the reporter protein mCherry, the minimal information for correct targeting to the cell surface is likely
localized between amino acids 69 (after the TM
domain) and 131 of Ath1 protein sequence. Several
intracellular enzymes in yeast, in particular the glycolytic enzymes glyceraldehyde dehydrogenase [32],
3-phosphoglycerate mutase [33] and enolase [34,35],
were found to be secreted at the cell surface although
they did not harbor any classical signal sequence for
secretion. Nombela et al. [36] proposed that these signalless proteins could be exported by nonclassical
export systems, such as those identified in mammals
and parasites, which involve membrane blebbing (bubble formation) and secondary-structure elements that
might also contribute to export [37]. A common feature between these glycolytic enzymes and S. cerevisiae
Ath1 is the lack of a classical secretion sequence. However, because Ath1 is not a cytosolic protein, these
modes of secretion remain unknown. By contrast, the
classical secretion pathway cannot be excluded because
it was reported that mutations that cause accumulation

of secretory proteins in the endoplasmic reticulum
(sec18) or in the Golgi apparatus (sec7) led to diminished Ath1 activity [38,39]. Also, previous findings of
co-purification of Ath1 with cell-surface secreted proteins such as invertase [7,40] and Ygp1 [41] further
supported this mode of secretion. In conclusion, the
secretion pathway for Ath1 needs to be thoroughly
reinvestigated using specific mutants altered in various
secretion processes.

Experimental procedures
Strains, media and culture conditions
BY4741 (MAT a his3-D1 leu2-D0 ura3-D0 met15-D0),
BY4742 (MAT a his3-D1 leu2-D0 lys2-D0 ura3-D0) and
SEY6210 (MAT a his3-D200 leu2-3,112 lys2-801 trp1-901
ura3-52 suc2-D9) were used as recipient strains for various
gene constructs, as described in Table 1. Yeast transforma-

Table 1. Strains used in this study. Euroscarf, Institute of Molecular Biosciences, Johann Wolfgang Goethe-University Frankfurt, Germany;
´
H. Bussey, McGill University, Quebec, Canada.
Strain

Genotype

Reference

BY4741
BY4742
SEY6210
BY4741 ath1D
BY4741 vps4D

BY4741 ATH1_GFP
BY4741 ATH1_mCherry
BY4741 vps4D ATH1_mCherry
hxt1-17D

MAT a his3-D1 leu2-D0 ura3-D0 met15-D0
MATa his3-D1 leu2-D0 Lys2-D0 ura3-D0
MAT a his3-D300 leu2-3,112 lys2-801 trp1-901 ura3-52 suc2-D9
MAT a his3-D1 leu2-D0 ura3-D0 met15-D0 ath1D::KanMX4
MAT a his3-D1 leu2-D0 ura3-D0 met15-D vps4D::KanMX4
MAT a his3-D1 leu2-D0 ura3-D0 met15-D0 ATH1-GFP-His3MX6
MAT a his3-D1 leu2-D0 ura3-D0 met15-D0 ATH1-mCherry-His3MX6
MAT a his3-D1 leu2-D0 ura3-D0 met15-D0 vps4D::KanMX4 ATH1-mCherry-His3MX6
MATa hxt1-17 gal2

Euroscarf
Euroscarf
Gift of H. Bussey
This study
Euroscarf
This study
This study
This study
[19]

FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS

5441

Functional localization of Ath1 in S. cerevisiae

S. He et al.

tion was performed according to the lithium acetate
method, as described in Woods & Gietz [42]. The vps4D
mutant used in this study was derived from the Euroscarf
deletion collection (BY background). The ath1D null
mutant was constructed by replacing the gene of interest
with selective cassettes KanMX4 using in vivo homologous
recombination. Unless otherwise stated, yeast cells were cultured in yeast nitrogen base (YN) synthetic medium (0.17%
w ⁄ v yeast nitrogen base without amino acid and without
ammonium, supplemented with 0.5% ammonium sulfate
w ⁄ v, buffered to pH 4.8 with sodium succinate ⁄ NaOH and
with the auxotrophic amino acids when required). A carbon
source glucose, galactose, sucrose or trehalose was added
up to 2% (w ⁄ v). Cultures were carried out at 30 °C in
shaking flasks at a shaking speed of 170 rpmỈmin)1.

Plasmids construction
To construct N-terminal truncated versions of Ath1, primers ATH1_)1000_BH and ATH1_+508 (for primers list
see Table 2) were used to amplify a DNA fragment carrying the ATH1 gene and its promoter and terminator from
extracted genomic DNA of BY4741. This PCR product
was first cloned in pGEM-T-easy vector and a cut BamHI ⁄ PstI fragment was inserted into centromeric YCplac33
(linearized by BamHI and PstI) to construct pATH1 (for
plasmids list see Table 3). Mutagenesis of the TM domain
of Ath1 was carried out using the four nucleotides recombinant PCR method [43]. Use of ATH1_A and ATH1_D
external primers, together with the internal mutagenic primers ATH1_B and ATH1_C, led to the deletion of nucleotides 139–207 that encode the TM domain of Ath1. The
recombinant PCR fragment was cloned into the pGEMT-easy vector and cut by AgeI ⁄ AflII digestion to replace the
AgeI ⁄ AflII fragment in pATH1, which yielded path1DTM.

The same method was used to construct path1DN, with the
primers ATH1_E, ATH1_F, ATH1_G and ATH1_D that
lead to the deletion of nucleotides 1-300 of ATH1 sequence.
To fuse the signal peptide of Suc2 to the catalytic
domain of Ath1, the following constructions were carried
out using the centromeric plasmid pLC1 containing the
SUC2 gene (1602 bp) flanked by its own promoter [44].
The pSPSUC2–ath1DN plasmid was constructed by replacing the fragment coding the catalytic domain of invertase,
which starts from the 112th nucleotide to the stop codon
(remaining 5¢-end fragment including the region coding signal peptide of Suc2) of SUC2 in pLC1 by the ath1 allele
without its 5¢-end 300 bp (Fig. 7). To construct pSPPEP4–
ath1DN, the SUC2 ORF in pLC1 was replaced by the
PEP4 (1218 bp) ORF, which was amplified using the primers PEP4_D and PEP4_R. The 3¢-end (951 bp) fragment
encoding the catalytic domain of Pep4 (amplified by using
primers ATH1_pep4 and ATH1_pLC1), was removed and
replaced by the ath1 allele without its 300 bp 5¢-end in
order to yield pSPPEP4–ath1DN.

5442

Plasmids bearing Ath1-truncated fusion proteins inframe
to the intracellular invertase encoded by suc2ic allele were
constructed by using another centromeric plasmid pSC1
containing a suc2ic allele lacking its signal sequence [44].
Using the plasmid pATH1 as the template, PCR fragments
containing 1000 bp of ATH1 promoter sequence and part
of the 5¢-end of ATH1 coding sequence were obtained using
ATH1_)1000_BH as the forward primer and the following
reverse primers: ATH1_3633_BH for amplification of fulllength ATH1 coding sequence (without the stop codon);
ATH1_395_BH for the ‘N’ construct that carries an allele

version of ATH1 that stops just before the catalytic domain
of Ath1 (amino acid 131); ATH1_209_BH for the ‘TM’
construct that stops just after the TM domain of Ath1 (at
amino acid residue 69); and ATH1_140_BH for the ‘tm’
construct that stops just before the TM domain (amino
acid residue 41); Similarly, using path1DTM as template,
ATH1_)1000_BH
forward
primer
together
with
ATH1_3633_BH and ATH1_395_BH were used to obtain
‘ath1DTM’ and ‘NDTM’ constructs, respectively. In order
to achieve in frame fusion with suc2ic allele, all these PCR
fragments were cloned in pGEM-T-easy vector and excised
by BamHI digestion for subcloning into the BglII site of
pSC1 to produce plasmids pSC1–ATH1, pSC1–N, pSC1–
TM, pSC1–tm, pSC1–ath1DTM and pSC1–NDTM, respectively.
Ath1 was tagged with 3HA at the N-terminal end by
inserting 3HA after the start codon ATG of ATH1. For
this purpose, two rounds of the recombinant PCR were
successively carried out. First, we fused ATH1 promoter
(primers ATH1_1 and ATH1_2) and the 3HA (primers
HA_D and HA_R, using pFA6a–3HA–KanMX6 as template), using ATH1_1 and HA_R as external primers. Second, this recombinant PCR product was fused to an ATH1
5¢-end PCR product (primers ATH1_3 and ATH1_4) using
ATH1_1 and ATH1_4 as external primers. This final HAtagged PCR fragment was cloned into the pGEM-T-easy
vector and was then excised by SnaBI ⁄ AgeI to replace the
SnaBI ⁄ AgeI fragment in pATH1 and path1DTM, respectively, to obtain pHA–ATH1 and pHA–ath1DTM.
Using the plasmid pFA6a–KanMX6–PGAL1 as the template, the primers PGAL_D and PGAL_R were used to
amplify a GAL1 promoter PCR cassette that was co-transformed into yeast cells with SnaBI-linearized plasmids

pHA–ATH1 and pHA–ath1DTM, respectively. Cells carrying recombinant plasmids pPGAL1–HA–ATH1 or
pPGAL1–HA–ath1DTM, which express the HA-tagged versions of Ath1 under the strong promoter GAL1 instead of
the native promoter, were selected in the absence of uracil.

Construction of fluorescent fusion proteins
ATH1 was amplified from the plasmid pATH1 using the
primers ATH1_pUG36_D and ATH1_pUG36_R. This
PCR product was first cloned in pGEM-T-easy vector and

FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS


S. He et al.

Functional localization of Ath1 in S. cerevisiae

Table 2. Primer sequences for PCR. Restriction sites are shown in bold, underlined and homologue recombination region in italics.
Name

Oligo sequence

F2_ATH1
R1_ATH1
ATH1_pUG36_D
ATH1_pUG36_R
ATH1_)1000_BH
ATH1_+508
ATH1_A
ATH1_B
ATH1_C

ATH1_D
ATH1_E
ATH1_F
ATH1_G
ATH1_3633_BH
ATH1_395_BH
ATH1_209_BH
ATH1_140_BH
mCherry–pSC1_D
mCherry–pSC1_R
HA_D
HA_R
ATH1_1
ATH1_2
ATH1_3
ATH1_4
PGAL_D
PGAL_R
R1_pLC1
PEP4_D
PEP4_R
SGA1_D
SGA1_R
ATH1_suc2
ATH1_pep4
ATH1_pLC1

ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAA
ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC
GCACTAGTATGAAAAGAATAAGATCGCTTT

GCCCCGGGATCATTGAGAACAATTTCC
GCGGATCCGTATGACCACATTCTATACTGA
GAGCCAATATCAAATCTGGTGGTAATCC
GAGGAACAAAAATAGTACCGGTAATAAC
GTAAGCCTGGAACTCTTTGT GTCAAACCTTGAGAAAGAAC
GTTCTTTCTCAAGGTTTGAC ACAAAGAGTTCCAGGCTTAC
CAAATCTATGATTTCTTAAGGGCCA
AGCAAGCACTACGTATCACGACAAACCAAC
GCTTCTGGATCGTAGTTCAA CATTATTGGAATGAGGAAAT
ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC
GGATCCTCATTGAGAACAATTTCCTTGA
GGATCCATCATGTTCTCATCATCATAATATG
GGATCCGTTAAATATAATGCAGTGACGAAGATA
GGATCCAAGTCAAACCTTGAGAAAGAACGA
CACGGCATATTATGATGATGAGAACATGATGGATCTCG CGCGGATCCCCGGGTTAATTAA
TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC
ATTTCCTCATTCCAATAATG TACCCATACGATGTTCCTG
CAAAGCGATCTTATTCTTTT AGCGTAATCTGGAACGTC
ACTACGTATCACGACAAACCAACAGCCG
TCAGGAACATCGTATGGGTA CATTATTGGAATGAGGAAA
ATGACGTTCCAGATTACGCT AAAAGAATAAGATCGCTT
TTACCGGTACTATTTTTGTTCCTCAAACTAGGAG
GTATGACCACATTCTATACTGAGAAGAGTGCCTATATAAATCATCGTCAGGTAAAGAGCCCCATTATCTT
GGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTACATGGGTTTTTTCTCCTTGACG
TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC
CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGTTCAGCTTGAAAGC
TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGC
CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTT
TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTCTACAAACTCTGTAAAACTT
AACGGCCCTTCGCAAGTGCAGCTGCGGGATGCAGTCTTGATGAATGGGTTGAACTACGATCCAGAAGC

TTCACTGAAGGTGGTCACGATGTTCCATTGACAAATTACTTGAACGCATTGAACTACGATCCAGAAGC
TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTTAATCATTGAGAACAATTTCCTTGATTG

a cut SpeI ⁄ SmaI fragment was inserted into plasmid
pUG36 (linearized by SpeI and SmaI) to construct pGFP–
ATH1. The GFP–His3MX6 or mCherry–His3MX6 cassette
that contains the gene encoding GFP or mCherry was
amplified from plasmid pFA6a–GFP–His3MX6 or pFA6a–
mCherry–His3MX6 (kind gift of S. Bachellier-Bassi, Institut
Pasteur, Paris, France). Primers F2_ATH1 and R1_ATH1
were used to amplify the GFP–His3MX6_ATH1 and mCherry–His3MX6_ATH1, which were integrated into the genome
of the wild-type strain BY4741 or vps4D mutant by homologous recombination, for C-terminal tagging of Ath1 with
GFP or mCherry. The path1DN–mCherry vector was
constructed by in vivo homologous recombination after
co-transformation of yeast cells with the mCherry–His3MX6_ATH1 PCR cassette together with plasmids path1DN,
and selection of the recombinant plasmid in the absence of
both uracil and histidine. Similarly, co-transformation of a

mCherry–His3MX6 PCR cassette that was obtained from
primers F2_ATH1 and R1_pLC1, together with pLC1 derivative plasmids described above, led to mCherry–tagged
versions of Ath1 chimeric variants, i.e. pSPSUC2–ath1DN–
mCherry and pSPPEP4–ath1DN–mCherry.
The two plasmids pN–mCherry and pNDTM–mCherry
were obtained by replacing the suc2ic allele sequence by
mCherry in plasmids pSC1–N and pSC1–NDTM. This was
carried out by co-transformation into yeast cells of a
mCherry PCR cassette obtained from primers mCherry–
pSC1_D and mCherry–pSC1_R, together with AgeI-linearized pSC1–N and pSC1–NDTM, respectively.

Western blotting

Crude cell extract was prepared in the same way as crude
extract for trehalase activity measurement [14] with

FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS

5443


Functional localization of Ath1 in S. cerevisiae

S. He et al.

Table 3. Plasmids used in this study. GFP, green fluorescent protein; TM, transmembrane.
Plasmid

Description

Ref

YCplac33
pLC1
pSC1
pFA6a–GFP–His3MX6
pFA6a–mCherry–His3MX6

Centromeric plasmid
Centromeric plasmid, containing SUC2 ORF
Centromeric plasmid, containing suc2ic allele without sequences coding signal peptide
As a PCR template for amplifying GFP sequence
As a PCR template for amplifying mCherry sequence

pFA6a–3HA–KanMX6
pFA6a–KanMX6–PGAL1
pUG36

As a PCR template for amplifying 3HA sequence
As a PCR template for amplifying the promoter GAL1
For a N-terminal GFP fusion construction under promoter MET25

pATH1
pGFP–ATH1
path1DN
path1DTM

ATH1 ORF with its promoter and terminator cloned in YCplac33
To overexpress the chimeric protein GFP–Ath1
ATH1 variant without 5¢-end 300 nucleotides cloned in YCplac33
ATH1 variant without 5¢-end 139-207 nucleotides coding TM domain (aa 47-69)
cloned in YCplac33
To express a chimeric protein with the signal peptide of invertase fused to Ath1DN
To express a chimeric protein with the signal peptide of Pep4 fused to Ath1DN
To express a chimeric protein with HA tag in the N-terminus of Ath1
To express a chimeric protein with HA tag in the N-terminus of Ath1DTM
Bearing mCherry at the 3¢-end of ath1DN
Bearing mCherry at the 3¢-end of SPSUC2-ath1DN
Bearing mCherry at the 3¢-end of SPPEP4-ath1DN
ATH1 ORF fused to 5¢-end of suc2ic allele
ATH1 5¢-end 395 nucleotides fused to 5¢-end of suc2ic allele
ATH1 5¢-end 209 nucleotides fused to 5¢-end of suc2ic allele
ATH1 5¢-end 140 nt fused to 5¢-end of suc2ic allele

ath1DTM fused to 5¢-end of suc2ic allele
ATH1 5¢-end 395 nucleotides with a gap of 139-207 nucleotides coding the TM domain
(amino acids 47-69) fused to 5¢-end of suc2ic allele
ATH1 5¢-end 395 nucleotides fused to 5¢-end of mCherry
ATH1 5¢-end 395 nucleotides with a gap of 139-207 nucleotides coding TM domain
(amino acids 47-69) fused to 5¢-end of mCherry

[45]
[46]
[46]
[47]
Gift of S.
Bachellier-Bassi
[47]
[47]
Gift of
Hegemann JH
This study
This study
This study
This study

pSPSUC2–ath1DN
pSPPEP4–ath1DN
pPGAL1–HA–ATH1
pPGAL1–HA–ath1DTM
path1DN–mCherry
pSPSUC2–ath1DN–mCherry
pSPPEP4–ath1DN–mCherry
pSC1–ATH1

pSC1–N
pSC1–TM
pSC1–tm
pSC1–ath1DTM
pSC1–NDTM
pN–mCherry
pNDTM–mCherry

additional protease inhibitor (Roche, Basel, Switzerland,
NO.11836170001). Crude extract containing tagged proteins
was first treated with EndoH for 3 h at 37 °C. Western
blots were performed using the primary mouse mAb antiHA IgG (Roche, No. 11583816001) at a dilution of 1 ⁄ 2000
or mouse mAb anti-GFP IgG (Roche, NO. 11814460001)
at a dilution of 1 ⁄ 1000 or rabbit living colors DsRed polyclonal antibody (Clontech, Palo Alto, CA, USA,
NO.632496) at a dilution of 1 ⁄ 1000, and the secondary
antibody horseradish peroxidase-conjugated goat antimouse or rabbit IgG at a dilution of 1 ⁄ 20000 supplied in
SuperSignal West Pico Complete Mouse (Pierce, Rockford,
IL, USA, NO. 34081) or rabbit (Pierce, NO. 34084) IgG
Detection Kit.

Fluorescence and microscopy
Fluorescent protein tagged cells were cultivated in YN
trehalose or glucose medium to reach the exponential

5444

This
This
This
This

This
This
This
This
This
This
This
This
This

study
study
study
study
study
study
study
study
study
study
study
study
study

This study
This study

phase, and then cells were collected by centrifugation
(3000 g, 5 min). Images were captured on a Metamorph
driven Olympus IX81 wide-field microscope equipped with

a Coolsnap HQ camera and a Polychrome V (Till Photonics, Munich, Germany). A 100· ⁄ 1.4 Oil Plan-Apochromat objective from Zeiss was used. Exposure times were
500 ms for GFP (excitation k = 490 nm) and 2000 ms
for mCherry (excitation k = 590 nm). Images were
minimally adjusted for brightness and contrast using
photoshop.

Assay of trehalase and invertase activity
Yeast cells (D  100) were harvested by centrifugation
(3000 g, 5 min) and washed twice. Activity of acid trehalase
and invertase on intact cells and in crude extract was measured as described in [14]. The activity was expressed as
nmol of glucose released from either trehalose or sucrose
per minute and per D600.

FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS


S. He et al.

Functional localization of Ath1 in S. cerevisiae

Acknowledgements
We thank S. Bachellier-Bassi for generously providing
us with the pFA6a–mCherry–His3MX6 plasmid.
Microscopy analyses were performed at the RIO
microscopy facility in Toulouse, France. This work
was partially supported by ANR Blanc grant n° 05-242128 to JMF. SH holds a fellowship for PhD students
from the Research Grants China Scholarship Council.

12

13

14

References
1 Lillie SH & Pringle JR (1980) Reserve carbohydrate
metabolism in Saccharomyces cerevisiae: responses to
nutrient limitation. J Bacteriol 143, 1384–1394.
2 Hottiger T, Boller T & Wiemken A (1987) Rapid
changes of heat and desiccation tolerance correlated
with changes of trehalose content in Saccharomyces
cerevisiae cells subjected to temperature shifts. FEBS
Lett 220, 113–115.
3 Jules M, Beltran G, Francois J & Parrou JL (2008) New
insights into trehalose metabolism by Saccharomyces cerevisiae: NTH2 encodes a functional cytosolic trehalase,
and deletion of TPS1 reveals Ath1p-dependent trehalose
mobilization. Appl Environ Microbiol 74, 605–614.
4 Singer MA & Lindquist S (1998) Thermotolerance in
Saccharomyces cerevisiae: the Yin and Yang of trehalose. Trends Biotechnol 16, 460–468.
5 Simola M, Hanninen AL, Stranius SM & Makarow M
(2000) Trehalose is required for conformational repair
of heat-denatured proteins in the yeast endoplasmic
reticulum but not for maintenance of membrane traffic
functions after severe heat stress [In Process Citation].
Mol Microbiol 37, 42–53.
6 Francois J & Parrou JL (2001) Reserve carbohydrates
metabolism in the yeast Saccharomyces cerevisiae.
FEMS Microbiol Rev 25, 125–145.
7 Mittenbuhler K & Holzer H (1988) Purification and
characterization of acid trehalase from the yeast suc2

mutant. J Biol Chem 263, 8537–8543.
8 Destruelle M, Holzer H & Klionsky DJ (1995) Isolation
and characterization of a novel yeast gene, ATH1, that
is required for vacuolar acid trehalase activity. Yeast
11, 1015–1025.
9 Pedreno Y, Maicas S, Arguelles JC, Sentandreu R &
Valentin E (2004) The ATC1 gene encodes a cell walllinked acid trehalase required for growth on trehalose
in Candida albicans. J Biol Chem 279, 40852–40860.
10 Swaim CL, Anton BP, Sharma SS, Taron CH & Benner
JS (2008) Physical and computational analysis of the
yeast Kluyveromyces lactis secreted proteome. Proteomics 8, 2714–2723.
11 Keller F, Schellenberg M & Wiemken A (1982) Localization of trehalase in vacuoles and of trehalose in the

15

16

17

18

19

20

21

22

23

24

25

cytosol of yeast (Saccharomyces cerevisiae). Arch Microbiol 131, 298–301.
Huang J, Reggiori F & Klionsky DJ (2007) The transmembrane domain of acid trehalase mediates ubiquitinindependent multivesicular body pathway sorting. Mol
Biol Cell 18, 2511–2524.
Nwaka S, Mechler B, Destruelle M & Holzer H (1995)
Phenotypic features of trehalase mutants in Saccharomyces cerevisiae. FEBS Lett 360, 286–290.
Jules M, Guillou V, Francois J & Parrou JL (2004)
Two distinct pathways for trehalose assimilation in the
yeast Saccharomyces cerevisiae. Appl Environ Microbiol
70, 2771–2778.
Roberts CJ, Nothwehr SF & Stevens TH (1992) Membrane protein sorting in the yeast secretory pathway:
evidence that the vacuole may be the default compartment. J Cell Biol 119, 69–83.
Leon S, Erpapazoglou Z & Haguenauer-Tsapis R
(2008) Ear1p and Ssh4p are new adaptors of the ubiquitin ligase Rsp5p for cargo ubiquitylation and sorting at
multivesicular bodies. Mol Biol Cell 19, 2379–2388.
Silveira MC, Carvajal E & Bon EP (1996) Assay for
in vivo yeast invertase activity using NaF. Anal Biochem
238, 26–28.
San Miguel PF & Arguelles JC (1994) Differential
changes in the activity of cytosolic and vacuolar
trehalases along the growth cycle of Saccharomyces cerevisiae. Biochim Biophys Acta 1200, 155–160.
Wieczorke R, Krampe S, Weierstall T, Freidel K,
Hollenberg CP & Boles E (1999) Concurrent knock-out
of at least 20 transporter genes is required to block
uptake of hexoses in Saccharomyces cerevisiae. FEBS
Lett 464, 123–128.

Schultz J, Copley RR, Doerks T, Ponting CP & Bork P
(2000) SMART: a web-based tool for the study of genetically mobile domains. Nucleic Acids Res 28, 231–234.
Letunic I, Doerks T & Bork P (2009) SMART 6: recent
updates and new developments. Nucleic Acids Res 37,
D229–D232.
Parrou JL, Jules M, Beltran G & Francois J (2005)
Acid trehalase in yeasts and filamentous fungi: localization, regulation and physiological function. FEMS
Yeast Res 5, 503–511.
Haguenauer-Tsapis R (1992) Protein-specific features of
the general secretion pathway in yeast: the secretion of
acid phosphatase. Mol Microbiol 6, 573–579.
Ammerer G, Hunter CP, Rothman JH, Saari GC, Valls
LA & Stevens TH (1986) PEP4 gene of Saccharomyces cerevisiae encodes proteinase A, a vacuolar enzyme
required for processing of vacuolar precursors. Mol Cell
Biol 6, 2490–2499.
Bryant NJ & Stevens TH (1998) Vacuole biogenesis in
Saccharomyces cerevisiae: protein transport pathways to
the yeast vacuole. Microbiol Mol Biol Rev 62, 230–247.

FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS

5445


Functional localization of Ath1 in S. cerevisiae

S. He et al.

26 Blondel MO, Morvan J, Dupre S, Urban-Grimal D,
Haguenauer-Tsapis R & Volland C (2004) Direct

sorting of the yeast uracil permease to the endosomal
system is controlled by uracil binding and Rsp5pdependent ubiquitylation. Mol Biol Cell 15, 883–
895.
27 Nwaka S & Holzer H (1998) Molecular biology of
trehalose and the trehalases in the yeast Saccharomyces
cerevisiae. Prog Nucleic Acid Res Mol Biol 58, 197–237.
28 Plourde-Owobi L, Durner S, Parrou JL, Wieczorke R,
Goma G & Francois J (1999) AGT1, encoding an
alpha-glucoside transporter involved in uptake and
intracellular accumulation of trehalose in Saccharomyces cerevisiae. J Bacteriol 181, 3830–3832.
29 Muller J, Aeschbacher RA, Wingler A, Boller T &
Wiemken A (2001) Trehalose and trehalase in Arabidopsis. Plant Physiol 125, 1086–1093.
30 Frison M, Parrou JL, Guillaumot D, Masquelier D,
Francois J, Chaumont F & Batoko H (2007) The Arabidopsis thaliana trehalase is a plasma membrane-bound
enzyme with extracellular activity. FEBS Lett 581,
4010–4016.
31 Vater CA, Raymond CK, Ekena K, Howald-Stevenson
I & Stevens TH (1992) The VPS1 protein, a homolog
of dynamin required for vacuolar protein sorting in
Saccharomyces cerevisiae, is a GTPase with two
functionally separable domains. J Cell Biol 119, 773–
786.
32 Gil-Navarro I, Gil ML, Casanova M, O’Connor JE,
Martinez JP & Gozalbo D (1997) The glycolytic enzyme
glyceraldehyde-3-phosphate dehydrogenase of Candida albicans is a surface antigen. J Bacteriol 179, 4992–
4999.
33 Alloush HM, Lopez-Ribot JL, Masten BJ & Chaffin
WL (1997) 3-Phosphoglycerate kinase: a glycolytic
enzyme protein present in the cell wall of Candida albicans. Microbiology 143, 321–330.
34 Edwards SR & Chaffin WL (1999) Enolase is present in

the cell wall of Saccharomyces cerevisiae. FEMS Microbiol Lett 177, 211–216.
35 Lopez-Villar E, Monteoliva L, Larsen MR, Sachon E,
Shabaz M, Pardo M, Pla J, Gil C, Roepstorff P &
Nombela C (2006) Genetic and proteomic evidences
support the localization of yeast enolase in the cell
surface. Proteomics 6, S107–S118.

5446

36 Nombela C, Gil C & Chaffin WL (2006) Non-conventional protein secretion in yeast. Trends Microbiol 14,
15–21.
37 Prudovsky I, Mandinova A, Soldi R, Bagala C, Graziani I, Landriscina M, Tarantini F, Duarte M, Bellum S,
Doherty H et al. (2003) The non-classical export routes:
FGF1 and IL-1alpha point the way. J Cell Sci 116,
4871–4881.
38 Harris SD & Cotter DA (1987) Vacuolar (lysosomal)
trehalase of Saccharomyces cerevisiae. Curr Microbiol
15, 245–249.
39 Mittenbuhler K & Holzer H (1991) Characterization of
different forms of yeast acid trehalase in the secretory
pathway. Arch Microbiol 155, 217–220.
40 Biswas N & Ghosh AK (1996) Characterisation of an
acid trehalase of Saccharomyces cerevisiae present in
trehalase–sucrase aggregate. Biochim Biophys Acta 1290,
95–100.
41 Destruelle M, Holzer H & Klionsky DJ (1994) Identification and characterization of a novel yeast gene: the
YGP1 gene product is a highly glycosylated secreted
protein that is synthesized in response to nutrient limitation. Mol Cell Biol 14, 2740–2754.
42 Woods RA & Gietz RD (2001) High-efficiency transformation of plasmid DNA into yeast. Methods Mol Biol
177, 85–97.

43 Pont-Kingdon G (1994) Construction of chimeric molecules by a two-step recombinant PCR method. BioTechniques 16, 1010–1011.
44 del Castillo AL, Nieto SA & Sentandreu R (1992)
Differential expression of the invertase-encoding SUC
genes in Saccharomyces cerevisiae. Gene 120, 59–65.
45 Gietz RD & Sugino A (1988) New yeast–Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites.
Gene 74, 527–534.
46 Castillo L, Martinez AI, Gelis S, Ruiz-Herrera J,
Valentin E & Sentandreu R (2008) Genomic response
programs of Saccharomyces cerevisiae following
protoplasting and regeneration. Fungal Genet Biol 45,
253–265.
47 Wach A, Brachat A, Pohlmann R & Philippsen P
(1994) New heterologous modules for classical or PCRbased gene disruptions in Saccharomyces cerevisiae.
Yeast 10, 1793–1808.

FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS