Tài liệu Báo cáo khoa học: Transduced human PEP-1–heat shock protein 27 efficiently protects against brain ischemic insult pptx

Transduced human PEP-1–heat shock protein 27 efficiently
protects against brain ischemic insult
Jae J. An
1,
*, Yeom P. Lee
1,
*, So Y. Kim
1
, Sun H. Lee
1
, Min J. Lee
1
, Min S. Jeong
1
, Dae W. Kim
1
,
Sang H. Jang
1
, Ki-Yeon Yoo
2
, Moo H. Won
2
, Tae-Cheon Kang
2
, Oh-Shin Kwon
3
, Sung-Woo Cho
4
,
Kil S. Lee

1
, Jinseu Park
1
, Won S. Eum
1
and Soo Y. Choi
1
1 Department of Biomedical Science and Research Institute for Bioscience and Biotechnology, Hallym University, Chunchon, Korea
2 Department of Anatomy and Neurobiology, College of Medicine, Hallym University, Chunchon, Korea
3 Department of Biochemistry, Kyungpook National University, Taegu, Korea
4 Department of Biochemistry and Molecular Biology, University of Ulsan College of Medicine, Seoul, Korea
Reactive oxygen species (ROS) are formed as by-prod-
ucts of normal cellular processes involving interactions
with oxygen. Constant exposure to the harmful actions
of ROS damages macromolecules. Ultimately, these
ROS contribute significantly to the pathological pro-
cesses of various human diseases, including ischemia,
carcinogenesis, radiation injury and inflammation ⁄
immune injury [1,2].
Oxidative stresses are known to cause the brain
lesions that characterize neurodegenerative diseases,
with neuroinflammatory processes increasing free radi-
cal production [3]. Ischemic injury to neurons is pri-
marily due to the interruption of blood flow, lack of
oxygenation, and subsequent reoxygenation after brain
ischemia ⁄ reperfusion [4,5]. However, the exact mecha-
nisms of neuronal damage in ischemia remain to be
Keywords
heat shock protein 27; ischemia; protein
therapy; protein transduction; ROS

Correspondence
S. Y. Choi, Department of Biomedical
Science and Research Institute for
Bioscience and Biotechnology, Hallym
University, Chunchon 200-702, Korea
Fax: +82 33 241 1463
Tel: +82 33 248 2112
E-mail:
W. S. Eum, Department of Biomedical
Science and Research Institute for
Bioscience and Biotechnology, Hallym
University, Chunchon 200-702, Korea
Fax: +82 33 241 1463
Tel: +82 33 248 2112
E-mail:
*These authors contributed equally to this
work
(Received 30 October 2007, revised 10
January 2008, accepted 15 January 2008)
doi:10.1111/j.1742-4658.2008.06291.x
Reactive oxygen species contribute to the development of various human
diseases. Ischemia is characterized by both significant oxidative stress and
characteristic changes in the antioxidant defense mechanism. Heat shock
protein 27 (HSP27) has a potent ability to increase cell survival in response
to oxidative stress. In the present study, we have investigated the protective
effects of PEP-1–HSP27 against cell death and ischemic insults. When
PEP-1–HSP27 fusion protein was added to the culture medium of astrocyte
and primary neuronal cells, it rapidly entered the cells and protected them
against cell death induced by oxidative stress. Immunohistochemical analy-
sis revealed that, when PEP-1–HSP27 fusion protein was intraperitoneally

injected into gerbils, it prevented neuronal cell death in the CA1 region of
the hippocampus in response to transient forebrain ischemia. Our results
demonstrate that transduced PEP-1–HSP27 protects against cell death
in vitro and in vivo, and suggest that transduction of PEP-1–HSP27 fusion
protein provides a potential strategy for therapeutic delivery in various
human diseases in which reactive oxygen species are implicated, including
stroke.
Abbreviations
GFP, green fluorescent protein; HSP27, heat shock protein 27; MDA, malondialdehyde; ROS, reactive oxygen species.
1296 FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS
elucidated. One hypothesis is that cellular events
involving oxidative damage mediated by ROS may
induce neurodegeneration [6]. Previous studies have
also provided evidence for the occurrence of oxidative
stress in cerebral ischemia [7,8].
Heat shock proteins (HSPs) are major stress proteins
that are induced in response to a variety of stresses,
including oxidative stress [9]. HSPs consist of a family
of highly conserved proteins, grouped according to
their molecular size: high-molecular-mass proteins and
small HSPs. Various studies have shown that HSPs act
as modulators of disease pathology in many neurologi-
cal conditions [10–13]. However, HSPs show differ-
ences in their tissue and cellular specificity and their
response to different insults [14–16].
Many researchers have demonstrated the successful
delivery of full-length Tat fusion proteins by protein
transduction technology. Several small regions of pro-
teins, called protein transduction domains, have been
developed to allow the delivery of exogenous protein

into living cells. These include carrier peptides derived
from the HIV-1 Tat protein, Drosophila Antennapedia
(Antp) protein and herpes simplex virus VP22 protein
[17]. To increase the biological activity of transduced
proteins in cells, a novel carrier is required to trans-
duce the target protein in its active native structural
form. Morris et al. [18] have designed a PEP-1 peptide
carrier, which consists of three domains: a hydropho-
bic tryptophan-rich motif, a spacer, and a hydrophilic
lysine-rich domain. When they mixed PEP-1 peptide
and a target protein (GFP or b-galactosidase) and then
overlaid them on cultured cells, they found that non-
denatured target protein was transduced.
In a previous study, we have shown that a Tat–
Cu,Zn-superoxide dismutase (SOD) fusion can be
transduced into HeLa cells, and protects the cells from
oxidative stress-induced destruction [19]. PEP-1–SOD
was efficiently transduced into neuronal cells across
the blood–brain barrier and protected against ischemic
insults [20]. Recently, we reported the protective effects
of transduced PEP-1–SOD in neuronal cell death and
paraquat-induced Parkinson’s disease in mice models
[21]. In addition, we demonstrated that the PEP-1–
ribosomal protein S3 (rpS3) fusion protein efficiently
transduces into skin cells ⁄ tissues and protects against
UV-induced skin cell death [22].
In the present study, we designed a PEP-1–HSP27
fusion protein expression vector (Fig. 1) for direct
transduction in vitro and in vivo in its native active
form. The results show that the PEP-1–HSP27 fusion

protein can be directly transduced into neuronal cells
and across the blood–brain barrier and can efficiently
protect against cell death. Therefore, we suggest that
the PEP-1–HSP27 fusion protein could be useful as a
potential therapeutic agent for transient forebrain
ischemia.
Results
Expression and purification of PEP-1–HSP27
fusion protein
Following induction of expression, PEP-1–HSP27
fusion proteins were purified using an Ni
2+
-nitrilotri-
acetic acid Sepharose affinity column and PD-10 column
chromatography. SDS–PAGE and western blot analysis
of the purified PEP-1–HSP27 fusion proteins were
performed. As shown in Fig. 2A, PEP-1–HSP27 fusion
proteins were highly expressed, and the purified recom-
binant PEP-1–HSP27 fusion protein had an estimated
molecular mass of approximately 30 kDa. The PEP-1–
HSP27 fusion protein was confirmed by western blot
BamH I
A
B
T7 term HSP27 PEP-1
MCS
Ap
r
IacI
ori

PEP-1–HSP27
PEP-1–HSP27
Control HSP27
His-Tag
His-Tag
HSP27
HSP27
PEP-1
His-Tag Lac O
T7 Prom
Xho I
Fig. 1. The expression vector for the PEP-1–HSP27 fusion protein.
(A) Construction of the PEP-1–HSP27 expression vector system
based on the vector pET-15b. A synthetic PEP-1 oligomer was
cloned with into the NdeI and XhoI sites, and human HSP27 cDNA
was cloned into the XhoI and BamHI sites of pET-15b. (B) Diagram
of the expressed control HSP27 and PEP-1–HSP27 fusion proteins.
Each contains a His tag consisting of six histidine residues. Expres-
sion was induced by adding isopropyl thio-b-
D-galactoside (IPTG).
J. J. An et al. Protective effects of PEP-1–HSP27 against brain ischemia
FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS 1297
analysis using antibody against rabbit polyhistidine
(Fig. 2B).
Transduction of PEP-1–HSP27 fusion protein into
astrocyte and neuronal cells
The intracellular delivery of PEP-1–HSP27 fusion
proteins into astrocytes was confirmed by direct
fluorescence analysis. As shown in Fig. 3A, almost all
cultured cells were found to be transduced with PEP-1–

HSP27 fusion proteins. However, fluorescence signals
were not detected in the negative control cells or in cells
treated with control HSP27. To exclude the possibility
that cell fixation with paraformaldehyde may have
affected detection of PEP-1–HSP27 fusion protein
transduction by direct fluorescence, we used FITC-con-
jugated PEP-1–HSP27 fusion proteins for transduction
into non-fixed or fixed astrocytes. The intracellular
distribution of the PEP-1–HSP27 fluorescence signal for
non-fixed cells was similar to that for fixed cells.
Under the same experimental conditions, we also
confirmed the intracellular distribution of the PEP-1–
HSP27 fluorescence signal in primary neuronal cells
(Fig. 3B). These results indicate that cell fixation with
paraformaldehyde is not required for PEP-1–HSP27
fusion protein transduction.
To evaluate the transduction ability of PEP-1–
HSP27 fusion proteins, we added them to astrocyte
cell-culture medium at 3 lm for various periods of
time (10–60 min), and then analyzed the transduced
protein levels by western blotting. Transduced PEP-1–
HSP27 fusion proteins were detected in cells within
10 min, and the intracellular concentration gradually
increased up to 60 min. The dose-dependency of the
transduction of PEP-1–HSP27 fusion proteins was
then analyzed. Various concentrations (0.5–3 lm)of
PEP-1–HSP27 fusion proteins were added to astrocytes
in culture for 60 min, and the levels of transduced pro-
teins were determined by western blotting. The results
indicate that the fusion proteins are transduced into

astrocytes in a concentration-dependent manner.
Figure 4A shows that PEP-1–HSP27 fusion protein
was efficiently transduced into astrocytes in a time-
and dose-dependent manner. However, control HSP27
was not transduced into the cells (data not shown).
We also assessed the transduction of PEP-1–HSP27
fusion protein into primary neuronal cells. As shown
(kDa)
AB
12
150
75
50
37
25
3123
Fig. 2. Expression and purification of the PEP-1–HSP27 fusion
protein. Protein extracts of cells and purified fusion proteins were
analyzed by 12% SDS–PAGE (A) and subjected to western blot
analysis with antibody against rabbit polyhistidine (B). Lane 1,
non-induced PEP-1–HSP27; lane 2, induced PEP-1–HSP27; lane 3,
purified PEP-1–HSP27.
A
a
b
c
d
a
b
c

d
B
Fig. 3. Transduction of PEP-1–HSP27 fusion proteins into astro-
cytes (A) and primary neuronal cells (B). After transduction of FITC-
labeled PEP-1–HSP27 fusion proteins (3 l
M) astrocytes, the cells
were washed twice with trypsin ⁄ EDTA and NaCl ⁄ P
i
and immedi-
ately observed by fluorescence microscopy. (a) Negative control
cells, (b) positive control cells treated with HSP27, (c) non-fixed
cells treated with PEP-1–HSP27, and (d) fixed cells treated with
PEP-1–HSP27.
Protective effects of PEP-1–HSP27 against brain ischemia J. J. An et al.
1298 FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS
in Fig. 4B, PEP-1–HSP27 fusion protein transduction
into primary neuronal cells was similar to that for as-
trocytes. These results demonstrate that PEP-1–HSP27
fusion protein can not only be transduced into cul-
tured astrocytes but can also penetrate primary neuro-
nal cells.
The intracellular stability of transduced PEP-1–
HSP27 fusion protein in astrocytes is shown in
Fig. 4C. The PEP-1–HSP27 fusion protein was added
to the culture medium at a concentration 3 lm for var-
ious time periods, and the resulting levels of trans-
duced protein were analyzed by western blotting.
Transduced PEP-1–HSP27 was initially detected in
cells after 10 min. The level declined gradually over
the period of observation. However, significant levels

of transduced HSP27 fusion protein persisted in the
cells for 12 h. The same patterns were obtained when
we used primary neuronal cells (data not shown).
Effect of transduced PEP-1–HSP27 fusion proteins
on the viability of cells under oxidative stress
To determine whether the transduced fusion protein
has a functional role in cells under oxidative stress, we
examined the viability of cells containing transduced
fusion proteins after administration of hydrogen per-
oxide. When cells were exposed to 1.2 mm hydrogen
peroxide, only 35% of the cells were viable. The viabil-
ity of cells pre-treated with PEP-1–HSP27 fusion pro-
teins and then exposed to hydrogen peroxide was
markedly increased up to 95% (Fig. 5).
Next, we examined the effect of PEP-1–HSP27
transduction on DNA fragmentation induced by
hydrogen peroxide. Biological macromolecules are
known to be major targets of oxidative stress. As
shown in Fig. 6, DNA fragmentation was considerably
induced by hydrogen peroxide in astrocytes; however,
the levels of DNA fragmentation were significantly
decreased by transduction of the PEP-1–HSP27 fusion
protein. We also measured cell viability and DNA
fragmentation using hydrogen peroxide in primary
neuronal cells. Transduced PEP-1–HSP27 efficiently
protects the neuronal cell viability (data not shown),
as seen for astrocytes. These results indicate that trans-
duced PEP-1–HSP27 fusion protein plays a defensive
role against cell death induced by oxidative stress in
the cells.

Transduced PEP-1–HSP27 protects against
ischemic damage
To determine whether transduced PEP-1–HSP27 per-
forms biological roles in vivo, we tested the effects of
transduced PEP-1–HSP27 fusion protein on neuronal
cell viabilities after transient forebrain ischemia in a
gerbil model. We injected PEP-1–HSP27 fusion protein
C
C
10
A
B
C
0.5 1 2 3 (µ
M)
C 0.5 1 2 3 (µ
M)
C 1 6 9 12 24 (h)
20 30 45 60 (min)
C 10 20 30 45 60 (min)
Fig. 4. Transduction of PEP-1–HSP27 fusion proteins into astro-
cytes (A) and primary neuronal cells (B). PEP-1–HSP27 (3 l
M) was
added to the culture medium for 10–60 min or 0.5–3 l
M PEP-1–
HSP27 was added to the culture medium for 1 h. (C) Cells pretreat-
ed with 3 l
M PEP-1–HSP27 were incubated for 1–24 h. Analysis
was performed by western blotting.
120

Cell viability (% of control)
100
80
60
40
20
0
C 0.5H
2
O
2
12
*
+
+
+
3(µM)
Fig. 5. Effect of transduced PEP-1–HSP27 on cell viability. Hydro-
gen peroxide (1.2 m
M) was added to astrocytes pretreated with
0.5–3 l
M PEP-1–HSP27 for 1 h. Cell viabilities were estimated using
an MTT colorimetric assay. Each bar represents the mean ± SEM
obtained from five experiments. Asterisks and crosses denote
statistical significance at P < 0.05 and P < 0.01, respectively.
J. J. An et al. Protective effects of PEP-1–HSP27 against brain ischemia
FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS 1299
30 min before ischemia. At 4 and 7 days following
ischemic insult, PEP-1–HSP27-treated, vehicle-treated
and sham-operated control animals were killed and the

protective effects of PEP-1–HSP27 fusion proteins
after ischemic insult were evaluated using cresyl violet
histochemistry (Fig. 7). In the vehicle-treated group,
the percentage of positive neurons detected was 11.2%
of that in the sham-operated group. In the PEP-1–
HSP27 fusion protein-treated groups, 4 and 7 days
after ischemic insult, the percentages of positive neu-
rons were 78% and 70% of that in the sham-operated
group, respectively.
To determine whether the PEP-1–HSP27 fusion
protein crossed the blood–brain barrier, we performed
immunohistochemistry on brain sections of PEP-1–
HSP27-treated and sham-operated control gerbils.
HSP27 protein was not detected in the control ani-
mals. However, HSP27 protein levels were significantly
increased throughout the brain of PEP-1–HSP27-trea-
ted animals (Fig. 8). These results indicate that PEP-1–
HSP27 fusion proteins are efficiently transduced
beyond the gerbil blood–brain barrier, and effectively
protect against neuronal cell damage caused by ische-
mic insult.
Effect of transduced PEP-1–HSP27 on lipid
peroxidation
We examined whether PEP-1–HSP27 could inhibit
ischemia-induced lipid peroxidation by the measuring
levels of malondialdehyde (MDA), a marker of lipid
peroxidation, in the hippocampus. Three hours after
ischemic insult, MDA levels were significantly elevated
compared to the sham-operated control group
(no ischemic insult, no PEP-1–HSP27 treatment).

However, the PEP-1–HSP27-treated group showed
M1 2
3
Fig. 6. Transduced PEP-1–HSP27 fusion protein inhibits stress-
induced DNA damage. Astrocytes were exposed to hydrogen per-
oxide in the absence or presence of 3 l
M PEP-1–HSP27. After
hydrogen peroxide exposure, DNA fragmentation was analyzed by
agarose gel electrophoresis. M represents DNA molecular mass
markers (100 bp DNA ladder). Lane 1, control cells; lane 2, hydro-
gen peroxide-exposed cells; lane 3, PEP-1–HSP27-treated hydrogen
peroxide-exposed cells.
ba
dc
fe
hg
B
A
120
Sham
Vehicle
4 days
7 days
100
80
60
Relative density (%)
40
20
0

NC PC 4 days 7 days
PEP-1–HSP27
Fig. 7. Effects of transduced PEP-1–HSP27 on neuronal cell viabil-
ity after ischemic insult. (A) Representative photomicrography of
the cresyl violet-stained hippocampus of the gerbil brain 4 and
7 days after ischemic insult. Negative control (a,b; normal); positive
control (c,d; vehicle-injected group); PEP-1–HSP27 (2 mgÆkg
)1
)
injected into the gerbil as a single dose (e–h). Scale bars = 400 lm
(a,c,e,g) and 50 lm (b,d,f,h). (B) Neuronal cell density in the hippo-
campal CA1 region of gerbils injected with PEP-1–HSP27 fusion
protein. Each bar represents the mean ± SE obtained from seven
gerbils.
Protective effects of PEP-1–HSP27 against brain ischemia J. J. An et al.
1300 FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS
significantly lower hippocampal MDA levels after
ischemic insult compared to the ischemic insult group
that was not treated with PEP-1–HSP27 (Fig. 9).
Neuronal cell death in the hippocampal CA1
region
In the sham-operated group, ionized calcium-binding
adapter molecule 1 (iba-1)-immunoreactive cells were
detected in all layers of the CA1 region (Fig. 10A) but
the iba-1 immunoreactivity in the cells was weak. Four
days after ischemic insult, iba-1-immunoreactive cells
aggregated in the stratum pyramidale, and their iba-1
immunoreactivity was very strong (Fig. 10C). How-
ever, in the PEP-1–HSP27-treated groups (4 and
7 days), the presence of iba-1-immunoreactive cells

and their iba-1 immunoreactivities were markedly
decreased in the CA1 regions (Fig. 10E,G).
Under the same experimental conditions, we
performed Fluoro-Jade B (F-JB) histofluorescence
staining. In the sham-operated control group, no
F-JB-positive neurons were detected in the hippocam-
pal CA1 region (Fig. 10B). F-JB-positive neurons were
abundant in the hippocampal CA1 region 4 days after
ischemic insult because of neuronal death in this region
(Fig. 10D). However, the numbers of F-JB-positive
neurons in the hippocampal CA1 region in the PEP-1–
HSP27-treated group after 4 and 7 days were signifi-
cantly decreased (Fig. 10F,H).
Discussion
Heat shock proteins (HPSs) have very important func-
tions, such as acting as molecular chaperones under
physiological conditions or in response to stress. The
most common inducible HSPs in the nervous system
are HSP70 and HSP27, and they have been shown to
be neuroprotective. In particular, HSP27 belongs to
the family of small heat shock proteins, which protect
against apoptotic cell death triggered by various stim-
uli such as oxidative stress, and increase the anti-
oxidant defense of cells by decreasing the levels of
reactive oxygen species (ROS) [23–25]. HSPs have been
implicated as modulators of disease pathology in many
neurological conditions [10–13]. Moreover, studies
have demonstrated marked differences for each HSP
A
B

Fig. 8. Transduction of PEP-1–HSP27 fusion protein across the blood–brain barrier. Transduction of PEP-1–HSP27 fusion protein in gerbil
brain was analyzed by immunohistochemistry using antibody against histidine. Animals were treated with a single injection of PEP-1–HSP27
and killed after 8 h. (A) Negative control; (B) PEP-1–HSP27-treated gerbil.
12
10
8
6
MDA (nmol·g
–1
)
4
2
0
Sham
Ischemia
PEP-1–HSP27 +
Ischemia
Fig. 9. Effects of transduced PEP-1–HSP27 on brain malondialde-
hyde (MDA) level. PEP-1–HSP27 was administered 30 min before
ischemia. At 3 h after the ischemic insult, hippocampi were
dissected for measurement of MDA. Each bar represents the
mean ± SEM obtained from five gerbils. Values are significantly dif-
ferent between the sham-operated group and the ischemia group
(P < 0.001) and between the PEP-1–HSP27 + ischemia group and
the ischemia group (P < 0.01).
J. J. An et al. Protective effects of PEP-1–HSP27 against brain ischemia
FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS 1301
with regard to their tissue and cellular specificity and
their response to different insults [14–16]. However,
the exact role of HSP27 in the disease process remains

unclear. Although HSP27 has been considered as hav-
ing potential as a therapeutic protein, its inability to
enter cells hinders its use for this purpose. Therefore,
in an effort to deliver HSP27 protein to cells and tis-
sues, we investigated the possibility of protein trans-
duction. As the HSP27 has multiple roles, it may be
considered as a potential therapeutic protein against
various neuronal diseases if the protein can be deliv-
ered into cells. Morris et al. [18] have designed a
21-residue peptide carrier, the PEP-1 peptide, that
allows transduction of proteins in their native condi-
tion.
To express the cell-permeable PEP-1–HSP27 protein,
the human HSP27 gene was fused to a PEP-1 peptide
in a bacterial expression vector to produce a genetic
in-frame PEP-1–HSP27 fusion protein. The PEP-1–
HSP27 fusion protein was a major component of the
total soluble proteins in cells, and was found to be
nearly homogeneous and more than 95% pure by
SDS–PAGE analysis. The identity of the expressed
and purified PEP-1–HSP27 fusion proteins was con-
firmed by western blot analysis using an anti-rabbit
polyhistidine antibody.
B
A
iba-1 F-JB
Sham
Vehicle
4 days
7 days

D
C
F
E
H
G
Fig. 10. iba-1 and Fluoro-Jade B (F-JB)
staining in the CA1 region in sham-operated
(A,B), vehicle-treated (C,D) and PEP-1–
HSP27-treated groups 4 (E,F) and 7 (G,H)
days after ischemic insult. With F-JB stain-
ing, only damaged neurons are fluorescent.
In the PEP-1–HSP27-treated groups, the
numbers of iba-1- and F-JB-positive neurons
were markedly decreased in the hippocam-
pal CA1 region in comparison with the
vehicle-treated group. Scale bar = 50 lm.
Protective effects of PEP-1–HSP27 against brain ischemia J. J. An et al.
1302 FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS
It has been shown that protein transduction across
the cell membrane by HIV-1 Tat and (Arg)
9
protein
transduction domain fusions does not occur in living
cells, and that it is an artifactual redistribution caused
by cell fixation [26]. The cell fixation technique dis-
rupts the cell membrane and therefore cannot be reli-
ably used to study membrane-translocating proteins.
These peptides and fusion proteins are internalized
into cells by endocytosis. Thus, cell fixation should be

avoided in studies of protein transduction into living
cells [26]. However, in this study, we were unable to
detect any differences in the distribution of the fluores-
cence of transduced PEP-1–HSP27 fusion proteins in
non-fixed and fixed cells. These results demonstrate
that cell fixation with paraformaldehyde is not
required for PEP-1–HSP27 transduction. Similar
observations have been reported indicating that arti-
facts of protein transduction are not induced by para-
formaldehyde fixation [27]. Our previous studies
showed that transduction of PEP-1–SOD and PEP-1–
rpS3 fusion proteins into neuronal and skin cells was
not affected by paraformaldehyde fixation [21,22].
Purified PEP-1–HSP27 fusion proteins were effi-
ciently transduced into astrocytes in a time- and dose-
dependent manner. The fusion protein was transduced
into cells within 10 min, and levels gradually increased
up to 60 min after transduction. Morris et al. [18]
showed that PEP-1 peptide ⁄ green fluorescent protein
(GFP, 30 kDa) or b-Gal (b-galactosidase, 119 kDa)
mixtures can be transduced into a human fibroblast
cell line (HS-68) and into Cos-7 cells by incubation
with a PEP-1 peptide carrier and the GFP or b-Gal
proteins for 30 min at 37 °C. These differences in the
time courses of transduction may depend on whether
the target protein is fused to the PEP-1 vector or
mixed with the PEP-1 peptide. Fusion with the PEP-1
vector may alter the conformation, polarity or molecu-
lar shape of the target protein, improving transduction
of the fusion proteins into cells.

To determine whether transduced PEP-1–HSP27
fusion proteins can play a biological role in the cells,
we tested the effect of transduced PEP-1–HSP27 fusion
proteins on cell viability under oxidative stress. The
viability of cells treated with hydrogen peroxide was
significantly increased when cells were pretreated with
PEP-1–HSP27 fusion proteins. Only 35% of cells trea-
ted with hydrogen peroxide without PEP-1–HSP27
were viable. Next, we examined the ability of trans-
duced PEP-1–HSP27 fusion protein to inhibit stress-
induced DNA damage, and found that it efficiently
protects against such damage. It is well known that
DNA damage triggers a cell-death mechanism and
induces apoptosis. These results indicate that the trans-
duced PEP-1–HSP27 fusion protein efficiently protects
against cell death caused by oxidative stress. This pro-
tective effect is in agreement with other reports indicat-
ing that overexpression of HSP27 protects neuronal
cells from a variety of death-inducing stimuli [12,28].
To examine the ability of transduced PEP-1–HSP27
fusion protein to protect against ischemic damage, we
designed a gerbil animal model. The formation of a
large amount of toxic ROS in the hypoxic and ische-
mic brain has been proposed to be an important step
in the sequence of events that links cerebral blood
flow reduction to neuronal death. ROS formation has
been demonstrated during acute ischemic attack and
after blood and oxygen are eventually returned to the
brain by reperfusion [29]. In this study, PEP-1–HSP27
was intraperitoneally administered 30 min before

ischemia. At 4 and 7 days following ischemia, the pro-
tective effects of the fusion proteins were confirmed
by immunohistochemistry. The magnitude of the pro-
tective effect of PEP-1–HSP27 fusion protein was
indicated by the 78% and 70% survival of CA1
neurons, respectively, after 4 and 7 days. In addition,
we observed that the PEP-1–HSP27 fusion protein
crossed the blood–brain barrier and the protein levels
significantly increased throughout the brain. Recently,
Cho et al. [30] demonstrated that PEP-1–cargo fusion
proteins can be efficiently delivered into neurons in
the ischemic hippocampus, and that PEP-1–SOD treat-
ment of animals with ischemic damage (induced prior
to treatment) reduces that damage.
Oxidative stress is an important underlying factor in
delayed neuronal death induced by ischemic insult.
Release of ROS and increases in lipid peroxidation can
be detected at a very early stage [8,31,32]. We observed
a significant increase in brain MDA levels, a marker of
lipid peroxidation, 3 h after an ischemic insult, similar
to that reported previously [33]. However, increased
MDA levels were significantly reduced by pretreatment
with transduced PEP-1–HSP27.
Neuronal death induced by injury of the central ner-
vous system causes activation of microglia. It has been
reported that activated microglia contribute to various
neurodegenerative diseases via the production of cyto-
toxic molecules such as free radicals, proinflammatory
prostaglandins and cytokines [34–36]. Ionized calcium-
binding adaptor molecule 1 (iba-1) is a calcium-bind-

ing protein that is specifically expressed in microglia in
the brain and plays an important role in regulating
their function. iba-1 has been utilized as a microglial
marker in several studies [37,38]. In this study, we
observed iba-1-immunoreactive cells in the hippocam-
pal CA1 regions after ischemia. The number of iba-1-
immunoreactive cells increased significantly in the
J. J. An et al. Protective effects of PEP-1–HSP27 against brain ischemia
FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS 1303
hippocampal CA1 region 4 days after an ischemic
insult. However, in the PEP-1–HSP27-treated group,
the number of iba-1-immunoreactive cells decreased
markedly in the hippocampal CA1 region at 4 and
7 days after the ischemic insult compared with the
group that was not treated with PEP-1–HSP27. We
also observed cell death using F-JB histofluorescent
staining under the same experimental conditions. F-JB
staining confirmed the presence of damaged neurons in
the hippocampal CA1 region. However, transduced
PEP-1–HSP27 fusion protein markedly decreased the
number of damaged neurons in the hippocampal
CA1 region. These results indicate that PEP-1–HSP27
fusion protein is associated with delayed neuronal
death in the hippocampal CA1 region after ischemia,
and attenuates the neuronal damage after an ischemic
insult.
HSP27 has a potent ability to increase cell survival
in response to a wide range of cellular challenges.
Reports have shown that overexpression of an individ-
ual HSP using viral vectors has a protective effect in

ischemic ⁄ reperfusion animal models, and demonstrated
that cell damage is reduced in hippocampus neurons
by approximately 50% in HSP27 transgenic animal
models [39,40]. Recently, Kwon et al. reported that
transduced Tat–HSP27 protein reduces infarct volume
(29.5%) compared with controls (39.1%) in ische-
mic ⁄ reperfusion animals [41]. In addition, Badin et al.
[42] demonstrated that, in animal ischemia models,
herpes simplex virus carrying HSP27 reduced neuronal
cell death by 44%. These results indicate that HSP27
protected against neuronal cell death induced by ische-
mia and stroke.
In summary, we demonstrate here for the first time
that human HSP27 fused with PEP-1 peptide (PEP-1–
HSP27) can be efficiently transduced in vitro and
in vivo in its native conformation. Moreover, PEP-1–
HSP27 fusion protein markedly protected against
stress-induced cell death and ischemic insults.
Although the detailed mechanism remains to be fur-
ther elucidated, our success in protein transduction of
PEP-1–HSP27 may provide a new strategy for protect-
ing against cell destruction resulting from ischemic
damage, and therefore may provide an opportunity for
development of therapeutic agents for the treatment of
various human diseases including stroke.
Experimental procedures
Materials
Restriction endonuclease and T4 DNA ligase were
purchased from Promega Co. (Madison, WI, USA). Oligo-
nucleotides were synthesized from Gibco BRL custom

primers (Gibco, Grand Island, NY, USA). The Ni
2+
-nitrilo-
triacetic acid Sepharose superflow column was purchased
from Qiagen (Valencia, CA, USA). Isopropyl thio-b-d-
galactoside (IPTG) was purchased from Duchefa Co.
(Haarlem, the Netherlands). Plasmid pET-15b and Escheri-
chia coli strain BL21 (DE3) were obtained from Novagen
(Hilden, Germany).
Expression and purification of PEP-1–HSP27
fusion proteins
The PEP-1–HSP27 fusion construct was generated by fusion
of the human HSP27 gene in-frame with the sequence encod-
ing the 21-amino acid PEP-1 peptide in a bacterial expression
vector (Fig. 1). A PEP-1–HSP27 expression vector was con-
structed to express the PEP-1 peptide (KETWWETWWT-
EWSQPKKKRKV) as a fusion with human HSP27. First,
two oligonucleotides 5¢-TATGAAAGAAACCTGGTGGG
AAACCTGGTGGACCGAATGGTCTCAGCCGAAAAA
AAAACGTAAAGTGC-3¢ (top strand) and 5¢-TCGABC
ACTTTACGTTTTTTTTTCGGCTGAGACCATTCGGTC
CACCAGGTTTCCCACCAGGTTTCTTTCC-3¢ (bottom
strand) were synthesized and annealed to generate a double-
stranded oligonucleotide encoding the PEP-1 peptide. The
double-stranded oligonucleotide was ligated into an NdeI–
XhoI-digested pET-15b vector. Second, two primers were
synthesized on the basis of the cDNA sequence of human
HSP27. The sense primer, 5¢-CTCGAGATGACCGAGCG
CCGCGTCCCCTTC-3¢, contains an XhoI site, and the
antisense primer, 5¢-GGATCCTTACTTGGCGGCAGTCT

CATCGGA-3¢, contains a BamHI restriction site. PCR was
performed and the PCR product was excised with XhoI
and BamHI, eluted, ligated into a pPEP-1 vector using
T4 DNA ligase, and transformed into E. coli DH5a cells.
The PEP-1–HSP27 sequences were confirmed by sequence
analysis.
To produce the PEP-1–HSP27 fusion proteins, the plas-
mid was transformed into E. coli BL21 cells. The trans-
formed bacterial cells were grown in 100 mL of LB media
at 37 °CtoaD
600
value of 0.5–1.0 and induced with
0.5 m m IPTG at 37 °C for 4 h. Harvested cells were lysed
by sonication at 4 °C in a binding buffer (5 mm imidazole,
500 mm NaCl, 20 mm Tris ⁄ HCl, pH 7.9). The recombinant
PEP-1–HSP27 was purified by loading clarified cell extracts
onto a Ni
2+
-nitrilotriacetic acid Sepharose affinity column
(Qiagen) under native conditions. After washing the column
with 10 volumes of binding buffer and six volumes of a
wash buffer (25 m m imidazole, 500 mm NaCl, and 20 mm
Tris ⁄ HCl, pH 7.9), the fusion proteins were eluted using an
eluting buffer (0.25 m imidazole, 500 mm NaCl, 20 mm
Tris ⁄ HCl, pH 7.9). The fractions containing the PEP-1–
HSP27 fusion proteins were combined, and salts were
removed using PD-10 column chromatography (Amersham,
Braunschweig, Germany). The protein concentration was
Protective effects of PEP-1–HSP27 against brain ischemia J. J. An et al.
1304 FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS

estimated by the Bradford procedure using BSA as the
standard [43].
Primary cell cultures
Primary neuronal cell cultures were prepared from
embryonic gestation of mouse embryos (day 14–15). Ven-
tral mesencephalic tissue was mechanically dissociated by
mild trituration in ice-cold calcium- and magnesium-free
Hank’s balanced saline solution and incubated with 0.05%
trypsin ⁄ EDTA at 37 °C for 15 min. Dissociated cells were
transferred to a neurobasal medium containing 2% B27
supplement (Gibco, Grand Island, NY, USA), 2 mm gluta-
mate, 100 unitsÆmL
)1
penicillin and 100 lgÆmL
)1
streptomy-
cin (units as defined by supplier; Bio Whittaker,
Walkersville, MD, USA). Cells were seeded onto poly-d-
lysine-coated 24-well culture plates. Cultures were main-
tained at 37 °C in a humidified atmosphere containing 95%
air and 5% CO
2
. After 4 days, half of the medium was
replaced with fresh medium. Cells were grown for an addi-
tional 2 days and the cells were then used [44].
Transduction of PEP-1–HSP27 fusion protein
into astrocytes and primary neuronal cells
Astrocytes were cultured in Dulbecco’s modified Eagle’s
medium containing 20 mm Hepes ⁄ NaOH (pH 7.4), 5 mm
NaHCO

3
, 10% fetal bovine serum and antibiotics
(100 lgÆmL
)1
streptomycin, 100 unitsÆmL
)1
penicillin) at
37 °C under humidified conditions (95% air and 5% CO
2
).
For transduction of PEP-1–HSP27, the primary neuronal
cells and astrocytes were grown to confluence on a 6-well
plate. Then the culture medium was replaced with 1 mL of
fresh solution. After the cells had been treated with various
concentrations of PEP-1–HSP27 for 1 h, the cells were trea-
ted with trypsin ⁄ EDTA (Gibco) and washed with NaCl ⁄ P
i
.
The cells were harvested for the preparation of cell extracts
for western blot analysis.
Fluorescence analysis
For direct detection of fluorescein-labeled protein, purified
PEP-1–HSP27 was labeled using an EZ-Label fluorescein
isothiocyanate (FITC) protein labeling kit (Pierce, Rock-
ford, IL, USA). The FITC labeling was performed
according to the manufacturer’s instructions. Cultured
cells were grown on glass coverslips and treated with
3 lm PEP-1–HSP27 fusion proteins. Following incubation
for 1 h at 37 °C, the cells were washed twice with
NaCl ⁄ P

i
and trypsin ⁄ EDTA. The cells were fixed with
4% paraformaldehyde for 10 min at room temperature.
The distribution of fluorescence was analyzed on a fluo-
rescence microscopy (Carl Zeiss, EL-Einsatz, Goettingen,
Germany).
MTT assay
The biological activity of the transduced PEP-1–HSP27
fusion proteins was assessed by measuring the cell viability
of astrocytes treated with hydrogen peroxide. The cells were
seeded into 6-well plates at 70% confluence, and were pre-
treated with 3 lm PEP-1–HSP27 for 1 h, then hydrogen
peroxide (1.2 mm) was added to the culture medium for
4 h. Cell viability was estimated by a colorimetric assay
using MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-dipheyltetrazo-
lium bromide). Controls cells were not pretreated with
PEP-1–HSP27.
Analysis of DNA fragmentation
DNA fragmentation was performed according to the
method described by Iwahashi et al. [45]. After transduction
of PEP-1–HSP27 fusion proteins into astrocytes, the cells
were exposed to hydrogen peroxide (1.2 mm) for 3 h at
37 °C. Then, cultured cells were lysed and treated with
RNase and proteinase K (Roche, Mannheim, Germany).
The DNA was then extracted with phenol–chloroform, pre-
cipitated with isopropanol, washed with ethanol, and air-
dried. DNA samples were separated by 1.2% agarose gel
electrophoresis. The gel was stained with ethidium bromide
and photographed under UV light.
Experimental animals and induction of cerebral

forebrain ischemia
This study used the progeny of Mongolian gerbils (Meriones
unguiculatus) obtained from the Experiment Animal Center
at Hallym University. The animals were housed at constant
temperature (23 °C) and relative humidity (60%) with a fixed
12 h light ⁄ dark cycle and free access to food and water. Pro-
cedures involving animals and their care conformed to the
institutional guidelines, which are in compliance with current
NIH Guidelines for the Care and Use of Laboratory Ani-
mals, and were approved by the Hallym Medical Center
Institutional Animal Care and Use Committee.
Male Mongolian gerbils weighing 65–75 g were placed
under general anesthesia using a mixture of 2.5% isoflurane
(Abbott Laboratories, Abbott Park, IL, USA) in 33%
oxygen and 67% nitrous oxide. To determine whether
transduced PEP-1–HSP27 protects from ischemic damage,
gerbils were intraperitoneally injected with PEP-1–HSP27
fusion protein (2 mgÆkg
)1
) 30 min before occlusion of com-
mon carotid arteries. A midline ventral incision was made
in the neck. The common carotid arteries were isolated,
freed of nerve fibers, and occluded with non-traumatic
aneurysm clips. Complete interruption of blood flow was
confirmed by observing the central artery in the eyeball
using an ophthalmoscope. After 5 min occlusion, the
aneurysm clips were removed. Restoration of blood flow
J. J. An et al. Protective effects of PEP-1–HSP27 against brain ischemia
FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS 1305
(reperfusion) was observed directly under the ophthalmo-

scope. Sham-operated animals (n = 7) were subjected to
the same surgical procedures except that the common caro-
tid arteries were not occluded. Rectal temperature was
monitored and maintained at 37 ± 0.5 °C before and dur-
ing the surgery, and after the surgery until the animals had
recovered fully from anesthesia. At 4 and 7 days after
ischemia ⁄ reperfusion, the sham-operated group, vehicle-
treated group and PEP-1–HSP27-treated group were killed
for cresyl violet staining.
Effect of transduced PEP-1–HSP27 on cell viability
after ischemic insult
The animals were anesthetized with pentobarbital sodium,
and perfused transcardially with NaCl ⁄ P
i
(pH 7.4), fol-
lowed by 4% paraformaldehyde in 0.1 m phosphate buffer
(pH 7.4) in sham-operated (n = 7), vehicle-treated (n =7)
and PEP-1–HSP27-treated groups for 4 and 7 days (n =7)
after the surgery. Brains were removed and postfixed in the
same fixative for 4 h. The brain tissues were cryoprotected
by infiltrating with 30% sucrose overnight. Thereafter, the
tissues were frozen and sectioned with a cryostat at 30 lm,
and consecutive sections were collected in 6-well plates con-
taining NaCl ⁄ P
i
. These free-floating sections were then
mounted on glass slides and air-dried, followed by staining
with cresyl violet acetate in the usual manner [30].
Measurement of lipid peroxidation in the
hippocampus

Lipid peroxidation was measured according to the method
described by Zhang et al. [46]. An aliquot (100 lL) of brain
supernatant was added to a reaction mixture containing
100 lL of 8.1% SDS, 750 lL of 20% acetic acid (pH 3.5),
750 lL of 0.8% thiobarbituric acid and 300 lL distilled
water. Samples were then boiled for 1 h (95 ° C) and centri-
fuged at 4000 g for 10 min. The absorbance of the superna-
tant was measured by spectrophotometry at 532 nm.
Fluoro-Jade B histofluorescence staining
To examine the effect of PEP-1–HSP27 on ischemic dam-
age, the sections were stained using F-JB, a marker for neu-
rodegeneration [47]. The sections were first immersed in a
solution containing 1% sodium hydroxide in 80% alcohol,
followed by a solution with 70% alcohol. They were then
transferred to a solution of 0.06% potassium permanga-
nate, and then to a 0.0004% F-JB staining solution (Histo-
chem, Jefferson, AR, USA). After washing, the sections
were placed on a slide warmer, and examined using an epi-
fluorescent microscope (Carl Zeiss). Using this method,
neurons that undergo degeneration are brightly stained in
comparison to the background [48].
Immunohistochemistry for iba-1
To confirm the neuroprotective effects and reactive gliosis
after PEP-1–HSP27 treatment, immunohistochemistry was
performed according to the method previously described
[49]. The sections were incubated with rabbit anti-ionized
calcium-binding adapter molecule 1 (iba-1) (1 : 500; Wako,
Osaka, Japan) and subsequently exposed to biotinylated
goat anti-rabbit IgG and streptavidine peroxidase complex
(diluted 1 : 200; Vector (Burlingame, CA, USA)). They

were then visualized by staining with 3,3’-diaminobenzidine.
Quantitative analysis
To calculate the number of surviving neurons, sections (10
per animal) representing the same level of the hippocampus
were selected for measurement. Each studied field in each
tissue was within the midpoint of the hippocampal CA1
region including all layers. Tissue images were obtained
using an Axiophot light microscope (Carl Zeiss) connected
via CCD camera to a PC monitor. Images of cresyl violet-
positive neurons were captured using an Applescanner
(Cupertino, CA, USA). Measurement of the number of
neuronal somata was performed using an image-analyzing
system equipped with a computer-based CCD camera and
utilizing optimas 6.5 software (CyberMetrics, Scottsdale,
AZ, USA). Cell counts were obtained by averaging the
counts from 70 sections taken from each animal. The num-
bers of cresyl violet-positive neurons in the PEP-1–HSP27-
and vehicle-treated groups were compared to that in the
sham-operated group. Finally, an anova test was per-
formed to investigate the protective effect of PEP-1–HSP27.
Acknowledgements
This work was supported by a 21st Century Brain
Frontier Research Grant (M103KV010019-03K2201-
01910) and a Next Generation Growth Engine Pro-
gram Grant from the Korean Science and Engineering
Foundation.
References
1 Floyd RA (1990) Role of oxygen free radicals in carci-
nogenesis and brain ischemia. FASEB J 4, 2587–2597.
2 Halliwell B & Gutteridge JMC (1999) Free Radicals in

Biology and Medicine. Oxford University Press, Oxford.
3 Dore S, Otsuka T, Mito T, Sugo N, Hand T, Wu L,
Hurn PD, Traystman RJ & Andreasson K (2003) Neu-
ronal overexpression of cyclooxygenase-2 increases cere-
bral infarction. Ann Neurol 54, 155–162.
4 Petito CK, Torres-Munoz J, Roberts B, Olarte JP,
Nowak TS Jr & Pulsinelli WA (1997) DNA
Protective effects of PEP-1–HSP27 against brain ischemia J. J. An et al.
1306 FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS
fragmentation follows delayed neuronal death in CA1
neurons exposed to transient global ischemia in the rat.
J Cereb Blood Flow Metab 17, 967–976.
5 Frantseva MV, Carlen PL & Perez Velazquez JL (2001)
Dynamics of intracellular calcium and free radical
production during ischemia in pyramidal neurons. Free
Radic Biol Med 31, 1216–1227.
6 Numagami Y, Sato S & Ohnishi ST (1996) Attenuation
of rat ischemic brain damage by aged garlic extracts: a
possible protecting mechanism as antioxidants. Neuro-
chem Int 29, 135–143.
7 Won MH, Kang TC, Jeon GS, Lee JC, Kim DY, Choi
EM, Lee KH, Choi CD, Chung MH & Cho SS (1999)
Immunohistochemical detection of oxidative DNA dam-
age induced by ischemic–reperfusion insults in gerbil
hippocampus in vivo. Brain Res 836, 70–78.
8 Chan PH (2001) Reactive oxygen radicals in signaling
and damage in the ischemic brain. J Cereb Blood Flow
Metab 21, 2–14.
9 Yenari MA, Giffard RG, Sapolsky RM & Steinberg
GK (1999) The neuroprotective potential of heat shock

protein 70 (HSP70). Mol Med Today 5, 525–531.
10 Kitamura Y & Nomura Y (2003) Stress proteins and
glial functions: possible therapeutic targets for neuro-
degenerative disorders. Pharmacol Ther 97, 35–53.
11 Slavotinek AM & Biesecker LG (2001) Unfolding the
role of chaperones and chaperonins in human disease.
Trends Genet 17, 528–535.
12 Takayama S, Reed JC & Homma S (2003) Heat-shock
proteins as regulators of apoptosis. Oncogene 22, 9041–
9047.
13 Latchman DS (2005) HSP27 and cell survival in neu-
rons. Int J Hyperthermia 21, 393–402.
14 Akbar MT, Wells DJ, Latchman DS & de Belleroche J
(2001) Heat shock protein 27 shows a distinctive wide-
spread spatial and temporal pattern of induction in
CNS glial and neuronal cells compared to heat shock
protein 70 and caspase 3 following kainite administra-
tion. Mol Brain Res 93, 148–163.
15 Mailhos C, Howard MK & Latchman DS (1993) Heat
shock protects neuronal cells from programmed cell
death by apoptosis. Neuroscience 55, 621–627.
16 Wagstaff MJ, Collaco-Moraes Y, Smith J, de Belleroche
JS, Coffin RS & Latchman DS (1999) Protection of
neuronal cells from apoptosis by Hsp27 delivered with
a herpes simplex virus-based vector. J Biol Chem 274,
5061–5069.
17 Wadia JS & Dowdy SF (2002) Protein transduction
technology. Curr Opin Biotechnol 13, 52–56.
18 Morris MC, Depollier J, Mery J, Heitz F & Divita G
(2001) A peptide carrier for the delivery of biologically

active proteins into mammalian cells. Nat Biotechnol 19,
1173–1176.
19 Kwon HY, Eum WS, Jang HW, Kang JH, Ryu J, Lee
BR, Jin LH, Park J & Choi SY (2000) Transduction of
Cu,Zn-superoxide dismutase mediated by an HIV-1 Tat
protein basic domain into mammalian cells. FEBS Lett
485, 163–167.
20 Eum WS, Kim DW, Hwang IK, Yoo KY, Kang TC,
Jang SH, Choi HS, Choi SH, Kim YH, Kim SY et al.
(2004) In vivo protein transduction: biologically active
intact PEP-1–superoxide dismutase fusion protein effi-
ciently protects against ischemic insult. Free Radic Biol
Med 37, 1656–1669.
21 Choi HS, An JJ, Kim SY, Lee SH, Kim DW, Yoo KY,
Won MH, Kang TC, Kwon HJ, Kang JH et al. (2006)
PEP-1–SOD fusion protein efficiently protects against
paraquat-induced dopaminergic neuron damage in a
Parkinson disease mouse model. Free Radic Biol Med
41, 1058–1068.
22 Choi SH, Kim SY, An JJ, Lee SH, Kim DW, Ryu HJ,
Lee NI, Yeo SI, Jang SH, Won MH et al. (2006)
Human PEP-1–ribosomal protein S3 protects against
UV-induced skin cell death. FEBS Lett 580, 6755–
6762.
23 Jakob U & Buchner J (1994) Assisting spontaneity: the
role of HSP90 and small HSPs as molecular chaper-
ones. Trends Biochem Sci 19, 205–211.
24 Kiang JG & Tsokos GC (1998) Heat shock protein
70 kDa: molecular biology, biochemistry, and physiol-
ogy. Pharmacol Ther 80, 183–201.

25 Mehlen P, Kretz-Remy C, Preville X & Arrigo AP
(1996) Human HSP27, Drosophila HSP27 and human
B-crystallin expression-mediated increase in glutathione
is essential for the protective activity of these proteins
against TNF-induced cell death. EMBO J 15, 2695–
2706.
26 Richard JP, Melikov K, Vives E, Ramos C, Verbeure
B, Gait MJ, Chernomordik LV & Lebleu B (2003) Cell-
permeable peptides: a reevaluation of the mechanism of
cellular uptake. J Biol Chem 278, 585–590.
27 Cashman SM, Morris DJ & Kumar-Singh R (2003)
Evidence of protein transduction but not intracellular
transport by protein fused to HIV Tat in retinal cell
culture and in vivo. Mol Ther 8, 130–142.
28 Concannon CG, Gorman AM & Samali A (2003) On
the role of Hsp27 in regulating apoptosis. Apoptosis 8,
61–70.
29 Hall ED & Braughler JM (1989) Central nervous sys-
tem trauma and stroke. II. Physiological and pharmaco-
logical evidence for involvement of oxygen radicals and
lipid peroxidation. Free Radic Biol Med 6, 303–313.
30 Cho JH, Hwang IK, Yoo KY, Kim SY, Kim DW,
Kwon YG, Choi SY & Won MH (2008) Effective deliv-
ery of Pep-1–cargo protein into ischemic neurons and
long-term neuroprotection of Pep-1–SOD1 against
ischemic injury in the gerbil hippocampus. Neurochem
Int 52, 659–668.
31 Candelario-Jalil E, Mhadu NH, Al-Dalain SM, Marti-
nez G & Leon OS (2001) Time course of oxidative
J. J. An et al. Protective effects of PEP-1–HSP27 against brain ischemia

FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS 1307
damage in different brain regions following transient
cerebral ischemia in gerbils. Neurosci Res 41, 233–241.
32 Wang Q, Sun AY, Simonyi A, Jensen MD, Shelat PB,
Rottinghaus GE, MacDonald RS, Miller DK, Lubahn
DE, Weisman GA et al. (2005) Neuroprotective mecha-
nisms of curcumin against cerebral ischemia-induced
neuronal apoptosis and behavioral deficits. J Neurosci
Res 82, 138–148.
33 Sharma SS, Dhar A & Kaundal RK (2007) FeTPPS
protects against global cerebral ischemic–reperfusion
injury in gerbils. Pharmacol Res 55, 335–342.
34 Kreutzberg GW (1996) Microglia: a sensor for patho-
logical events in the CNS. Trends Neurosci 19, 312–318.
35 Araham H, Losonczy A, Czeh G & Lazar G (2001)
Rapid activation of microglial cells by hypoxia, kainic
acid, and potassium ions in slice preparations of the rat
hippocampus. Brain Res 906, 115–126.
36 Teismann P & Schulz JB (2004) Cellular pathology of
Parkinson’s disease: astrocytes, microglia and inflamma-
tion. Cell Tissue Res 318, 149–161.
37 Kato H, Tanaka S, Oikawa T, Koike T, Takahashi A
& Itoyama Y (2000) Expression of microglial response
factor-1 in microglia and macrophages following cere-
bral ischemia in the rat. Brain Res 882, 206–211.
38 Ito D, Tanaka K, Suzuki S, Dembo T & Fukuuchi Y
(2001) Enhanced expression of Iba1, ionized calcium-
binding adapter molecule 1, after transient focal cere-
bral ischemia in rat brain. Stroke 32, 1208–1215.
39 Brar BK, Stephanou A, Wagstaff MJ, Coffin RS, Mar-

ber MS, Engelmann G & Latchman DS (1999) Heat
shock protein delivered with a virus vector can protect
cardiac cells against apoptosis as well as against thermal
or hypoxic stress. J Mol Cell Cardiol 31, 135–146.
40 Akbar MT, Lundberg AMC, Liu K, Vidyadaran S,
Wells KE, Dolatshad H, Wynn S, Wells DJ, Latchman
DS & de Belleroche J (2003) The neuroprotective effects
of heat shock protein 27 overexpression in transgenic
animals against kainite-induced seizures and hippocam-
pal cell death. J Biol Chem 278, 19956–19965.
41 Kwon JH, Kim JB, Lee KH, Kang SM, Chung N, Jang
Y & Chung JH (2007) Protective effect of heat shock
protein 27 using protein transduction domain-mediated
delivery on ischemia ⁄ reperfusion heart injury. Biochem
Biophys Res Commun 363, 399–404.
42 Badin RA, Lythgoe MF, van der Weerd L, Thomas
DL, Gadian DG & Latchman DS (2006) Neuro-
protective effects of virally delivered HSPs in
experimental stroke. J Cereb Blood Flow Metab 26,
371–381.
43 Bradford M (1976) A rapid and sensitive method for
the quantitation of microgram quantities utilizing the
principle of protein–dye binding. Anal Biochem 72,
248–254.
44 Peng J, Mao XO, Stevenson FF, Hsu M & Andersen
JK (2004) The herbicide paraquat induces dopaminergic
nigral apoptosis through sustained activation of the
JNK pathway. J Biol Chem 279, 32626–32632.
45 Iwahashi H, Hanafusa T, Eguchi Y, Nakajima H,
Miyagawa J, Itoh N, Tomita K, Namba M, Kuwajima

M, Noguchi T et al. (1996) Cytokine-induced apoptotic
cell death in a mouse pancreatic beta cell line: inhibition
by Bcl-2. Diabetologia 39, 530–536.
46 Zhang DL, Zhang YT, Yin JJ & Zhao BL (2004) Oral
administration of Crataegus flavonoids protects against
ischemia ⁄ reperfusion brain damage in gerbils. J Neuro-
chem 90
, 211–219.
47 Candelario-Jalil E, Alvarez D, Merino N & Leon OS
(2003) Delayed treatment with nimesulide reduces mea-
sures of oxidative stress following global ischemic brain
injury in gerbils. Neurosci Res 47, 245–253.
48 Schmued LC & Hopkins KJ (2000) Fluoro-Jade B: a
high affinity fluorescent marker for the localization of
neuronal degeneration. Brain Res 874, 123–130.
49 Hwang IK, Yoo KY, Kim DW, Choi SY, Kang TC,
Kim YS & Won MH (2006) Ionized calcium-binding
adapter molecule 1 immunoreactive cells change in the
gerbil hippocampal CA1 region after ischemia ⁄ reperfu-
sion. Neurochem Res 31, 957–965.
Protective effects of PEP-1–HSP27 against brain ischemia J. J. An et al.
1308 FEBS Journal 275 (2008) 1296–1308 ª 2008 The Authors Journal compilation ª 2008 FEBS