Tài liệu Báo cáo khoa học: Globin gene family evolution and functional diversification in annelids ppt

Globin gene family evolution and functional diversification
in annelids
Xavier Bailly
1,
*
,
, Christine Chabasse
1,
*, Ste
´
phane Hourdez
1
, Sylvia Dewilde
2
, Sophie Martial
1
,
Luc Moens
2
and Franck Zal
1
1 Equipe Ecophysiologie: Adaptation et Evolution Mole
´
culaires, UPMC – CNRS UMR 7144, Station Biologique, BP 74, Roscoff, France
2 Biochemistry Department, University of Antwerp, Belgium
Globins are heme-containing proteins that reversibly
bind oxygen and other gaseous ligands, and are wide-
spread in the three major kingdoms of life [1,2].
Despite the great diversity of their amino-acid
sequences, the basic functional unit is assumed to be a
monomeric globin with a specific and highly conserved

fold referred to as the ‘globin-fold’. On the basis of
this conserved basic structure and its prevalence in
living organisms, it has been suggested that globin
genes evolved from a common ancestral gene which,
after successive duplications and speciation events,
led to the genes that encode the widespread globin
superfamily [1–5].
Three types of globin have been described in anne-
lids: (a) noncirculating intracellular globin [e.g. myo-
globin (Mb) found in the cytoplasm of muscle cells]
[5,6]; (b) circulating intracellular globin [e.g. hemo-
globin (Hb) found in erythrocytes] [7]; (c) extracellu-
lar globin dissolved in circulating fluids [7,8]. These
three types of globin display diversity in sequence,
quaternary structure and functions such as binding
and transport of oxygen and hydrogen sulfide, and
activity of superoxide dismutase and mono-oxygenase
[8].
Annelid noncirculating intracellular globins are gen-
erally encountered as monomers [9,10], and only the
Keywords
annelid; dehaloperoxidase; extracellular
globin; intracellular globin; myoglobin
Correspondence
F. Zal, Equipe Ecophysiologie: Adaptation et
Evolution Mole
´
culaires, UPMC – CNRS
UMR 7144, Station Biologique, BP 74,
29682 Roscoff cedex, France

Fax:. +33 (0) 2 98 29 23 24
Tel: +33 (0) 2 98 29 23 09
E-mail:
Present address
Department of Cell Biology and Comparative
Zoology, Institute of Biology, University of
Copenhagen, Denmark
*These authors contributed equally to this
work
(Received 8 December 2006, revised 12
March 2007, accepted 20 March 2007)
doi:10.1111/j.1742-4658.2007.05799.x
Globins are the most common type of oxygen-binding protein in annelids.
In this paper, we show that circulating intracellular globin (Alvinella pom-
pejana and Glycera dibranchiata), noncirculating intracellular globin (Areni-
cola marina myoglobin) and extracellular globin from various annelids
share a similar gene structure, with two conserved introns at canonical
positions B12.2 and G7.0. Despite sequence divergence between intracellu-
lar and extracellular globins, these data strongly suggest that these three
globin types are derived from a common ancestral globin-like gene and
evolved by duplication events leading to diversification of globin types and
derived functions. A phylogenetic analysis shows a distinct evolutionary
history of annelid extracellular hemoglobins with respect to intracellular
annelid hemoglobins and mollusc and arthropod extracellular hemoglobins.
In addition, dehaloperoxidase (DHP) from the annelid, Amphitrite ornata,
surprisingly exhibits close phylogenetic relationships to some annelid intra-
cellular globins. We have characterized the gene structure of A. ornata
DHP to confirm assumptions about its homology with globins. It appears
that it has the same intron position as in globin genes, suggesting a com-
mon ancestry with globins. In A. ornata, DHP may be a derived globin

with an unusual enzymatic function.
Abbreviations
DHP, dehaloperoxidase; Hb, hemoglobin; HBL-Hb, hexagonal bilayer hemoglobin; Mb, myoglobin; nMb, nerve myoglobin.
FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS 2641
amino-acid sequences from the polychete, Arenicola
marina, [11] and the nucleotide sequence from the
polychete, Aphrodite aculeata, [24] have been obtained
previously. To date, only cDNA and amino-acid
sequences of circulating intracellular Hb belonging to
the marine polychete, Glycera dibranchiata, are known
[12,13]. Annelid extracellular hexagonal bilayer hemo-
globins (HBL-Hbs) are assembled into a large multi-
subunit structure with molecular mass of 3–4 MDa.
Some nucleotide and amino-acid sequences are already
known. Extracellular globin chains are encoded by
genes belonging to a multigenic family, the molecular
phylogeny of which has previously been studied
[15,16]. Only three annelid families are currently
known to express simultaneously the three types of
globin: the Terebellidae, the Alvinellidae and the
Opheliidae [17,18]. The sporadic co-occurrence of the
three globin types may be more common in the annelid
phylum, as they were probably already present in a
common ancestor.
Despite studies on the evolution of noncirculating
intracellular globins (Mbs) [5] and extracellular globins
[16,19,20], the phylogenetic relationships between these
different globins in annelids remain unclear because of
the lack of available sequences.
To understand the emergence and evolution of these

globins, we have sequenced new annelid extracellular
and intracellular globin polypeptides, cDNAs and
genes such as (a) the nucleotide sequences of two extra-
cellular globins from the polychete, Ar. marina, (b) the
nucleotide sequence of an Ar. marina Mb, (c) the
amino-acid and nucleotide sequence of the intracellular
circulating globin of the polychete, Alvinella pompejana,
(d) the nucleotide sequence of the intracellular circula-
ting globin of the polychete, G. dibranchiata, and (e)
the nucleotide sequence of dehaloperoxidase A
(DHPA) of the marine annelid polychete, Amphitrite
ornata. In the light of a molecular phylogeny including
intracellular and extracellular globins of annelids, mol-
luscs and arthropods, we address here a likely evolu-
tionary scenario for the origin of extracellular and
intracellular globins in annelids.
To complete and strengthen the phylogenetic analy-
sis, we also carried out a study on globin gene struc-
ture (intron positions), which provides an obvious
opportunity to explore gene evolution because genes
sharing the same intron positions are thought to be
homologous and closely related. The typical pattern of
two introns ⁄ three exons (with intron positions in B12.2
and G7.0) already found in numerous eukaryotic glo-
bin genes [1] has previously been reported in four
annelid extracellular globin genes from Lumbricus
terrestris [21], Eudystilia vancouverii [22] and Riftia
pachyptila [23]. Apart from the nerve myoglobin
(nMb) of Aph. aculeata in which the first intron is
missing [24], neither intracellular circulating nor non-

circulating globin gene structures are known. For this
survey, we have identified (a) gene structures of the
two new extracellular globins from Ar. marina, (b) the
gene structures of four extracellular globins from the
vestimentiferan, R. pachyptila, (c) the gene structure of
Ar. marina Mb, (d) the gene structure of the new intra-
cellular circulating globin from Al. pompejana, (e) the
gene structure of intracellular circulating globin from
G. dibranchiata, and (f) the gene structure of DHPA
from A. ornata.
Interestingly, blast searches revealed a strong
amino-acid similarity between intracellular Hbs from
Al. pompejana and DHP from A. ornata involved in
halometabolite detoxication (converts halogenated
phenols into quinones in the presence of hydrogen per-
oxide) [25]. These heme-containing enzymes exhibit
conserved distal and proximal histidines found in most
globin sequences [26], and the crystal structure of
native DHP exhibits a typical globin fold [27]. These
data suggest that DHP activity may have arisen by
duplication of a globin gene [27], but do not rule out a
possible evolutionary convergence. In this paper,
we also show that this annelid DHP protein illustrates
an original case of functional diversification from a
globin.
Results
Identification of the A2 and B2 extracellular
globin chains of Ar. marina
Two extracellular globin chains of Ar. marina (acces-
sion numbers AJ880690 and AJ880691 for cDNAs,

Q53I65 and Q53I64 for amino-acid sequences) were
aligned and compared with other globins in the mul-
tiple sequence alignment (Fig. 1 and Table 1). The
sequence of the extracellular globin from Lumbricus
terrestris [28] was used as reference for the helix
assignment (Fig. 1). These two new globin chains pos-
sess the well-conserved globin amino acids, Pro-C2,
Phe-CD1, His-F8 and Trp-H4, as well as the two
cysteines NA2 and H7 known to be involved in the
formation of an intrachain disulfide bridge [29,30].
Strong molecular signatures and phylogenetic analyses
allowed the unambiguous assignment of these two
new globin chains to A2 and B2 extracellular Hb
clusters according to the classification proposed by
Suzuki et al. [31] in which the A and B families are,
respectively, subdivided into A1, A2 and B1, B2 sub-
families.
Functional diversification in annelid globin family X. Bailly et al.
2642 FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS
A2 chain
This sequence contains an ORF of 157 codons (inclu-
ding the initiation codon). As in other annelid extracel-
lular globins, residues 1–16 correspond to a signal
peptide. This signal peptide was removed in the align-
ment presented in Fig. 1.
This sequence clearly belongs to the A family, as
evidenced by typical molecular features: Lys-A9,
Trp-B10 and also a deletion of three residues
between the A and B helices, and a deletion of one
residue between the F and G helices. Moreover,

the two residues Gly-Pro (at position A1-A2) indi-
cate that this sequence belongs to the A2 group
(Fig. 1).
B2 chain
This sequence contains an ORF of 165 codons (inclu-
ding the initiation codon). Residues 1–16 correspond
to a signal peptide. This signal peptide is not shown in
the alignment (Fig. 1).
This sequence exhibits amino acids that are typical
of the B family: Asp-A4, Trp-A16, Phe-B10 and Leu-
B13. Furthermore, it shows an insertion of three resi-
dues between the A and B helices, an insertion of one
residue between the F and G helices, and a three-resi-
due motif Pro-Gln-Val at position G17-19. Moreover,
the three-residue motif Thr-Gly-Arg between the A
and B helices indicates that this sequence belongs to
the B2 group (Fig. 1).
Fig. 1. Multiple alignment of annelid DHP,
extracellular and intracellular globins (circula-
ting and noncirculating) amino-acid
sequences. Intracellular globin sequences
are shaded. Positions of intron 1 (B12.2) and
2 (G7.0) are indicated by dashed lines. The
conserved amino-acid residues are indicated
in black. Letters above the sequence indi-
cate the helical designation, based on the
Lumbricus terrestris helical structure [28].
Signal peptides, when present, have been
removed. See Table 2 for abbreviations.
X. Bailly et al. Functional diversification in annelid globin family

FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS 2643
Intracellular circulating globin of Al. pompejana
The partial cDNA sequence (accession number
AJ880693) was obtained using degenerate primers
designed from the amino-acid sequence obtained by
Edman degradation. This sequence displays the key
residues as Pro-C2, Phe-CD1, His-F8 and Trp-H4
(Fig. 1). However, as in Ar. marina myoglobin MbIIa
and A. ornata DHP, the conserved Trp-A12 is replaced
by an Ile residue.
Gene structure
Introns were sequenced and characterized for Ar. mar-
ina A2 and B2 extracellular globins (accession numbers
AJ880690 and AJ880691, respectively) and myoglobin
MbIIa (accession number AJ880692), the extracellular
A1, B1a, B1b and B1c globin chains from R. pachypti-
la, intracellular Hb from Al. pompejana, Hb mIV from
G. dibranchiata, and DHPA from A. ornata. Bailly
reported the intron position of R. pachyptila A2 and
B2 [23]. The position and length of each intron are
summarized in Table 2. For all the sequences, the
insertion positions of the two introns correspond to
the usual B12.2 and G7.0 positions previously reported
for many other globin sequences including L. terrestris
[32] and E. vancouverii globins [1,22] (Fig. 1).
The splicing sites have also been analyzed: it was
shown that the 5¢ splice donor is marked by an eight-
nucleotide conserved sequence, the 3¢ acceptor site cor-
responds to a pyrimidine-rich region of 11 nucleotides
followed by (C ⁄ T)AG, and the typical branch point

signal corresponds to a five-nucleotide sequence that
functions as a signal for the spliceosome [33,34]. In all
introns, splicing donor and acceptor sequences con-
form to the consensus sequences (Table 2).
Phylogenetic relationships
The Bayesian tree based on annelid globin sequences
only is shown in Fig. 2. The NJ tree shows a similar
topology (data not shown). Two well-supported main
clusters can be identified: one comprises all intracellu-
lar globins and the other all the extracellular globins.
The intracellular cluster includes the nerve myoglobin
(nMb) and all Mbs and intracellular Hbs. The extra-
cellular cluster is divided into two groups: the A and B
families [15], as expected.
Al. pompejana intracellular Hb and A. ornata
DHP are most closely related to each other and obvi-
ously belong to a well-supported intracellular cluster,
distinct from a second cluster of intracellular globins
which includes G. dibranchiata Hb and Aph. aculeata
nMb.
In Fig. 3, which includes annelid, mollusc and arth-
ropod globins, annelid extracellular and intra-
cellular globins do not cluster together, but annelid
Table 1. Globin amino-acid sequences shown in the multiple align-
ment and molecular phylogeny.
Species Abbreviation
Accession
number
Amphitrite ornata DHP-Amph Q9NAV8
Arenicola marina A2a-Are

a
Q53I65
B2-Are
a
Q53I64
MbIa-Are Kleinschmidt [11]
Alvinella pompejana HbInt-Alv
a
Q53I62
Aphrodite aculeata NMb-Aph Q93101
Eudistylia vancouverii A1-Eud Q9BKE9
Glycera dibranchiata mIV-Gly P022 16
P1-Gly P23216
Lamellibrachia sp. A2-Lam P15469
B1-Lam Q7Z1R4
B2-Lam Q86BV3
Lumbricus terrestris A1-LumT P08924
A2-LumT P022 18
B1-LumT P11069
B2-LumT P13579
Ophelia bicornis Mb-Oph Q56JK7
Pheretima hilgendorfi A1-Phehil P83122
Pheretima sieboldi A1-Phesie P11740
Riftia pachyptila A1-Rif Q8IFK4
A2-Rif P80592
B1b-Rif Q8IFK1
B2-Rif Q8IFJ9
Sabella spallanzanii A2-Sab Q9BHK1
B2a-Sab Q9BHK3
Tubifex tubifex A1-Tub P18202

Tylorrhynchus heterochaetus A1-Tyl P02219
A2-Tyl P09966
B2a-Tyl P13578
Buccinum undatum BuccMb Q7M424
Nassarius mutabilis NassaMb P31331
Scapharca inaequivalvis ScaHb1 Q26505
Anadara trapezia HBIaAna P14395
HBIIAna P14394
Barbatia lima BarbHBD Q17157
Biomphalaria glabrata HBD2Biom and
HBD3Biom
Q683R3
Artemia sp. Hb1Art to
HB9Art
Q7M454
E1ART P19363
E7ART P19364
Chironomus thummi thummi B1CHITH P02221
B2CHITH P02222
B6CHITH P02224
B7CHITH P12550
B8CHITH Q23763
B9CHITH P02223
a
New sequences presented in this work.
Functional diversification in annelid globin family X. Bailly et al.
2644 FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS
intracellular globins are at the base of a cluster com-
posed of extracellular globins from the insect, Chirono-
mus thummi thummi. The extracellular globin family of

the other arthropod, Artemia salina, surprisingly clus-
ters independently of C. thummi thummi. This topology
illustrates the high level of divergence among extracel-
lular globin families between crustacean and insects in
the Arthropoda phylum, reflecting specific adaptations.
This is particularly obvious when the exon ⁄ intron
structures of arthropod globin genes (summarized in
[35]) are compared, showing the presence of the canon-
ical B12.2 and G7.0 introns position in the Artemia
crustacean and their absence in the Chironomus insects.
Discussion
Annelid globin gene structure
All introns described in this article exhibit the splicing
donor GT and acceptor AG sites (Table 2), whereas in
the L. terrestris B1 globin gene, the donor GT is
replaced by GC [32]. The typical branch point
sequence, involved in spliceosome binding, sometimes
diverges from the standard consensus sequence
(CTRAY), but studies have shown that this consensus
sequence may not reflect the majority of branch point
signals [34].
We used the intron insertion position pattern as ref-
erence in order to follow gene evolution relationships.
We assume that identical intron position between
genes is a strong argument to reject evolutionary
convergence between proteins exhibiting structural
similarity.
We have shown that R. pachyptila and Ar. marina
extracellular globins (A2 and B2), Ar. marina Mb and
Al. pompejana and G. dibranchiata intracellular Hb all

share the same typical two intron ⁄ three exon pattern
(Table 2). These results allow us to rule out the possi-
bility of structural and functional convergence between
circulating and noncirculating intracellular globin and
extracellular globin genes in annelids: these genes prob-
ably evolved from a common globin-like gene ancestor
and did not emerge independently of unrelated genes.
All the annelid intracellular globin gene structures
reported here show the same gene structure, whereas
Aph. aculeata nMb gene lacks the first intron [24]. This
might be explained by the loss of the first intron in the
Aph. aculeata nMb evolutionary lineage [24].
Table 2. Position, length of introns, exon ⁄ intron splice junctions and possible branch points in Ar. marina, Al. pompejana, R. pachyptila, G. di-
branchiata globins and A. ornata globin and DHP genes. Sequences in italic correspond to branch points where the well-conserved C or T or
A is not found. BP, Branch point. The consensus sequences presented are from Mount et al. [33,52].
Consensus Globin ⁄ DHP Intron Position Size (bp)
Splicing donor
A ⁄ C
AG gt
a ⁄ g
agt BP ctray
Splicing acceptor
yyn
c ⁄ t
ag G
G ⁄ T
Ar. marina A2 Intron 1 B12.2 370 GGC gt taagt ⁄ ctgt ag TA
Intron 2 G7.0 773 GAT
gt aagt ctaaa ctat ag CT
B2 Intron 1 B12.2 487 GGA

gt aagt ctaac ttac ag CC
Intron 2 G7.0 495 GAC
gt aagt ataac ctgc ag GA
R. pachyptila A2 Intron 1 B12.2 495 CCA
gt gagt ctaat ttgc ag TG
Intron 2 G7.0 639 GAC
gt aagc cttat cctc ag AC
B2 Intron 1 B12.2 531 GAC
gt aagc cttaa ttgc ag CC
Intron 2 G7.0 390 TCT
gt gagt ctgac ttgc ag CC
A1 Intron 1 B12.2 505 AAA
gt aagt cttat tgac ag CG
Intron 2 G7.0 473 GTT
gt aagt gtcat ttgc ag GT
B1a Intron 1 B12.2 1183 CGA
gt aagt ctcac catc ag GC
Intron 2 G7.0 947 GGA
gt aagt ctaat tttc ag GC
B1b Intron 1 B12.2 601 GTA
gt aagt ctgac tcac ag CA
Intron 2 G7.0 655 CAG
gt agag ttaat ttgc ag CT
B1c Intron 1 B12.2 1029 CAG
gt ttgt ctgac ttgc ag AT
Intron 2 G7.0 489 CAG
gt aaag ctaac ttgc ag GT
Al. pompejana Hb Intron 1 B12.2 135 GGA
gt aagt ctaac accc ag GT
Intra Intron 2 G7.0 241 GCT

gt aagt ctaac tttc ag GA
Ar. marina Mb Intron 1 B12.2 301 CTT
gt aagt ctcaa ccac ag CC
Intron 2 G7.0 500 ACT
gt aagt ctgac cgcc ag GA
G. dibranchiata mIV Intron 1 B12.2 978 CAA
gt aagt ttgat tttc ag GT
Intron 2 G7.0 912 GAG
gt aggt ataac tttc ag CC
A. ornata DHP Intron 1 B12.2 110 CGC
gt aagc ctcat ctgc ag AT
Intron 2 G7.0 2424 GAG
gt gaat atgac cttc ag AA
X. Bailly et al. Functional diversification in annelid globin family
FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS 2645
Distinct evolutionary history of extracellular
globins with respect to intracellular globins
in annelids
Working in the field of comparative biochemistry and
especially on intracellular hemerythrins and hemo-
globins, Manwell & Baker [36] drew attention to a
neglected problem in annelid globin evolution: ‘The
transition between intracellular and extracellular res-
piratory proteins represents a profound evolutionary
accomplishment. It is much more than placing an
appropriate signal polypeptide portion, labeling a pro-
tein for extracellular export.’
Molecular signatures (Fig. 1) clearly indicate that
circulating and noncirculating intracellular globins
share more common features among them than with

extracellular globins. Phylogenetic analyses (Fig. 2)
show that these intracellular globins cluster independ-
ently of extracellular globins, with high bootstrap
values (NJ method, data not shown). This strongly
suggests that extracellular globin lineages have a dis-
tinct evolutionary history with respect to circulating
and noncirculating intracellular globins. Experiments
performed on the polychete, Travisia japonica,by
Fushitani et al. [37] showed that antibodies against
extracellular globins did not cross-react with intracellu-
lar globins. This supports early or rapid divergence
between intracellular and extracellular globin lineages.
Globins are found in many unicellular organisms
such as archae, eubacteria and lower eukaryota [2,38–
40]. The acquisition of a signal peptide for the secre-
tion of extracellular globins is probably an apomorphic
characteristic in multicellular organisms with respect to
unicellular ones. It has been proposed that the secre-
tory peptide may have been acquired by insertion of
some other secreted protein gene by genetic recombi-
nation [41,42]. Therefore, the secretory peptide found
in all annelid extracellular globins must have been
Fig. 2. Bayesian phylogenetic tree based on
annelid extracellular and intracellular globins
(circulating and noncirculating) and DHP
amino-acid sequences. Posterior probability
values are indicated above the branches.
Functional diversification in annelid globin family X. Bailly et al.
2646 FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS
acquired by the original ancestral globin gene, which

has duplicated to give rise to the extracellular globin
multigenic family in this phylum (it is not parsimoni-
ous to envisage a repeated peptide signal acquisition in
the extracellular globin multigenic family).
Even though acquisition of a signal peptide must have
been a determinant step, other features are specific to
annelid extracellular globins. Extracellular state seems
to correlate with the formation of a high-molecular-
mass complex, limiting the protein’s contribution to the
total colloid osmotic pressure of body fluids (vascular
blood and coelomic fluids) [43] and to minimizing rapid
Hb loss by excretion. It is clear that the evolutionary
elaboration of the HBL-Hb structure simultaneously
involved the possibility for globins and linkers (proteins
involved in the structure of HBL-Hb) to interact and to
bind to dimers or other aggregation states while conser-
ving functionality. Indeed, linkers are thought to result
from duplication of globins and rearrangement of exons
[41]. It has been suggested that these ‘nonoxygen-bind-
ing subunits’ may also intrinsically possess superoxide
dismutase and ⁄ or methemoglobin reductase activities
necessary to keep the Hb functional [36]. Evolution of
HBL-Hbs implies the coevolution of extracellular glo-
bins and linkers, which also represents a unique feature
of annelids with respect to other living organisms. Mol-
luscs and arthropods, which also sometimes express
extracellular Hbs, do not exhibit a HBL-Hb quaternary
structure and do not possess linkers. Arthropod extra-
cellular globin sequences also exhibit a signal peptide,
but possess neither internal disulfide bridge nor HBL-

Hb quaternary structure, which suggests a different evo-
lutionary history from extracellular globins in annelids.
In addition, annelid extracellular globins do not cluster
together with arthropod and mollusc extracellular glo-
bins as shown in Fig. 3. To date, it is not possible to
state whether annelid, arthropod and mollusc extracel-
lular globins come from an extracellular globin already
present in a common ancestor before their radiation.
Showing a clear homology between these extracellular
globins would require additional globin sequences.
However, in the Annelida phylum, the HBL-Hb
extracellular globins represent a phylum-specific inno-
vation, and the common gene structure shared between
all annelid globin types attest that extracellular globins
are homologous with the intracellular ones. This rules
out functional and structural convergence occurring by
a gene co-option process.
DHP is a derived globin
A. ornata DHP, Al. pompejana intracellular Hb
and Ar. marina Mb exhibit obvious molecular sig-
natures between each other and with the intracellular
Fig. 3. Bayesian phylogenetic tree based on
annelid, mollusc and arthropod extracellular
and intracellular globins and DHP amino-acid
sequences. Posterior probability values are
indicated above the branches.
X. Bailly et al. Functional diversification in annelid globin family
FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS 2647
monomeric globin N-terminal sequence of the poly-
chete, Enoplobranchus sanguineus [44]. These results,

suggesting a close relationship between DHP and
intracellular globin, are supported by molecular phylo-
genic analyses showing that A. ornata DHP, Al. pom-
pejana intracellular Hb, Ar. marina Mb and Ophelia
bicornis Mb cluster together with high bootstrap
values, with respect to other intracellular globins
(G. dibranchiata and Aph. aculeata nMb) and extra-
cellular globins. Interestingly, we have found that, in
A. ornata, the DHP-encoding gene exhibits the same
gene structure as extracellular globins, Ar. marina Mb
and intracellular globin from Al. pompejana and
G. dibranchiata.
The conserved intron positions between the three
annelid globin types and DHP, the DHP globin fold
and the amino-acid similarities between protein
sequences including globin and DHP allow us to rule
out structurally convergent evolution and indicate the
homology (i.e. common ancestry) of these genes. In
addition, like other typical globins, A. ornata DHP is
able to reversibly bind oxygen. It is found in the oxy-
ferrous (Fe
2+
) state when natively purified [26] and
also exhibits a globin fold, a heme group and distal
histidine [26,27].
We have confirmed by a molecular genetic approach
that DHP is a globin with a derived function, using
its heme to bind the peroxide ligand in order to cata-
lyze the oxidative dehalogenation of polyhalogenated
phenols.

The DHP function, derived from a canonical globin
structure encoded by a globin-like gene, may have
been an innovation selected after annelid radiation
from an oxygen carrying Hb as an adaptation driven
by selection based on territorial war between annelids
excreting halogenous compounds [25].
A. ornata possesses a monomeric circulating Hb in
its coelomic circulating cells [45], but the amino-acid
sequence is still unknown. It is not possible to state
whether DHP and intracellular Hb of A. ornata are
the same protein. Further molecular studies are needed
to confirm whether they are the same protein with
several functions or the result of gene duplication with
subsequent acquisition of a new function.
Experimental procedures
Collection of biological material
Juvenile specimens of the lugworm, Ar. marina, were collec-
ted at low tide from a sandy shore near Roscoff (Penpoull
Beach), Nord Finiste
`
re, France, and kept in local running
sea water for 24 h.
Specimens of Al. pompejana were collected at 2500 m
depth on the East Pacific Rise (9°50¢N at the M-vent site)
by the manned submersible Nautile during the HOPE¢99
cruise. Once on board, the animals were kept in chilled sea
water (10 °C) until used for tissue collection (usually less
than 5 h). Tissues were then frozen in liquid nitrogen until
they were used.
Specimens of the hydrothermal vent tube worm,

R. pachyptila, were collected on the EPR (9°50¢N at the
Riftia Field site) at a depth of about 2500 m, during the
French oceanographic cruise HOT 96 and the American
cruise LARVE’99. The worms were sampled using the tele-
manipulated arms of the submersibles Nautile and Alvin,
brought back alive to the surface inside a temperature-insu-
lated basket, and immediately frozen and stored in liquid
nitrogen after their recovery on board.
Specimens of A. ornata were collected at Debidue flats,
in the North Inlet estuary (Georgetown, SC, 33°20¢N,
79°10¢W) and immediately placed in 70% alcohol until used
for DNA extraction.
Specimens of G. dibranchiata were collected in Maine,
USA and immediately preserved in 70% alcohol until used
for DNA extraction.
Preparation of Al. pompejana intracellular Hb
Coelomic fluid was collected by carefully opening the dorsal
body wall in the middle part of the body. The coelomic fluid
was centrifuged at 1000 g for 3 min at 4 °C, and the cells
were washed twice with filtered sea water. After the last cen-
trifugation, three volumes of distilled water were added to
the pellet of cells obtained, inducing cell lysis. The suspension
obtained was then centrifuged at 10 000 g for 5 min at 4 °C.
The supernatant, containing the cell extract, was then separ-
ated and frozen in liquid nitrogen. To prevent hydrolysis by
proteases, phenylmethanesulfonyl fluoride was added to a
final concentration of 1 lmolÆL
)1
before freezing. Intracellu-
lar Hb was prepared as previously described [18].

Protein sequencing of Al. pompejana intracellular
Hb
Heme was extracted by acid acetone precipitation.
‘De-hemed’ Hb was pyridylethylated as described by Allen
[46] and subsequently dialysed against 0.1% trifluoroacetic
acid. The protein was modified with maleic anhydride and
cleaved with trypsin and CNBr. An Asp-Pro cleavage
was performed as described by Allen [46]. The tryptic
peptides were separated by HPLC on a reversed-phase
Vydac C4 column developed with 0.1% trifluoroacetic
acid ⁄ acetonitrile. The CNBr and Asp-Pro peptides were
separated by SDS ⁄ PAGE [47], and subjected to electroblot-
ting. The peptides were sequenced in an ABI 471-B
sequencer (Applied Biosystems, Foster City, CA, USA)
Functional diversification in annelid globin family X. Bailly et al.
2648 FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS
operated as recommended by the manufacturer. The
N-terminal sequence was obtained by subjecting intact Hb
to Edman degradation.
Total RNA extraction and cDNA synthesis
Entire juvenile specimens of Ar. marina and Al. pompejana
were crushed in liquid nitrogen. Total RNA was extracted
using RNAbleÒ buffer (Eurobio, Courtaboeuf, France),
and poly(A) RNA was then isolated using an mRNA Puri-
fication KitÒ (Amersham, Little Chalfont, Buckingham-
shire, UK). RT-PCR was carried out using an anchor
5¢-CTCCTCTCCTCTCCTCTTCC(T)
17
primer.
Isolation of genomic DNA

Whole specimens of Ar. marina, Al. pompejana, R. pachypti-
la, G. dibranchiata and A. ornata were washed in deionized
water, and then incubated in 700 lL PK Buffer (50 mm
Tris ⁄ HCl, 100 mm NaCl, 25 mm EDTA and 1% SDS, pH 8)
with 15 lL Proteinase K (10 lgÆlL
)1
)at65°C for 1 h. The
supernatant was separated by centrifugation at 12 000 g for
5 min at 4 °C, and added to 700 lL phenol. The DNA was
separated by a standard phenol ⁄ chloroform extraction. The
resulting DNA was precipitated with propan-2-ol, kept at
)20 °C overnight, and centrifuged at 12 000 g for 15 min.
The pellet was then washed once with 75% ethanol. Finally,
the DNA pellet was resuspended in 100 lL TE buffer
(10 mm Tris ⁄ HCl, 0.1 mm EDTA, pH 8) and stored at 4 °C
until used.
Amplification of cDNA and genomic DNA
PCR was carried out in a total volume of 25 lL containing
10–50 ng template cDNA ⁄ gDNA, 100 ng each degenerate
primer, 200 lm dNTPs, 2.5 mm MgCl
2
and 1 U DNA
polymerase (Uptima, Interchim, Montluc¸ on, France). PCR
conditions were as follows: an initial denaturation step at
95 °C for 5 min, 35 cycles consisting of denaturation at
95 °C for 30 s, annealing for 30 s, extension at 72 °C for
40 s, and a final elongation step at 72 °C for 10 min. Prim-
ers are given in Table 3.
Cloning and sequencing
The PCR products were cloned using a TOPOÒ-TA

cloning Kit (Invitrogen, Cergy Pontoise, France). The pos-
itive recombinant clones were isolated, and plasmid DNA
was prepared with the FlexiPrep Kit (Amersham). Purified
plasmids containing the putative globin insert were used in
a dye–primer cycle sequencing reaction, using the primer
T7 and the Big DyeÒ Terminator V3.1 Cycle Sequencing
kit (Applied Biosystems). PCR products were subsequently
run on a 3100 Genetic Analyser (Applied Biosystems) at
Roscoff Sequencing Core Facility Ouest GenopoleÒ
Plateform.
Table 3. Primer sequences used for the PCR amplification. CDS, Coding sequence.
Species Forward (5¢ to 3¢) Reverse (5¢ to 3¢)
Ar. marina A2 CDS GARTGYGGNCCNTTRCARCG CCANGCNTCYTTRTCRAAGCA
Intron 1 GTCAGGGACGAGGCCGGA ACTCTCTTGAAGAGAGCCCG
Intron 2 GCACGTAGAAAGGCACATCC GCTGGGGGCATACTCCATCA
B2 CDS TGYTGYAGYATHGARGAYCG CANGCNYCNGRRTTRAARCA
Intron 1 TTCACTGGTCGCCGTGTCCA TTCTTGGACTCGGGGTCGC
Intron 2 AGCACAAGGAGCGTGATGGC TGCTGACCTGGGGCATGAC
R. pachyptila A1 Intron 1 CGGTATCGGTGCTGCCC TGTCTTTGGAGTTGACACTTTCG
Intron 2 CCAGGCGACGCTCGATGCTG TGGCACGTCGAAGCAGACG
B1a Intron 1 AGCAAGGAGCAAGCTCT GTGAACAGATTCTTGGC
Intron 2 CGTGACGGCGTTACCAAAG AGGCGTCGGGGTTGAATC
B1b Intron 1 GAACAAGTGCGAGTGGAGCT TAAACAACTGTTTAGCCGC
Intron 2 GACATCTCGCCAGCCAACA CGACGACCTGAGGAAGCAA
B1c Intron 1 CCTCCAACGGCGGCAAGTTGCC TGAAGAGGTTCTTGGCAGTGG
Intron 2 CAGGGTCTGCTCGACTCTCTG CGATAAGCTGAGGCATCACC
Al. pompejana Hb Intra CDS GCNGAYAAYATHGCNGCNGT RTTRTANGCYTGYTCCCANGC
Intron 1 GCGGTTAGGGGTGATGTCTC GCGTCTTGAACTTGGGCAG
Intron 2 CTGCCCAAGTTCAAGACGC GTTCCCATGCAGCCGAGT
Ar. marina Mb CDS GCNGAYCARATGGCNGCNGTNAA CNCCNGTNGCNGCNGTCCA

Intron 1 CATCGCCGCCGTGAAG TGGCAACAGAGCCCAAAGA
Intron 2 TGTGGAGAAGGGCGGAGA GGCCAGGAAGGGGACGA
G. dibranchiata mIV Intron 1 GAGAACAGCACCTGAAGCAAA CCATCTGTGCCAACACTTTC
Intron 2 GGCACAGATTGGCGTCG AGCAGTGACGCACCCAGA
A. ornata DHP Intron 1 AAGATATTGCCACCCTCCG GGTCAGATTTGCCGACATAGTT
Intron 2 CACTCGTCCAGATGAAACAGC CGCGGAGACCAAATTCTTG
X. Bailly et al. Functional diversification in annelid globin family
FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS 2649
Rapid amplification of cDNA ends
cDNA ends were obtained by PCR using the 5¢-RACE and
3¢-RACE kit (Roche, Grenzacherstrasse, Switzerland)
according to the manufacturer’s instructions. Buffer, rea-
gents and other conditions for the nested PCR were as
described by the manufacturer. The RACE products
were purified, cloned with the TOPO-TA cloning kit
(Amersham), and sequenced as described above.
Sequence analyses
Signal peptide
The peptide signal cleavage site was predicted by the
SignalP 3.0 Server [48] ( />SignalP).
Database analysis
The tblastn and tblastx search algorithms [49] were
employed to search data on the Uniprot database (http://
www.ebi.ac.uk).
Globin multiple alignment
We performed a global multiple alignment including anne-
lid, mollusc and arthropod intracellular and extracellular
globins. We present here only the annelid globin multiple
alignment; the global one including molluscs and arth-
ropods is available on request. All the globin sequences

used in the multiple alignment are listed in Table 1.
Amino-acid sequences were aligned with the program
muscle [50] ( />muscle/input_muscle.py) and adjusted manually.
Molecular phylogeny
For the two sets of aligned globins (annelids on one hand
and annelids, molluscs and arthropods on the other), Baye-
sian analysis was carried out using mrbayes 3.1.1 (http://
mrbayes.csit.fsu.edu/index.php) and the JTT transition mat-
rix [51]. Four chains were run simultaneously for 10
6
gener-
ations, and trees were sampled every 100 generations,
producing a total of 10
4
trees.
Acknowledgements
We thank Dr Joa
˜
o Gil for collecting specimens of
G. dibranchiata, and Dr David Lincoln for collecting
specimens of A. ornata. We gratefully acknowledge the
captain and crew of the NO L’Atalante, the pilots and
groups of the French and US submersibles Nautile
and Alvin, respectively. We are also very grateful to
the chief scientists of the HOT’96, LARVE’99 and
HOPE’99 oceanographic cruises. This work was sup-
ported by CNRS, European grant (FEDER no. pres-
age 3814) and the Conseil Re
´
gional de Bretagne

(contract no. 809) (FZ). SD is a postdoctoral fellow of
the FWO (Fund for Scientific Research Flanders).
References
1 Hardison R (1998) Hemoglobins from bacteria to man:
evolution of different patterns of gene expression. J Exp
Biol 201, 1099–1117.
2 Vinogradov SN. et al. (2005) Three globin lineages
belonging to two structural classes in genomes from the
three kingdoms of life. Proc Natl Acad Sci USA 102,
11385–11389.
3 Goodman M. et al. (1988) An evolutionary tree for
invertebrate globin sequences. J Mol Evol 27, 236–249.
4 Moens L. et al. (1996) Globins in nonvertebrate species:
dispersal by horizontal gene transfer and evolution of
the structure–function relationships. Mol Biol Evol 13,
324–333.
5 Suzuki T & Imai K (1998) Evolution of myoglobin. Cell
Mol Life Sci 54, 979–1004.
6 Wittenberg JB (1970) Myoglobin-facilitated oxygen dif-
fusion: role of myoglobin in oxygen entry into muscle.
Physiol Rev 50, 559–636.
7 Vinogradov SN, Walz DA, Pohajdak B, Moens L,
Kapp OH, Suzuki T & Trotman CN (1993) Adventi-
tious variability? The amino acid sequences of nonverte-
brate globins. Comp Biochem Physiol B 106, 1–26.
8 Weber RE & Vinogradov SN (2001) Nonvertebrate
hemoglobins: functions and molecular adaptations. Phy-
siol Rev 81, 569–628.
9 Wittenberg BA, Briehl RW & Wittenberg JB (1965)
Haemoglobins of invertebrate tissues. Nerve haemo-

globins of Aphrodite, Aplysia and Halosydna. Biochem
J 96, 363–371.
10 Terwilliger RC, Garlick RL & Terwilliger NB (1980)
Characterization of hemoglobins and myoglobin
of Travisia foetida. Comp Biochem Physiol 66B, 261–266.
11 Kleinschmidt T & Weber RE (1998) Primary structures
of Arenicola marina isomyoglobins: molecular basis for
functional heterogeneity. Biochim Biophys Acta 1383,
55–62.
12 Zafar RS, Chow LH, Stern MS, Scully JS, Sharma PR,
Vinogradov SN & Walz DA (1990) The cDNA
sequences encoding two components of the polymeric
fraction of the intracellular hemoglobin of Glycera
dibranchiata. J Biol Chem 265 , 21843–21851.
13 Zafar RS, Chow LH, Stern MS, Vinogradov SN &
Walz DA (1990) The heterogeneity of the polymeric
intracellular hemoglobin of Glycera dibranchiata and the
cDNA-derived amino acid sequence of one component.
Biochim Biophys Acta 1041, 117–122.
Functional diversification in annelid globin family X. Bailly et al.
2650 FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS
14 Seamonds B, Forster RE & Gottlieb AJ (1971)
Heterogeneity of the hemoglobin from the common
bloodworm Glycera dibranchiata. J Biol Chem 246,
1700–1705.
15 Gotoh T, Shishikura F, Snow JW, Ereifej KI,
Vinogradov SN & Walz DA (1987) Two globin strains
in the giant annelid extracellular haemoglobins.
Biochem J 241, 441–445.
16 Bailly X, Jollivet D, Vanin S, Deutsch J, Zal F, Lallier

F & Toulmond A (2002) Evolution of the sulfide-bind-
ing function within the globin multigenic family of the
deep-sea hydrothermal vent tubeworm Riftia pachyptila.
Mol Biol Evol 19, 1421–1433.
17 Weber RE (1978) Respiratory pigments. In Physiology
of Annelids (Mill PJ, ed), pp. 393–446. Academic Press
Inc, New York, NY.
18 Hourdez S, Lallier FH, De Cian MC, Green BN, Weber
RE & Toulmond A (2000) Gas transfer system in
Alvinella pompejana (Annelida polychaeta, Terebellida):
functional properties of intracellular and extracellular
hemoglobins. Physiol Biochem Zool 73, 365–373.
19 Negrisolo E, Pallavicini A, Barbato R, Dewilde S,
Ghiretti-Magaldi A, Moens L & Lanfranchi G (2001)
The evolution of extracellular hemoglobins of annelids,
vestimentiferans, and pogonophorans. J Biol Chem 276,
26391–26397.
20 Gotoh O & Suzuki T (1990) Molecular assembly and
evolution of multi-subunit extracellular annelid hemo-
globins. Zool Sci 7, 1–16.
21 Jhiang SM & Riggs AF (1989) The structure of the gene
encoding chain c of the hemoglobin of the earthworm,
Lumbricus terrestris. J Biol Chem 264, 19003–19008.
22 Dewilde S, Van Hauwaert ML, Vinogradov S, Viers-
traete A, Vanfleteren J & Moens L (2001) Protein and
gene structure of a chlorocruorin chain of Eudistylia
vancouverii. Biochem Biophys Res Commun 281, 18–24.
23 Bailly X (2003) Evolution de la fonction de liaison du
sulfure d’hydroge
`

ne par les he
´
moglobines de Riftia
pachyptila, anne
´
lide tubicole des sources hydrothermales
profondes. The
`
se de doctorat, E
´
cole Pratique des
Hautes Etudes et Universite
´
Pierre et Marie Curie, Paris
VI, France.
24 Dewilde S, Blaxter M, Van Hauwaert ML, Vanfleteren J,
Esmans EL, Marden M, Griffon N & Moens L (1996)
Globin and globin gene structure of the nerve myoglobin
of Aphrodite aculeata. J Biol Chem 271, 19865–19870.
25 Chen YP, Woodin SA, Lincoln DE & Lovell CR (1996)
An unusual dehalogenating peroxidase from the marine
terebellid polychaete Amphitrite ornata. J Biol Chem
271, 4609–4612.
26 Roach MP, Chen YP, Woodin SA, Lincoln DE, Lovell
CR & Dawson JH (1997) Notomastus lobatus chloro-
peroxidase and Amphitrite ornata dehaloperoxidase both
contain histidine as their proximal heme iron ligand.
Biochemistry 36
, 2197–2202.
27 LaCount MW, Zhang E, Chen YP, Han K, Whitton

MM, Lincoln DE, Woodin SA & Lebioda L (2000) The
crystal structure and amino acid sequence of dehalo-
peroxidase from Amphitrite ornata indicate common
ancestry with globins. J Biol Chem 275, 18712–18716.
28 Strand K, Knapp JE, Bhyravbhatla B & Royer WE Jr
(2004) Crystal structure of the hemoglobin dodecamer
from Lumbricus erythrocruorin: allosteric core of
giant annelid respiratory complexes. J Mol Biol 344,
119–134.
29 Fushitani K, Matsuura MS & Riggs AF (1988) The
amino acid sequences of chains a, b, and c that form
the trimer subunit of the extracellular hemoglobin from
Lumbricus terrestris. J Biol Chem 263, 6502–6517.
30 Suzuki T, Kapp OH & Gotoh T (1988) Novel S-S loops
in the giant hemoglobin of Tylorrhynchus heterochaetus.
J Biol Chem 263, 18524–18529.
31 Suzuki T, Takagi T & Ohta S (1993) N-terminal amino
acid sequences of 440 kDa hemoglobins of the deep-sea
tube worms, Lamellibrachia sp.1, Lamellibrachia sp.2
and slender vestimentifera gen. sp. 1 evolutionary
relationship with annelid hemoglobins. Zool Sci 10,
141–146.
32 Jhiang SM, Garey JR & Riggs AF (1988) Exon-intron
organization in genes of earthworm and vertebrate
globins. Science 240, 334–336.
33 Keller EB & Noon WA (1984) Intron splicing: a con-
served internal signal in introns of animal pre-mRNAs.
Proc Natl Acad Sci USA 81, 7417–7420.
34 Harris NL & Senapathy P (1990) Distribution and con-
sensus of branch point signals in eukaryotic genes: a

computerized statistical analysis. Nucleic Acids Res 18,
3015–3019.
35 Dewilde S, Van Hauwaert M-L, Peeters K, Vanfleteren
J & Moens L (1999) Daphnia pulex didomain hemo-
globin: structure and evolution of polymeric hemo-
globins and their coding genes. Mol Biol Evol 16,
1208–1218.
36 Manwell C & Baker CMA (1988) Magelona haemery-
thrin: tissue specificity, molecular weights and oxygen
equilibria. Comp Biochem Physiol 89B, 453–463.
37 Fushitani K, Ochi O & Morimoto H (1982) Purifica-
tion, characterization, and comparison of extracellular
hemoglobins in coelomic fluid and blood vessel plasma
of Travisia japonica (Polychaeta, Annelid). Comp Bio-
chem Physiol B 72, 267–273.
38 Freitas TA, Hou S, Dioum EM, Saito JA, Newhouse J,
Gonzalez G, Gilles-Gonzalez MA & Alam M (2004)
Ancestral hemoglobins in Archaea. Proc Natl Acad Sci
USA 101, 6675–6680.
39 Zhu H & Riggs AF (1992) Yeast flavohemoglobin is an
ancient protein related to globins and a reductase
family. Proc Natl Acad Sci USA 89, 5015–5019.
40 Andersson JO, Sjogren AM, Davis LA, Embley TM &
Roger AJ (2003) Phylogenetic analyses of diplomonad
X. Bailly et al. Functional diversification in annelid globin family
FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS 2651
genes reveal frequent lateral gene transfers affecting
eukaryotes. Curr Biol 13, 94–104.
41 Riggs AF (1991) Aspects of the origin and evolution of
non-vertebrate hemoglobins. Am Zool 31, 535–545.

42 Williams EJ, Pal C & Hurst LD (2000) The molecular
evolution of signal peptides. Gene 253, 313–322.
43 Toulmond A. (1992) Properties and functions of extra-
cellular heme pigments. In Advances in Comparative and
Environmental Physiology (Mangum CP, ed.), Vol. 13,
pp 231–256. Springer, New York.
44 Weber RE, Mangum C, Steinman H, Bonaventura C,
Sullivan B & Bonaventura J (1977) Hemoglobins of two
terebellid polychaetes: Enoplobranchus sanguineus and
Amphitrite ornata. Comp Biochem Physiol A 56,
179–187.
45 Mangum CP, Woodin BR, Bonaventura C, Sullivan B
& Bonaventura J (1975) The role of coelomic and vas-
cular hemoglobin in the annelid family terebellidae.
Comp Biochem Physiol A 51, 281–294.
46 Allen G (1989) Sequencing of proteins and peptides. In
Laboratory Techniques in Biochemistry and Molecular
Biology (Burdon RH, Van Knippenberg PH, eds), Vol.
9, pp. 73–104. Elsevier North Holland, Amsterdam.
47 Swank RT & Munkres KD (1971) Molecular weight
analysis of oligopeptides by electrophoresis in polyacry-
lamide gel with sodium dodecyl sulfate. Anal Biochem
39, 462–477.
48 Bendtsen JD, Nielsen H, von Heijne G & Brunak S
(2004) Improved prediction of signal peptides: SignalP
3.0. J Mol Biol 340, 783–795.
49 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang
Z, Miller W & Lipman DJ (1997) Gapped BLAST and
PSI-BLAST: a new generation of protein database
search programs. Nucleic Acids Res 25, 3389–3402.

50 Edgar RC (2004) MUSCLE: multiple sequence align-
ment with high accuracy and high throughput. Nucleic
Acids Res 32, 1792–1797.
51 Jones DT, Taylor WR & Thornton JM (1992) The
rapid generation of mutation data matrices from protein
sequences. Comput Appl Biosci 8, 275–282.
52 Mount SM (1982) A catalogue of splice junction
sequences. Nucleic Acids Res 10, 459–472.
Functional diversification in annelid globin family X. Bailly et al.
2652 FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS