Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

Cloning and characterization of CBL-CIPK signalling
components from a legume (Pisum sativum)
Shilpi Mahajan, Sudhir K. Sopory and Narendra Tuteja
Plant Molecular Biology, International Centre for Genetic Engineering and Biotechnology, New Delhi, India
In plants, calcium plays an important role in regula-
ting gene expression and many other processes inclu-
ding abiotic stress signalling. However, the molecular
mechanisms underlying the role of calcium in cellular
functions are not well established. Many external
stimuli including light and various stress factors can
bring out changes in cellular Ca
2+
level, which can
affect plant growth and development [1,2]. The Ca
2+
serves as second messenger and its concentration is
delicately balanced by the presence of ‘Ca
2+
stores’
such as vacuoles, endoplasmic reticulum, mitochon-
dria and cell wall. Ca
2+
signals exhibit a high degree
of specificity and are decoded by Ca
2+
sensing
proteins known as Ca
2+
sensors, which are small
proteins interacting with their target proteins to relay
the signal. In plant cells many Ca

2+
sensors have
been identified which include calmodulin (CaM) and
calmodulin-related proteins [3,4], Ca
2+
-dependent
protein kinases (CDPKs) [5,6], and calcineurin B-like
proteins (CBLs) [4]. The first plant CBL to be iden-
tified was from Arabidopsis thaliana, and is known
as both AtCBL and ScaBP (SOS3-like calcium-
binding protein) [7,8]. CBL proteins contain four
Ca
2+
-binding EF hand motifs [9] and functions by
interacting and regulating a group of Ser ⁄ Thr pro-
tein kinases called CBL-interacting protein kinases
Keywords
abscisic acid; abiotic stress; biotic stress;
calcium sensor CBL; CIPK
Correspondence
N. Tuteja, Plant Molecular Biology,
International Centre for Genetic Engineering
and Biotechnology, Aruna Asaf Ali Marg,
New Delhi, 110067, India
Fax: +91 11 26162316
E-mail:
Note
The sequences reported in this paper have
been deposited in the General Bank
database (accession nos. AY134619 (pea

CBL cDNA); AY883569 (pea CBL genomic
clone); AY191840 (pea CIPK cDNA).
(Received 7 October 2005, revised 11
December 2005, accepted 19 December
2005)
doi:10.1111/j.1742-4658.2006.05111.x
The studies on calcium sensor calcineurin B-like protein (CBL) and CBL
interacting protein kinases (CIPK) are limited to Arabidopsis and rice and
their functional role is only beginning to emerge. Here, we present cloning
and characterization of a protein kinase (PsCIPK) from a legume, pea,
with novel properties. The PsCIPK gene is intronless and encodes a protein
that showed partial homology to the members of CIPK family. The recom-
binant PsCIPK protein was autophosphorylated at Thr residue(s). Immu-
noprecipitation and yeast two-hybrid analysis showed direct interaction of
PsCIPK with PsCBL, whose cDNA and genomic DNA were also cloned in
this study. PsCBL showed homology to AtCBL3 and contained calcium-
binding activity. We demonstrate for the first time that PsCBL is phos-
phorylated at its Thr residue(s) by PsCIPK. Immunofluorescence ⁄ confocal
microscopy showed that PsCBL is exclusively localized in the cytosol,
whereas PsCIPK is localized in the cytosol and the outer membrane. The
exposure of plants to NaCl, cold and wounding co-ordinately upregulated
the expression of PsCBL and PsCIPK genes. The transcript levels of both
genes were also coordinately stimulated in response to calcium and salicylic
acid. However, drought and abscisic acid had no effect on the expression
of these genes. These studies show the ubiquitous presence of CBL ⁄ CIPK
in higher plants and enhance our understanding of their role in abiotic and
biotic stress signalling.
Abbreviations
3-AT, 3-aminotrizole; ABA, abscisic acid; CaM, calmodulin; CBL, calcineurin B-like protein; CDPK, Ca
2+

-dependent protein kinase; CIPK, CBL
interacting protein kinases; DAPI, diamidino-2phenylindole hydrochloride; DTT, dithiothreitol; IPTG, isopropyl thio-b-
D-galactoside; SA, salicylic
acid; SD, synthetic dextrose; UAS, upstream activating sequences; UTR, 5¢ untranslated region; YPD, yeast extract–peptone–dextrose.
FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS 907
(CIPKs) [4,10,11]. CIPKs most likely represent tar-
gets of Ca
2+
signals sensed and transduced by CBL
proteins.
CIPK consist of a catalytic domain (at the N ter-
minus) and a regulatory domain (at the C terminus)
that interact with each other to keep the enzyme
inactive (autoinhibition), presumably by preventing
substrate access to the catalytic site [12]. CBL binds
to the FISL motif (or NAF domain) ) an autoinhib-
itory domain present in the regulatory domain of the
CIPK – and thereby makes the enzyme active by
disrupting the intramolecular domain interaction of
CIPK [12–14]. A database search revealed 10
AtCBLs and 25 CIPKs in the Arabidopsis genome
and 10 CBLs and 30 CIPKs in the rice genome
[4,12,15]. An analysis of genome evolution suggested
that a large number of gene family members resulted
from segmental duplications [15]. Furthermore, dif-
ferential affinities among different AtCBL–CIPK
members have been reported [11,12]. For example,
AtCBL1 is known to interact only with a subset of
six CIPKs (AtCIPK 1, 7, 8, 17, 18 and 24) [15]. The
multiple combinations of CBL–CIPK complexes

might provide a novel mechanism to integrate and
specifically decode signals in plants [12,13]. Recent
studies in Arabidopsis indicated that several such
genes function in stress [12,14–21]. Except in Arabid-
opsis and rice the CBL–CIPK pathways have not
been well studied in higher plants.
In this report, we describe the cloning and charac-
terization of a novel CIPK and its interacting partner
CBL from Pisum sativum. PsCIPK showed auto-
phosphorylation and could phosphorylate pea CBL
and other substrates such as casein. The mRNA lev-
els of PsCIPK were coordinately upregulated along
with CBL, in response to various abiotic and biotic
stresses, and to calcium and salicylic acid, but not to
abscisic acid (ABA) or dehydration. PsCIPK showed
dual localization (in the cytosol and the plasma mem-
brane) while CBL was localized exclusively in the
cytosol.
Results
Isolation and sequence analysis of PsCIPK and
CBL cDNAs and genomic clones
For cDNA cloning, first partial fragments of 550 bp for
PsCIPK and 335 bp for PsCBL were amplified by PCR
using double-stranded cDNAs (prepared from mRNA
isolated from NaCl-stressed pea seedlings) as template
and the degenerate primers, designed from the conserved
areas of AtCIPK and AtCBL of Arabidopsis, respect-
ively (data not shown). The cDNA clones of CIPK
(pBS-PsCIPK) and CBL (pBS-PsCBL) were obtained
by screening the pea cDNA library with respective par-

tial DNA fragments as probes. Sequence analysis of
pBS-CIPK cDNA (Accession no. AY191840) shows that
it encodes a full length cDNA, 1842 bp in size with an
ORF of 1553 bp, a 5¢ untranslated region (UTR) of
47 bp and a 3¢ UTR of 242 bp including 39 bp of
poly(A) tail. The PsCIPK ORF encodes a protein of 516
amino acid residues with a predicted molecular mass of
 57.9 kDa and pI 8.23. Sequence analysis of pBS-CBL
cDNA (Accession no. AY134619) shows that it encodes
a full length cDNA, 972 bp in size with an ORF of
678 bp, a 5¢ UTR of 131 bp and a 3¢ UTR of 163 bp
including 20 bp of poly(A) tail. The PsCBL ORF
encodes a protein of 225 amino acid residues with a
calculated molecular mass of 25.9 kDa and pI 4.67.
The amino acid sequence alignment of PsCIPK with
AtCIPK12, AtCBL19, Gossypium hirsutum (Gh) kin-
ase, and AtCIPK18 is shown in Fig. 1A. The N-ter-
minal domain of PsCIPK contains an activation
domain starting from the conserved DFG and ending
at APE; the C-terminal domain contains the NAF
(FISL) motif (Fig. 1A). Phylogenetic analysis indicated
67% sequence identity with AtCIPK12 (Accession
no. NP_193605), 66% with AtCIPK24 ⁄ SOS2-like
(AAK26847), and 66% with GhCIPK (AAT64036)
(data not shown). The identity of PsCIPK with other
AtCIPKs is: 64% with AtCIPK19 (NP199393), and
62% with AtCIPK18 (NP174217) (data not shown).
Fig. 1. Multiple amino acid sequence alignment. (A) Comparison of predicted amino acid sequences of PsCIPK with AtCIPK12 (Accession
no.NP_193605), AtCIPK19 (NP199393), GhCIPK (AAT64036) and AtCIPK18 (NP174217). The activation and NAF domains are shown in the
boxes. (B) The deduced amino acid sequence of PsCBL is aligned with rice CBL (OsCBL, Accession no. AAR01663) and AtCBL3

(AAM91280). The calcium binding domains (EF1–4) and calcineurin A binding domain are shown in the box. The dot in the EF1 box repre-
sents the modified amino acids alanine (A) as compared to the oxygen containing-calcium binding residue aspartate (D). The conserved dis-
tances between EF hands are marked. Multiple alignments were performed using
CLUSTAL W. The program recognizes a consensus residue
and based on that residue other amino acids that fall in that consensus position are marked. The most identical amino acids at each protein
are dark shaded and similar ones are light shaded whereas nonsimilar ones are left unshaded. The amino acids marked by red, blue, green
and pink lines indicates the putative casein kinase II, protein kinase C, the cAMP- and cGMP-dependent protein kinase and putative tyrosine
kinase phosphorylation sites, respectively.
Stress-induced CIPK from pea phosphorylate CBL S. Mahajan et al.
908 FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS
A
B
S. Mahajan et al. Stress-induced CIPK from pea phosphorylate CBL
FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS 909
The amino acid sequence alignment of PsCBL with
rice CBL (OsCBL) and Arabibopsis CBL (AtCBL3) is
shown in Fig. 1B. It lacks the myristoylation site in
the N-terminal sequence. PsCBL contains four EF
hand Ca
2+
-binding domains (Fig. 1B). The EF1 shows
variation from the canonical EF hand. The amino acid
D at position 1, of EF1 is replaced by amino acid A
(Fig. 1B). The EF1 and EF2 are 22 amino acids apart,
whereas EF2 and EF3, and EF3 and EF4 are 25 and
32 amino acids apart, respectively (Fig. 1B). The cal-
cineurin A binding domain is also present between
positions 155 and 172 (Fig. 1B). Phylogenetic analysis
indicated the identity of PsCBL with OsCBL (Acces-
sion no. AAR01663), AtCBL3 (AAM91280), AtCBL2

(AAM65177), AtCBL6 (AAG28400), AtCBL4 ⁄ SOS3-
like (BAD43952), and AtCBL1 (BAC43389) as 92, 90,
89, 71, 68, and 66%, respectively (data not shown).
Genomic organization of PsCIPK and PsCBL
For PsCIPK, a genomic fragment (1.84 Kb) was
amplified by PCR from the pea genomic DNA as a
template with the 5¢ UTR and 3¢ UTR specific primers
of PsCIPK gene. As a control the primers were used
to amplify a cDNA fragment of expected size 1.84 Kb
using cDNA as a template. To confirm the specificity
of the PCR products a nested PCR (2nd PCR) was
performed using PsCIPK gene-specific internal prim-
ers. These fragments were then cloned and sequenced
(data not shown). The same size and sequence of the
genomic fragment of PsCIPK and the cDNA show
that PsCIPK is an intron-less gene.
For the PsCBL gene, a genomic fragment (3.22 Kb)
was amplified by PCR using the pea genomic DNA as
a template with the 5¢ UTR and 3¢ UTR specific prim-
ers of the PsCBL gene. As a control, the same set of
primers was used to amplify a cDNA fragment of
expected size 0.97 Kb using cDNA as a template. To
confirm the specificity of the PCR products a nested
PCR (2nd PCR) was performed using gene-specific
internal primers. As a result 2.547 Kb genomic and
0.67 Kb (expected size) cDNA fragments were
obtained, which were cloned and sequenced (data not
shown). The higher size of the genomic fragment of
PsCBL as compared to the cDNA indicates that this
gene contains introns. Sequence analysis of the genomic

clone reveals that the PsCBL genomic clone spans
2.547 Kb (Accession no. AY883569) (from ATG to
TAA). Alignment of the genomic sequence with the
cDNA sequence identified eight exons (121, 82, 59, 108,
52, 80, 112, and 58 bp in size) and seven introns (331,
223, 682, 346, 80, 109, and 92 bp in size) (Fig. 2A).
Two introns of 401 and 81 bp were found localized in
the 5¢ UTR region (Fig. 2A). Most of the 3¢ and 5¢
splice junctions follow the typical canonical consensus
dinucleotide sequence GU-AG found in other plant in-
trons. Figure 2B shows the genomic organization of
AtCBL3 (Accession no. AT4G265702) containing seven
exons and six introns. The sizes of all the exons except
exon 5 were found to be mostly conserved between
PsCBL and AtCBL3 (Fig. 2A and B). The PsCBL gene
has an additional splice site at the fifth exon. Accord-
ingly; there was one intron fewer in AtCBL3 as com-
pared to PsCBL (Fig. 2A and B). The sizes of introns
are not conserved between the two species (Fig. 2A
and B).
Tissue distribution of PsCBL and CIPK and their
copy number in pea genome
The transcript levels of PsCIPK and PsCBL in
different tissues of pea were studied by northern
A
B
Fig. 2. Genomic organization of PsCBL. The schematic representation of the exon–intron organization of genomic PsCBL clone (A) and the
Arabidopsis homologue (AtCBL3) clone (B). Closed boxes represent exons, and lines between closed boxes represent introns. The dark
boxes represent the UTRs. The position of ATG and TAA are marked. The numbers below the lines and the above boxes indicate the sizes
(bp) of introns and exons, respectively.

Stress-induced CIPK from pea phosphorylate CBL S. Mahajan et al.
910 FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS
hybridization. PsCIPK (1.8 Kb) and PsCBL (1.0 Kb)
were ubiquitously present in all the tissues examined
including root, shoot, tendril and flower, but at relat-
ively higher levels in leaves and roots as compared to
the other tissues (data not shown).
The pattern of Southern genomic hybridization
bands under low (data not shown) and high strin-
gency washing conditions suggests that both PsCIPK
and PsCBL exist as single-copy genes in the pea
genome (Fig. 3A and B, respectively). Restriction
enzymes which either had a specific site in the gene
or which had no restriction site were used. Some of
the enzymes such as SpeI and XbaI, which had no
recognition site in PsCIPK cDNA and genomic
DNA sequence gave a single band after hybridiza-
tion (Fig. 3A, lanes 1 and 2), whereas enzymes such
as BglII and NdeI, which had a single specific site in
the gene gave two bands after hybridization (lanes 3
and 4). However, with HindIII, which has a single
site in the gene towards the 3¢ end (that would
result in 3127 and 94 bp fragments) gave single band
around the 5 Kb region (Fig. 3B, lane 6). It is poss-
ible that the second fragment containing a very small
part of the gene did not hybridize under the condi-
tions used. Enzymes such as EcoRI, BglII and NdeI,
which had no recognition site in the PsCBL cDNA
and genomic DNA sequence gave a single band after
hybridization (Fig. 3B, lanes 3, 4 and 7), whereas

enzymes such as SpeI and SacI, which had a single
specific restriction site in the gene gave two bands
after hybridization (lanes 2 and 5).
Expression and purification of PsCIPK and PsCBL
The pea cDNA encoding CIPK and CBL were cloned
into the expression vector pET28a and the recombin-
ant proteins were expressed in Escherichia coli.
SDS ⁄ PAGE analysis showed a highly expressed a
58 kDa additional polypeptide for PsCIPK (Fig. 4A,
lane 2) and a 26 kDa additional polypeptide for
PsCBL (Fig. 4G, lane 2) in isopropyl thio-b-d-gal-
actoside (IPTG) induced fractions, respectively, as
compared to uninduced (lane 1). The recombinant
PsCIPK and PsCBL were present in the soluble frac-
tions and therefore purified in the soluble form
through a single Ni
2+
–NTA–agarose column chroma-
tography step. PsCIPK and PsCBL proteins, purified
to near homogeneity, showed a 58-kDa (Fig. 4A, lane
3) and a 26-kDa band (Fig. 4G, lane 3), respectively.
In western blotting, the anti-PsCIPK and PsCBL
antibodies detected PsCIPK as a single band of
58 kDa (Fig. 4B, lane 2 and 3, respectively) and a
single band 26 kDa of PsCBL (Fig. 4H, lane 2 and 3)
in the IPTG-induced fraction and in the purified
fraction. There was no signal in the uninduced frac-
tion of PsCIPK (Fig. 4B, lane 1) or PsCBL (Fig. 4H,
lane 1). The purified PsCIPK and PsCBL proteins
were also recognized by anti-His antibody (data not

shown).
PsCBL encodes a functional Ca
2+
-binding protein
The presence of conserved EF-hand motifs in the
predicted protein sequence of PsCBL suggests that it
may function as Ca
2+
-binding protein. To check the
Ca
2+
-binding activity of PsCBL, the purified protein
in two different concentrations (3 and 4 lg) along
with positive and negative controls were fractionated
by SDS ⁄ PAGE (Fig. 4I), electro-blotted onto mem-
brane and incubated with radioactive
45
CaCl
2
(Fig. 4J). The same sets of proteins were also spotted
on a membrane (dot blot) and treated as above
(Fig. 4K). The results show that PsCBL binds to
45
Ca
2+
(Fig. 4J, lanes 2 and 3). The positive control
Entamoeba histolytica calcium binding protein
(EhCaBP) [22], showed binding to
45
Ca

2+
(Fig. 4J,
lane 1), while negative controls (glutathione S-trans-
ferase and BSA) lack the binding (Fig. 4J, lanes 4
and 5). Similar results were obtained with dot blot
analysis (Fig. 4K). In Fig. 4K, spots 1 and 2 are
PsCBL protein (3 and 4 lg), lanes 3 and 4 are the
same negative controls and lane 5 is the positive
NU
1caS
1RocE
11lgB
1ed
N
111dn
i
H
A CIPK
1abX
12.0
0.5
1.0
1.6
2.0
3.0
4.0
5.0
7.0
1epS
B CBL

kbkb
12.0
0.5
1.0
1.6
2.0
3.0
4.0
5.0
7.0
NU
11lgB
1edN
1epS
Fig. 3. Southern blot analysis of PsCIPK and PsCBL to determine
copy number in the pea genome. (A, B) Genomic DNA gel blots
analysis. Pea genomic DNA (30 lg) was completely digested with
the enzyme indicated, separated by electrophoresis, blotted and
hybridized with the [a-
32
P]dCTP-labelled PsCIPK (1.2-Kb fragment
from the 3¢ end containing the 3¢ UTR) (A) and [a-
32
P]dCTP-labelled
PsCBL cDNA (0.97 Kb, full-length) (B), cDNAs as probes. Un, Uncut
DNA. The DNA size (Kb) is indicated at the left.
S. Mahajan et al. Stress-induced CIPK from pea phosphorylate CBL
FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS 911
control. The CD spectrum of purified recombinant
PsCBL (1.2 mgÆmL

)1
) in the presence and absence of
Ca
2+
was markedly different (Fig. 4L). The spectrum
of PsCBL changed significantly when Ca
2+
was
either added or depleted by the addition of EGTA
(Fig. 4L). No significant change in the spectra of the
AB
CD
E
F
H
IJ
L
K
G
Fig. 4. Purification of PsCIPK and PsCBL proteins and their activities. (A) Induction and purification of overexpressed PsCIPK in E. coli is
shown on SDS ⁄ PAGE. Lane M, Molecular weight marker; lane 1, uninduced; lane 2, IPTG induced; lane 3, PsCIPK protein after Ni
2+
–NTA–
agarose column chromatography. The protein size markers are indicated at the left side of the gel. (B) Western blot analysis of the same
protein fractions of lanes 1–3 as shown in panel (A) using polyclonal anti-PsCIPK antiserum. (C, D) Autophosphorylation of PsCIPK and phos-
phorylation of PsCBL by PsCIPK. PsCIPK protein in the presence of Mn
2+
(lane 1), Mg
2+
(lane 2), PsCBL plus Mn

2+
(lane 3), PsCBL plus
Mg
2+
(lane 4) and casein plus Mg
2+
(lane 5) incubated with [c-
32
P]ATP in kinase buffer, electrophoresed on SDS ⁄ PAGE and stained with
Coomassie blue (C) followed by autoradiography (D). (E) Phosphoamino acid analysis of PsCIPK autophosphorylation (lane 2) and PsCBL
phosphorylation by PsCIPK (lane 1). Positions of phosphoserine (P-Ser), phosphothreonine (P-Thr), and phosphotyrosine (P-Tyr) are marked at
right side of autoradiogram. (F) Immunodepletion of kinase activity of PsCIPK. PsCIPK protein was immunodepleted using anti-PsCIPK anti-
bodies. Lane 1, Phosphorylation of PsCBL by PsCIPK (control without any IgG); lane 2, PsCIPK pretreated with preimmune IgG; lane 3,
PsCIPK pretreated with anti-PsCIPK IgG. (G) Induction and purification of overexpressed PsCBL in E. coli is shown on SDS ⁄ PAGE. Lane M,
Molecular weight marker; lane 1, uninduced; lane 2, IPTG induced; lane 3, PsCBL protein after Ni
2+
–NTA–agarose column chromatography.
The protein size markers are indicated at the left side of the gel. (H) Western blot analysis of the same protein fractions of lanes 1–3 as
shown in panel (G) using polyclonal anti-PsCBL antiserum. (I, J, K)
45
Ca
2+
overlay assay showing that PsCBL is a functional Ca
2+
binding pro-
tein. (I) PsCBL along with the controls were run on 12% SDS ⁄ PAGE and stained with Coomassie blue. Lane 1, EhCaBP protein (positive
control); lanes 2 and 3, PsCBL (3 and 4 lg); lanes 4 and 5, GST and BSA (negative controls). Lane M, Pre-stained marker. (J) The same sam-
ples (as in panel I) transferred to nitrocellulose membrane and assayed by
45
Ca

2+
binding. Only PsCBL (lane 2 and 3) and the positive control
(lane 1) showed Ca
2+
-binding capability. (K) Dot blot analysis of the same protein samples (as in panel I) followed by
45
Ca
2+
overlay assay to
confirm the
45
Ca
2+
binding data. Spots 1 and 2, PsCBL proteins (3 and 4 lg); lanes 3 and 4, negative controls; lane 5, positive control. (L)
CD spectra of PsCBL, calcium-bound PsCBL and the calcium-bound PsCBL treated with 1.25 m
M EGTA.
Stress-induced CIPK from pea phosphorylate CBL S. Mahajan et al.
912 FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS
protein was observed by the addition or depletion of
Mg
2+
(data not shown). These results suggest that
PsCBL changes its conformation in a Ca
2+
-depend-
ent manner.
PsCIPK phosphorylates PsCBL at Thr residue(s)
To determine whether PsCIPK is a functional protein
kinase, the autophosphorylation and substrate phos-
phorylation activities of the enzyme were checked by

incubating the enzyme with [c-
32
P]ATP in the absence
or presence of the substrates. After incubation, the
phosphorylation of the proteins was examined by
SDS ⁄ PAGE (Fig. 4C) followed by autoradiography
(Fig. 4D). The result shows that PsCIPK autophos-
phorylated (58 kDa) in the presence of Mn
2+
(Fig. 4D, lane 1) as well as Mg
2+
(Fig. 4D, lane 2).
The sequence analysis of PsCBL revealed that it has
putative phosphorylation sites (Fig. 1B). We therefore
tested whether PsCBL is a substrate for the PsCIPK
enzyme. The result shows that PsCBL is phosphorylat-
ed strongly by PsCIPK in the presence of the divalent
cations Mn
2+
and Mg
2+
(Fig. 4D lanes 3 and 4,
respectively). We have shown that PsCIPK also phos-
phorylates casein in the presence of Mg
2+
(Fig. 4D,
lane 5). CBL has no effect on the autophosphorylation
of CIPK (Fig. 4D, lane 3 and 4). PsCIPK phosphoryl-
ated PsCBL even in the absence of exogenous Ca
2+

in
the reaction buffer (data not shown). This data is sim-
ilar to that reported earlier for AtCIPK1, where no
effect was noted on substrate phosphorylation (MBP
and casein) in the presence or absence of any exogen-
ously supplied Ca
2+
in the reaction buffer [10].
For phosphoamino acid analysis, the radioactive
autophosphorylated 58-kDa band of PsCIPK and the
26-kDa band of PsCBL from the above gel were
excised, acid hydrolysed and subjected to paper chro-
matography. The results show that PsCIPK phos-
phorylates PsCBL at Thr residue(s) (Fig. 4E, lane 1)
and also becomes autophosphorylated at its Thr resi-
due(s) (Fig. 4E, lane 2). PsCBL did not show any
autophosphorylation, as without any kinase there was
no phosphorylation of CBL (data not shown).
To confirm the phosphorylation activity of
PsCIPK, an immunodepletion experiment was per-
formed as follows. Purified PsCIPK was reacted sepa-
rately with IgG purified from the sera of preimmune
rabbit and a rabbit immunized with PsCIPK. The
antigen–antibody complex was removed by protein A-
Sepharose. The supernatant was analysed for PsCIPK
activity to phosphorylate PsCBL. Results revealed
that immunodepletion of PsCIPK in the extract
decreased the phosphorylation of PsCBL significantly
(Fig. 4F, lane 3),whereas there was no reduction of
PsCIPK activity to phosphorylate PsCBL in the sam-

ple treated with preimmune IgG (Fig. 4F, lane 2).
Lane 1 is the control reaction without the addition of
IgG.
Regulation of transcript levels of PsCIPK and
PsCBL in response to stress
To analyse PsCIPK and PsCBL expression under
various abiotic and biotic stresses, 7-day-old pea
seedlings were stressed for different times. The control
plants were grown without any stress treatment. Total
RNAs were extracted from control and treated shoot
tissues and hybridized with PsCIPK (1.2-Kb fragment
from the 3¢ end containing the 3¢ UTR) and PsCBL
(0.97 Kb, full-length) cDNA probes. As shown in
Fig. 5, the transcript levels of both PsCIPK (panels A,
C, E, G, I, K, and N) and PsCBL (panels B, D, F, H,
J, L, and O) are coordinately regulated following a
similar trend. Following low temperature treatment
the transcripts of both genes started increasing from
9 h, reaching a maximum at 12–24 h (Fig. 5A and B).
After NaCl treatment the levels increased after 12 h
and were maintained high at least until 24 h (Fig. 5C
and D). In response to wounding stress, both the
genes showed an early induction at 3 h; however, the
levels decreased by 6 h (Fig. 5E and F). The transcript
levels in salicylic acid (SA) stress were increased after
8 h of treatment and then decreased at 12 h (Fig. 5I
and J). Interestingly, the transcript levels of both the
genes did not alter in response to dehydration stress
(Fig. 5G and H) and after the exogenous application
of ABA hormone (Fig. 5K and L). As a positive con-

trol, an ABA responsive gene PDH45 (see Fig. 5 leg-
ends). was used. The transcript level of PDH45
strongly increased from 12 to 24 h under similar
experimental conditions (Fig. 5M).
Calcium upregulates PsCIPK and PsCBL in a
dose-dependent manner
As PsCIPK and PsCBL are strongly upregulated in
response to various abiotic and biotic stresses and as the
signalling pathway for these stresses are often mediated
by Ca
2+
, the effect of exogenous Ca
2+
was analysed on
the transcript levels of both the genes. As shown in
Fig. 5N the transcript level of PsCIPK was upregulated
in response to Ca
2+
, reaching a maximum at 10 mm
and declined at higher Ca
2+
concentrations (Fig. 5N).
The transcript level of PsCBL was strongly upregulated
by Ca
2+
. The level started increasing at 5 mm of exo-
genously supplied Ca
2+
and the maximum level was
S. Mahajan et al. Stress-induced CIPK from pea phosphorylate CBL

FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS 913
observed at 50 mm and remained constant thereafter
(Fig. 5O). To exclude the possibility of this upregulation
being mediated via any divalent cation, the effect of
Mg
2+
was also tested. Plants treated with 50 mm Mg
2+
for 24 h did not show any upregulation of transcripts
of either of the genes (Fig. 5N and O, second lane).
PsCBL
B
D
F
H
J
L
O
18 S
1.0
kb
18 S
1.0
kb
18 S
1.0
kb
18 S
1.0
kb

18 S
1.0
kb
18 S
1.0
kb
18 S
1.0
kb
PsCIPK
A
C
E
G
I
K
N
18 S
1.8
kb
18 S
1.8
kb
18 S
1.8
kb
18 S
1.8
kb
18 S

1.8
kb
18 S
1.8
kb
18 S
1.8
kb
CaCl
2
SALICYLIC ACID
(150 µ
M)
COLD
(4
0
C)
SALINITY
(150 m
M
NaCl )
WOUNDING
DEHYDRATION
ABSICIC ACID
(100 µ
M)
M
M M
Fig. 5. Expression pattern of PsCIPK and PsCBL genes in response to various abiotic and biotic stresses. The total RNAs were extracted from
leaf tissue after the stress treatment. The various abiotic stresses used for treatment of pea seedlings were cold (A and B), salinity (C and D),

wounding (E and F), drought (G and H), SA (I and J), ABA (K and L) and calcium (N and O). Panel M is the control for ABA responsive gene,
PDH45 [35]. The RNAs (50 lg) samples were separated by electrophoresis, blotted and hybridized with the [a-
32
P]dCTP-labelled PsCIPK (1.2-Kb
fragment from 3¢ end containing the 3¢ UTR) (panels A, C, E, G, I, K and N), and [a-
32
P]dCTP-labelled PsCBL cDNA (0.97 Kb, full-length) probes
(panels B, D, F, H, J, L, and O). For each stress examined the upper panel shows the autoradiograph of transcript (1.8 Kb for PsCIPK and 1 Kb
for PsCBL), while the lower panel shows the hybridization of same blot with 18S rRNA gene (loading control). In each panel, lane 1 is the control
(C) without any treatment while other lanes are the RNAs samples collected after stress treatments at the indicated time points.
Stress-induced CIPK from pea phosphorylate CBL S. Mahajan et al.
914 FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS
In vitro interaction of PsCBL with PsCIPK protein
by far-western blotting
As the two genes (PsCBL and PsCIPK) showed a sim-
ilar and synchronized transcript profile, we speculated
that these may interact with each other. We studied
the interaction of PsCBL with PsCIPK by the far-
western method (see Experimental procedures). Briefly,
the two proteins and controls were separated by
SDS ⁄ PAGE, transferred to nylon membrane and then
renatured on the membrane. Next they were incubated
with the second protein PsCBL in the presence or
absence of CaCl
2
(1 mm), followed by western blotting
with anti-CBL IgG. The results of far-western blotting
showed that PsCBL binds to PsCIPK, which was
recognized by anti-CBL IgG (Fig. 6B, lanes 1 and 2).
This binding is calcium dependent as no signal was

observed when the experiment was performed in the
absence of calcium (data not shown). As a negative
control, 47-kDa pea helicase (lane 3) and 80-kDa pea
MCM7 protein (lane 4) were used; these produced no
signal. Figure 6A, shows a Ponceau-S stained mem-
brane in which lane 1 contains prephosphorylated
CIPK which suggests that CBL can interact with both
phosphorylated and nonphosphorylated forms of
CIPK. To further confirm binding, the same experi-
(-Leu,- Trp).
(-Leu,-Trp,-His +
15 mM 3AT.)
YPD MEDIA
β galactosidase
assa
y
.
Pea CBL
in pGBKT7
1.6
Pea CIPK
in pGADT7
A
C
B
D
EFG
HI
JK
58

47
26
80
58
47
26
80
kDa
kDa
Ponseu-S Immuno blot
Ponseu-S Immuno blot
0.5
1.0
1
2
3
4
5
6
1.6
1.0
2.0
3.0
2.0
kb kb
Fig. 6. Direct interaction of PsCBL and PsCIPK proteins, in vitro,as
well as via a yeast two-hybrid system. (A, B) PsCBL interacts with
PsCIPK in vitro. PsCIPK prephosphorylated (2 lg, lane 1), PsCIPK
(2 lg, lane 2), pea helicase (PDH47) [36] (6 lg, lane 3, negative
control), pea MCM7 (3 lg, lane 4, negative control) and PsCBL

(5 lg, lane 5) were run on SDS ⁄ PAGE, transferred to PVDF mem-
branes, stained with Ponceau-S (A). The proteins on the same blot
were denatured ⁄ renatured, blocked with BSA, incubated with
1 lgÆmL
)1
CBL protein followed by standard western using anti-
PsCBL antibodies (B). (C, D) PsCIPK interacts with PsCBL in vitro.
The same set of proteins as (A) were stained with Ponceau-S (C)
treated as above until the BSA blocking step, and then incubated
with 1 lgÆmL
)1
of PsCIPK protein and detected with anti-PsCIPK
antibodies (D). (E–K) PsCIPK interacts with PsCBL in a yeast two-
hybrid system. (E) The ORF of PsCBL was cloned in pGBKT7 and
checked by restriction (NcoI and EcoRI) to show the insert size of
0.67 Kb (lane 2), lane 1 is the DNA marker. (F) The ORF of PsCIPK
was cloned in pGADT7 vector and checked by restriction (EcoRI
and XhoI) to give the insert size of 1.55 Kb (lane 2), lane 1 is DNA
marker. (G) Template for panels H–K. (H) Phenotype on YPD plate
showing uninhibited growth of all the above. (I) Phenotype on syn-
thetic dextrose lacking Leucine and Trytophan (SD –Leu–Trp) plate;
this is selection medium for double transformants. (J) Phenotype
on synthetic dextrose lacking Leucine, Trytophan, and Histidine
containing 15 m
M 3-AT (SD–Leu–Trp–His+3AT) plate; here growth
represent the interaction of PsCBL with PsCIPK. (K) b-galactosidase
filter assay further confirms the interaction. The blue colour repre-
sents interaction of both the proteins (PsCBL-CIPK) resulting in the
expression of b-galactosidase reporter gene.
S. Mahajan et al. Stress-induced CIPK from pea phosphorylate CBL

FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS 915
ment was performed by incubating the same proteins
on the membrane with the PsCIPK followed by West-
ern blotting with anti-CIPK antibodies (Fig. 6C and
D). The results show that PsCIPK can also bind to
PsCBL (Fig. 6D, lane 5). PsCIPK did not bind to the
negative controls (Fig. 6D). Figure 6C is a Ponceau-S
stained membrane.
Interaction of PsCBL with PsCIPK via yeast
two-hybrid system
The complete ORF of PsCBL (678 bp) was cloned into
the NcoI and EcoRI sites of yeast two-hybrid binding
domain vector (pGBKT7). The resulting construct
(pGBKT7-PsCBL or BD-CBL) was verified by sequen-
cing and digestion with NcoI and EcoRI to give a band
of 678 bp (Fig. 6E, lane 2). On the other hand the com-
plete ORF of PsCIPK (1.5 Kb) was cloned into the
EcoRI and XhoI sites of yeast two-hybrid activating
domain vector (pGADT7). The resulting construct
(pGADT7-PsCIPK or AD-CIPK) was verified by
sequencing and digestion with EcoRI and XhoI to give
a band of 1.5 Kb on gel electrophoresis (Fig. 6F, lane
2). The Saccharomyces cervisiae AH109 cells were co-
transformed with both the constructs (BD-PsCBL plus
AD-PsCIPK) as well as with several combinations of
plasmids which served as controls for this experiment.
Interactions between PsCBL and PsCIPK were deter-
mined by growth of the cotransformants on the selec-
tion media of synthetic dextrose (SD) lacking Leu, Trp,
and His (SD-Leu

–
Trp
–
His
–
and containing 15 mm
3-aminotrizole, 3-AT). 3-AT is a competitive inhibitor
of histidine and checks any leaky expression of histi-
dine. Yeast cells could survive due to the activation of
the nutritional marker gene HIS3. Activation of the sec-
ond reporter gene (lacZ), was monitored by measuring
b-galactosidase activity.
The results are shown in Fig. 6G–K. Figure 6G is a
template for panels H to K showing the clones
streaked: clone 1, Yeast (AH109) cells containing co-
transformants of BD-PsCBL plus AD-PsCIPK; clone
2, cotransformants of BD-PsCBL and AD vector
alone; clone 3, AD-PsCIPK and BD vector alone;
clone 4, cotransformants of empty AD and BD vec-
tors; clone 5, cotransformants of Pea Gb and Gc
served as a positive control (unpublished data); clone
6, yeast AH109 cells alone. All these transformants
and AH109 cells grew on the yeast extract–peptone–
dextrose (YPD) plate (nonselective medium) (Fig. 6H).
Except AH109 cells, all of the cotransformants con-
taining AD and BD vectors showed growth on SD-
Leu
–
Trp
–

medium (Fig. 6I). In a selection medium
lacking Leu, Trp and His (SD-Leu
–
Trp
–
His
–
+15mm
3-AT) only selected clones of cotransformants (BD-
PsCBL plus AD-PsCIPK) and the positive control, in
which the HIS3 gene was transactivated grew (Fig. 6J).
This confirmed the interaction of PsCBL and PsCIPK
proteins. The results from b-galactosidase filter assay
of colonies of cotransformants (BD-PsCBL plus AD-
PsCIPK) further confirmed the interaction between
PsCBL and PsCIPK (Fig. 6K, blue colonies). Domain
swapping was also performed in which PsCBL was
cloned in pGADT7 and PsCIPK was cloned in
pGBKT7 and similar interaction results were obtained
(data not shown). The results show that PsCIPK inter-
acts with PsCBL in a yeast two-hybrid system. A
PsCIPK mutant with a deletion in the autoinhibitory
(NAF) motif failed to interact with PsCBL thus con-
firming the authenticity of these proteins and emphasi-
zing the importance NAF in the interaction between
them (data not shown).
Localization by immunofluorescence labelling
and confocal microscopy
Localization of PsCIPK and PsCBL was analysed by
immunofluorescence labelling of tobacco BY2 cells fol-

lowed by confocal microscopy. Cell cultures were
found to better for these studies than a whole-plant
system. Immunofluorescence labelling of tobacco BY2
cells with anti-PsCIPK (Fig. 7B) and anti-PsCBL
(Fig. 7J) antibodies showed the localization of both
proteins in the cytosol of all cells. In addition, PsCIPK
protein was also localized in the outer membrane
(Fig. 7B). A single enlarged cell showing PsCIPK
localization is shown in Fig. 7E, whereas Fig. 7M is
the single enlarged cell showing PsCBL localization.
Figure 7A, D, I and L are diamidino-2phenylindole
hydrochloride (DAPI) stained cells showing the nuc-
leus, and Fig. 7C, F, K and N are the merged images
of A and B, D and E, I and J, and L and M, respect-
ively.
Discussion
Nature has developed many pathways for combating
and tolerating the the various stress signals that cross-
talk with each other. The CBL ⁄ CIPK pathway is one
of these; it emerged as a novel pathway for deciphering
calcium signatures and initiating a series of phosphory-
lation cascades. This ultimately results in the expres-
sion and regulation of stress genes mediating plant
adaptation in response to array of stresses. The exist-
ence of a large family of CIPK and CBL genes has
been reported in Arabidopsis and rice [15]. However,
the details of the role of these proteins and the inter-
Stress-induced CIPK from pea phosphorylate CBL S. Mahajan et al.
916 FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS
actions between different members of these families are

not clear. Moreover, the existence, interaction, and
role of CBL ⁄ CIPK members in other plants has not
been well studied and characterized. Because these
genes are among the master switches controlling the
major genes in the signalling pathway, much more
effort should be invested in analysing the role of these
genes in higher plants. Here, we report the isolation
and characterization of a novel CIPK from a legume,
Pisum sativum (pea) and show that it interacts and
phosphorylates a CBL having homology to AtCBL3.
Both PsCIPK and PsCBL genes showed delayed tran-
scriptional upregulation in response to stresses. This
kinase showed dual localization in the cytosol and in
the plasma membrane.
Characterization of PsCIPK and its interacting
PsCBL
Sequence analysis of PsCIPK showed that it has low
similarity (67%) to AtCIPK12, which also has not
been well characterized. Regarding PsCBL, the amino
acid sequence alignments revealed that PsCBL is more
similar to rice CBL (92%) and AtCBL3 (90%). All 10
AtCBL genes are reported to contain introns and only
eight of 25 AtCIPK genes contain multiple intron
sequences [15]. Like AtCBL3, PsCBL also contains
two introns in the 5¢ UTR region [15]. The regulatory
function of such an unusual composition of introns
needs to be experimentally verified. In rice also all of
the 10 OsCBLs genes contain introns, while eight of 30
DEF
ABC

IJK
LMN
Fig. 7. Subcellular localization of PsCIPK and
PsCBL in tobacco BY2 cells by immunofluo-
rescence labelling and confocal microscopy.
The BY2 cells were fixed, permeabilized and
treated with primary antibodies against
PsCIPK (A–F) and PsCBL (I–N) followed by
Alexafluor488-labelled secondary antibodies
and then counterstained with DAPI. Multiple
cells are shown in panel A–C for PsCIPK
and I–K for PsCBL. Confocal image of single
enlarged cell is also shown in panel D–F for
PsCIPK and panel L–N for PsCBL. (A, D, I
and L) Images of cells stained with DAPI
(blue). (B, E, J and M) Alexafluor488-labelled
immunostained cells showing florescence
(green). Anti-PsCIPK labelling is seen in the
cytosol as well as plasma membrane (B and
E), while Anti-PsCBL labelling is restricted to
cytosol (J and M). (C and F) Superimposed
images of A, B, and D, E, respectively.
Similarly, K and N are the superimposed
images of I, J and L, M, respectively.
S. Mahajan et al. Stress-induced CIPK from pea phosphorylate CBL
FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS 917
OsCIPKs genes contain introns [15]. The PsCIPK gene
is an intron-less representative of the CIPK gene fam-
ily. By computer prediction and sequence alignment
we found that PsCBL has four EF hand motifs

required for calcium binding. Using a
45
Ca
2+
overlay
assay and the CD spectra analysis, PsCBL was found
to be a functional calcium binding protein. The CD
spectrum data also shows that PsCBL changes its con-
formation in a Ca
2+
-dependent manner, and thereby
functions as a molecular switch through the EF hands,
as also reported for AtCBL2 [23].
PsCIPK directly interacts with PsCBL and shows
dual localization
Previous studies have shown that CBL interacts with
CIPKs and some specificity is maintained in this
interaction [13]. AtCBL1 has been shown to interact
in vivo with only six AtCIPK members (1, 7, 8, 17,
18 and 24) while AtCBL9 interacts with AtCIPK1,
8, 18, 20, 23 and 24 [15]. In another study AtCBL1
has been shown to interact with AtCIPK15 [18].
AtCBL 2 and 3 seem to interact with AtCIPK 4, 7,
12 and 13 [13]. In the present study we found that
PsCBL has significant homology (90%) to AtCBL3,
while PsCIPK has lower homology (67%) with
AtCIPK12 and 24. However, both PsCIPK and
PsCBL interacted with each other. This interaction
in vitro is calcium dependent.
Some structural features of CBLs are known to be

responsible for their cellular localization. For exam-
ple, the CBLs that contain myristoylation site at
their N terminus (e.g. AtCBL1, 4, 5, and 9, and
OsCBL1, 4, 5, 7, and 8) are expected to localize to
cell membranes [8,11,13,15]. AtSOS5 has been repor-
ted to localize in the plasma membrane [24]. How-
ever, PsCBL does not contain a myristoylation site
suggesting its role in membrane-independent Ca
2+
-
signalling pathways. The absence of myristoylation
site in the PsCBL and in some other CBLs might be
due to the loss of this lipid modification site during
evolution of the CBL genes. Our studies do indicate
that PsCBL is localized in the cytosol, whereas
PsCIPK is present in the cytosol and also localized
in the outer membranes. These studies, however,
need further confirmation as the present experiments
were performed with tobacco cells. Whether pea anti-
bodies recognize identical isoforms of CBL and
CIPK in tobacco need to be assessed in future stud-
ies. Nevertheless it seems that PsCBL antibody
recognizes a nonmyristoylated form of tobacco CBL
and hence shows presence in cytosol only.
SOS2 ⁄ AtCIPK24 is known to phosphorylate and
activate SOS1 (Na
+
-H
+
-antiporter), which is locali-

zed in the plasma membrane [22]. Whether PsCIPK
phosphorylates SOS1-like protein needs to be stud-
ied. PsCIPK may interact with a myristoylated mem-
ber of CBL, which recruits it to the plasma
membrane.
Phosphorylation of PsCBL by PsCIPK
Similar to all the CIPKs, the PsCIPK also contain an
activation loop and an autoinhibitory NAF motif,
which is known to regulate its kinase activity. We
found that PsCIPK becomes autophosphorylated at its
Thr residue. The in silico analysis of the CBL primary
sequence revealed that it has potential phosphorylation
sites. This prompted us to check if CBL could be
phosphorylated by its interacting kinase, PsCIPK. The
different substrates, which are phosphorylated by CIP-
Ks, are not well characterized. It was shown earlier
that SOS2 ⁄ CIPK24 phosphorylates and activates SOS1
[22]. In this study we show that CBL is a phosphopro-
tein and is used as a substrate for phosphorylation by
PsCIPK at Thr residue(s). The extent of phosphoryla-
tion was found to be similar in the presence of Mg
2+
and Mn
2+
. Earlier, Mn
2+
was shown to be the pre-
ferred ion for AtCIPK1, which, unlike PsCIPK, phos-
phorylates at both Ser and Thr residues [10]. This
shows that PsCIPK is different from AtCIPK1. This is

the first indication showing the phosphorylation of a
CBL by its interacting kinase. An understanding of the
functional significance of this observation and the
exact Thr residue that is phosphorylated needs further
study.
Our studies also suggest that the phosphorylation of
CIPK may not affect the interaction with CBL as
PsCBL showed interaction with both phosphorylated
as well as nonphosphorylated forms of CIPK. It is
possible that these interphosphorylation and trans-
phosphorylation events could provide a means for
cross-talk in various signalling pathways involving cal-
cium in response to different environmental signals.
Regulation of PsCIPK and PsCBL at the transcript
level is a delayed response
As the role of various CIPKs and CBLs is being inves-
tigated in mediating different signalling pathways and
in identifying the downstream events, one of the ques-
tions being studied is how this family of genes are
themselves regulated. Our data show that both
PsCIPK and PsCBL showed expression in all of the
tissues examined. Earlier AtCBL3 was shown to have
ubiquitous presence [8]. In this respect PsCBL shows
Stress-induced CIPK from pea phosphorylate CBL S. Mahajan et al.
918 FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS
an expression pattern similar to that of AtCBL3. There
are reports on the effect of various abiotic factors in
regulating the expression of CIPKs and CBLs at the
transcript level [8,15]. Although there is high identity
between AtCBLs, different members behave differently

in response to various stresses. For example AtCBL1
gene expression was reported to be induced by cold,
salt, wounding, and drought, whereas AtCBL9 expres-
sion did not respond to these stimuli [8,15]. All of
these studies provide evidence that different AtCBL
members perform different functions under various
stress conditions.
Previously, it was shown that two of the AtCBLs,
AtCBL2 and 3, show constitutive expression in
response to abiotic stresses [8]. Although PsCBL is a
homologue of AtCBL3, we found that its expression
was upregulated strongly in response to cold, salinity
and wounding. The difference in the two studies
seems to be due to the fact that the authors investi-
gated the transcripts only at the earlier time points
(until 6 h in cold, and 2 h in wounding). As seen in
the present study, the upregulation of PsCBL tran-
script starts from 9 h in cold and 12 h in salt, reach
a maximum by 15 h and are then maintained till
24 h. This suggests that PsCBL may play a major
role in the maintenance of the stress response. Whe-
ther AtCBL3 also gets upregulated in the later time
points needs to be experimentally verified. The delay
in upregulation of transcript level in response to var-
ious stress conditions could be due to some of the
effects initiated following physiological changes in
growth and metabolism. Alternatively the basal tran-
script level and protein may be involved in signalling
in response to stress. However, for sustained
response an increase in the transcript and protein

level may be required at a later time point. Also,
transgenic plants over-expressing PsCBL and PsCIPK
genes showed increased tolerance to salinity stress
(our un published data).
The transcript levels of PsCIPK were also upregulated
in response to cold, salinity and wounding stress in
coordination with the CBL transcript profile. The tran-
script level of both the PsCBL and CIPK genes did not
alter in response to ABA and dehydration stress. This
shows that the induction of this pair of CBL ⁄ CIPK in
response to stress does not follow an ABA-dependent
pathway.
In comparison to induction by cold and salinity,
wounding ) a biotic stress ) caused faster induction
of both genes. This was also found in the case of
AtCBL1 [8]. Although SA, which is known to play a
critical role in signalling the activation of plant
defence responses after pathogen attack [25], induced
the expression of both PsCBL and PsCIPK genes,
the kinetics of induction by SA followed a trend
seen in response to abiotic stresses rather than the
biotic stress (wounding). There are few reports in
which SA is shown to upregulate the genes in
response to abiotic stresses [26,27]. This suggests that
the signalling pathways may be shared between abi-
otic and biotic stresses. However, the interrelation-
ship between abiotic and biotic signalling pathways
is currently unclear.
In addition to SA, it was found that the exogenous
application of calcium was also stimulatory for the

expression of PsCBL and PsCIPK. In the case of
PsCBL and PsCIPK, even though maximum increase
in the transcript level was obtained at 50 and 10 mm
CaCl
2
, respectively, the stimulatory effects were seen at
a much lower concentration of 5 mm CaCl
2.
. Similar
treatments to exogenous CaCl
2
have been reported
[28]. As these treatments were applied whole plants
and not to isolated protoplasts ⁄ cells the actual uptake
of CaCl
2
by the plant may be much lower. This effect
seems to be specific for Ca
2+
, as the addition of Mg
2+
had no effect. Whether calcium exerts its effect directly
as a signal transduction molecule or if it alters cell wall
and membrane properties which in turn bring about
these effects needs to be further investigated. Earlier,
rice CIPK was shown to be upregulated in response to
multiple signals and also in response to calcium [29].
Thus, calcium seems to affect the regulation of the
CBL ⁄ CIPK pathway by binding to calcium sensor
CBL, and also upregulates the expression of genes

encoding these proteins.
The novel aspects of this work are highlighted
below. This is the first report on the characterization
of CBL ⁄ CIPK proteins from a legume. Although
PsCBL shares 90% identity with AtCBL3, in contrast
to AtCBL3 it is upregulated strongly under cold, salin-
ity, wounding, SA and calcium treatments. The up-
regulation of gene expression of both PsCBL and
PsCIPK in response to various abiotic stresses seems
to be a relatively late response and may play an essen-
tial role in the maintenance of stress responses in legu-
minous plants such as pea. Moreover, PsCIPK shows
a maximum identity of 67% with AtCIPK12, which
lacks any significant characterization. A unique prop-
erty of PsCIPK is that it can phosphorylate PsCBL
strongly in the presence of Mg
2+
as well as Mn
2+
.
This is the first report suggesting that PsCBL is a
phosphoprotein and a substrate for PsCIPK. This
study indicates that PsCBL is localized exclusively in
the cytosol, whereas, PsCIPK shows dual localization
in both cytosol and plasma membrane. Although sev-
eral CBLs and CIPKs coexist in a plant cell, all CBLs
S. Mahajan et al. Stress-induced CIPK from pea phosphorylate CBL
FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS 919
do not interact with every CIPK and specificity is
maintained in the signalling pathway. Preferential com-

plex formation is one of the mechanisms for generating
response specificity in the plant cells. In the present
study the coordinated transcript data and the in vivo
and in vitro interaction data both provide corroborat-
ive evidence that these two genes function in a similar
pathway. These studies suggest that the CBL ⁄ CIPK
signalling pathway in pea functions in responses to
both abiotic and biotic stresses via an ABA-independ-
ent pathway and should make an important contribu-
tion to our understanding of the role of CBL ⁄ CIPK in
calcium and stress signalling in higher plants.
Experimental procedures
Plant growth and treatment
Pea (Pisum sativum) seeds were surface-sterilized in a solu-
tion of Clorox plus 0.05% Triton X-100 for 10 min, washed
with sterilized water three times and imbibed in sterilized
water for at least 4 h. These presoaked seeds were germina-
ted in the sterilized wet vermiculite (for cDNA library pre-
paration) or on wet germination paper (for treatment)
under a 14 ⁄ 10-h light ⁄ dark cycle at 25 °C for 7 days. For
treatment under different stress conditions, 7-day old pea
seedlings grown on wet germination paper were used. For
cold treatment, the seedlings were transferred to the 4 °C
cold chamber under white light. The control plants were
kept at 25 °C in growth chamber under constant light. For
salt treatment, the seedlings were further grown in 150 mm
NaCl solution by dipping the roots only for the requisite
time periods. Wounding was performed by puncturing
leaves with a hemostat as described by Kudla et al. [8].
Typically, at least 80% of the leaves in the treated set were

wounded. After wounding the seedlings were further grown
in water for required time points. For drought treatment,
the seedlings were carefully removed and dehydrated on the
filter paper as described by Yamaguchi-Shinozaki and Shi-
nozaki [30]. For ABA or SA treatments, 100 lm ABA or
150 lm SA was sprayed on the seedlings leaves and the
seedlings were also transferred to the same solution (ABA
or SA) by dipping the roots. For calcium and magnesium
treatments, the seedlings were grown on CaCl
2
or MgCl
2
solution by dipping the roots only for 24 h. Seedlings
grown in water for the same period of time were taken as a
control. After all the treatments, the seedling were frozen in
liquid nitrogen and processed for RNA isolation to analyse
the expression of PsCBL and PsCIPK transcripts.
Construction of P. sativum cDNA library
A cDNA library was constructed from 5 l g of poly(A)
+
RNA (isolated from top four leaves of 7-day-grown pea
seedlings) in Uni-Zap XR vector using Zap-cDNA syn-
thesis kit (Stratagene, La Jolla, CA) following the manu-
facturer’s protocol. The resulting phage library contained
1 · 10
9
plaque forming unitsÆml
)1
. During library con-
struction, some double-stranded cDNAs were also syn-

thesized from salt-stressed pea seedlings (150 mm
NaCl · 24 h) for use as a template for PCR cloning of
partial cDNAs of CBL and CIPK in the following step.
Isolation of PsCIPK and PsCBL cDNA clones and
their sequence analysis
Basically, both CIPK and CBL cDNAs were first partially
cloned by PCR and then followed by isolation of full-length
clones by library screening. For partial cloning of pea CIPK
(PsCIPK) or pea CBL (PsCBL), all the known sequences of
AtCIPK or AtCBL genes were first aligned and degenerate
primers were designed from the most conserved areas. For
PsCIPK, primer pair, Oligo-1 (forward) and Oligo-2 (reverse)
(Table 1) were used for PCR. For CBL, primer pair, Oligo-3
(forward) and Oligo-4 (reverse) (Table 1) were used for PCR.
In PCR reactions, using respective primer pairs and salt-
stressed double-stranded cDNAs as a template, partial frag-
ments of 550 bp for PsCIPK and 335 bp for PsCBL were
amplified. For cloning the full-length cDNAs of PsCIPK
and PsCBL, these partial fragments of CIPK (550 bp) and
CBL (335 bp) were radiolabelled and used as probes to
screen the pea cDNA library.
Sequencing of cDNAs was performed using the dideoxy
chain termination method by using sequenase version 2 kit
(US Biochemicals, Cleveland, OH). Most of the routine
sequence (DNA and amino acid) analysis was performed
using macvector (v7; Oxford Molecular Group). Homol-
ogy search was performed using fasta and multiple
sequence alignment was done using clustal w alignment
programs.
Isolation of PsCIPK and PsCBL genomic clones

Two gene-specific primers (designed from 5¢ UTR and 3¢
UTR of PsCIPK and PsCBL cDNA sequences, respect-
ively) were used to PCR amplify the genomic fragments
using pea genomic DNA as template. As a control, the
ds-cDNA was also used as a template with the same set of
primer pairs. The primer pairs used were: for PsCIPK,
Oligo-5 (forward) and Oligo-6 (reverse); for PsCBL, Oligo-
7 (forward) and Oligo-8 (reverse) (Table 1). PCR was car-
ried out using 150 ng of the gene’s UTR specific primers
along with 200 lm of each dNTPs and 2.5 U Taq DNA
polymerase with 300 ng genomic DNA as a template (or
40 ng of ds-cDNAs as control) in a 50-lL reaction. PCR
conditions were 94 °C, 1 min; 57 °C, 1 min; and 72 ° C,
3.5 min for 30 cycles. To confirm the specificity of the PCR
product, a second PCR (nested) was performed using the
Stress-induced CIPK from pea phosphorylate CBL S. Mahajan et al.
920 FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS
above PCR product as template and second pair of internal
gene-specific primers (designed from 5¢ ORF and 3¢ ORF
of the PsCIPK and PsCBL cDNAs). The second primer
pair used for PsCIPK was: Oligo-9 (forward) and Oligo-10
(reverse); for PsCBL were, Oligo-11 (forward) and Oligo-12
(reverse) (Table 1). These fragments were then cloned and
completely sequenced.
Northern and Southern analysis
For Northern analysis total RNA was extracted with Trizol
(Gibco-BRL, Grand Island, NY, USA) from different tis-
sues (root, shoot, tendril and flower) of pea seedlings, seed-
lings exposed to different abiotic stresses (cold, salinity,
wounding, drought, SA and ABA) for different lengths of

time. About 50 lg of total RNA was resolved by electro-
phoresis in a 1% agarose gel containing 5.5% formalde-
hyde, and trans-blotted onto Hybond N
+
membrane with
10 · NaCl ⁄ Cit as a transfer buffer.
For Southern analysis genomic DNA (30 lg) was extrac-
ted from pea leaves by standard cetyltrimethylammonium
bromide (CTAB) (Sigma, St Louis, MO, USA) method and
digested with an excess of restriction enzymes, electrophore-
sed on a 0.75% agarose gel, and transferred to a nylon
membrane (Hybond N
+
).
The RNA and genomic DNA blots were hybridized with
[a-
32
P]dCTP-labelled (nick translated) 1.2-Kb fragment of
PsCIPK cDNA (from the 3¢ end containing the 3¢ UTR)
and 0.97-Kb PsCBL cDNA (full-length) probes at 58 °Cin
5 · NaCl ⁄ Cit, 5 · Denhardt’s, 0.1% SDS, 100 lgÆmL
)1
denatured salmon sperm DNA for 16–18 h. After hybrid-
ization the blots were washed twice for 15 min at low strin-
gency (2 · NaCl ⁄ Cit + 0.1% SDS at 50 °C) and twice for
10 min at high stringency (0.1 · NaCl ⁄ Cit + 0.1% SDS at
55 °C) followed by autoradiography. The transcript levels
were estimated by scanning the autoradiograph using a
laser densitometer (Diversity 1, PDL, Version 6.1, New
York).

Construction of plasmids for expression of CIPK
and PsCBL proteins
The coding region of the PsCIPK (1.553 Kb) was amplified
by PCR with primers harbouring restriction sites, cloned in
frame into the EcoR1 and Xho1 sites of pET28a vector(+)
(Novagen, Madison, WI). [Note: In this case the expressed
PsCIPK protein will contain a His-tag in the N-terminal
region]. The primers for PsCIPK were: Oligo-13 (forward)
containing an EcoR1 site and Oligo-14 (reverse) containing
a Xho1 site (Table 1). This resulted in the construction of
plasmid pET28a-PsCIPK whose sequence was verified
before use for protein expression.
The coding region of the PsCBL (678 bp) was amplified
by PCR with primers harbouring restriction sites, cloned in
frame into the Nco1 and Xho1 sites of pET28a vector(+)
(Novagen). [Note: By using the Nco1 ⁄ Xho1 combination,
the 6 · His tag of the vector will be removed therefore; the
reverse primer was designed to incorporate 6 · His-tag
sequence at the 3¢ end of the gene. In this case the
expressed PsCBL protein will contain a His-tag at the
C-terminal region (this construct has the advantage that
only the fully expressed proteins can bind the Ni
2+
–NTA–
Table 1. Oligonucleotide used in this study.
Number Sequence Remarks
15¢-GG(A ⁄ T)CA(A ⁄ C)GG(A ⁄ T)AC(A ⁄ C)TT(C ⁄ T)GC(C ⁄ G ⁄ T)AAGGT-3¢ PsCIPK (degenerate forward)
25¢-ACAAA(A ⁄ C)A(A ⁄ G)(A ⁄ G ⁄ T)A(C ⁄ T)(A ⁄ C ⁄ G)ACACCACAAGACC)3¢ PsCIPK (degenerate reverse)
35¢-CTTAT(C ⁄ G)AACAAGGAA(A ⁄ C)AATTTC-3¢ PsCBL (degenerate forward)
45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse)

55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward)
65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ PsCIPK (3¢UTR reverse)
75¢-CGAGCTCACTGCCTCTCAAC-3¢ PsCBL (5¢UTR forward)
85¢-ACTCGTAGC-ACAGAGACAGAG-3¢ PsCBL (3¢UTR reverse)
95¢-ATGGCAGTAGTAGCAG-CTCC-3¢ PsCIPK (gene specific forward)
10 5¢-TCAGGTGTCT-AAGTTCAGAGATTC-3¢ PsCIPK (gene specific reverse)
11 5¢-ATGTTGCAGTGCTTAGAGGGA-3¢ PsCBL (gene specific forward)
12 5¢-TTAAGTATCATCTACTTGTGAATG-3¢ PsCBL (gene specific reverse)
13 5¢-CCTCCG
GAATTCATGGCAGTAGTAGCAGCTCC-3¢ PsCIPK [(gene specific forward
contains EcoR1 site (underlined)]
14 5¢-CCGCCG
CTCGAGTCAGGTGTCTAAGTTCAGAGATTC-3¢ PsCIPK [gene specific reverse
contains XhoI site (underlined)]
15 5¢-GCCATGC
CATGGCAATGTTGCAGTGCTTAGAGGGA-3¢ PsCBL [gene specific forward
contains NcoI site (underlined)]
16 5¢-GCCG
CTCGAGTCAGTGGTGGTGGTGGTGGTGAGTATCATCTACTTG
-TGAATGG-3¢
PsCBL [gene specific reverse
contains XhoI site (underlined) and
His-tag sequence (typed in bold)]
S. Mahajan et al. Stress-induced CIPK from pea phosphorylate CBL
FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS 921
agarose (Qiagen, GmbH, Hilden, Germany) column and
the truncated proteins cannot bind). The primers were:
Oligo-15 (forward) containing an Nco1 site and Oligo-16
(reverse) containing Xho1 site and His-tag sequence
(Table 1). This resulted in the construction of plasmid

pET28a-PsCBL whose sequence was verified before being
used for protein expression.
Expression and purification of CIPK and PsCBL
proteins
The plasmids pET28a-PsCIPK and pET28a-PsCBL were
transformed separately into E. coli BL21 (DE3) plysS cells
(Novagen). Fresh culture of the E. coli containing foreign
gene (pET28a-PsCIPK or pET28a-PsCBL) was grown in
Luria–Bertani medium containing 50 lgÆmL
)1
kanamycin
(until the A
600
reached 0.6), induced by IPTG (0.9 mm) and
harvested by centrifugation. All of the purification steps
were performed at 4 °C. The resulting pellet was resuspend-
ed in ice-cold TBS buffer, and lysed by the freeze–thaw
method according to Novagene’s instructions. The cell
lysate was centrifuged at 10 000 g for 10 min at 4 °C. As
the PsCIPK and PsCBL were found to be present in the
soluble fraction, the recombinant PsCIPK and PsCBL pro-
teins were purified to apparent homogeneity from the
resulting supernatant using Ni
2+
–NTA–agarose (Qiagen)
column chromatography following the manufacturer’s
instructions. The purification protocol routinely yielded 2–
3 mg of homogenous PsCIPK and 10–15 mg of homogen-
ous PsCBL from 1 L bacterial culture. The polyclonal anti-
bodies against PsCIPK and PsCBL proteins were raised in

rabbits and western blotting was performed using standard
protocols. The vertebrates (rabbits) in the experiments were
used as per approval of the animal ethics committee of the
Institute (ICGEB, New Delhi, India).
Protein kinase assay
Phosphorylation was measured as the incorporation of
radioactivity from c-
32
P-ATP into the PsCIPK (auto-
phosphorylation) or into the substrate proteins. The puri-
fied recombinant PsCIPK protein (0.5 lg) alone for
autophosphorylation or in the presence of the substrate
(PsCBL or casein) was incubated in the kinase buffer
[10 lCi-c
32
P-ATP, 20 mm Tris ⁄ HCl pH 8.0, either 5 mm
MgCl
2,
or MnCl
2,
1mm CaCl
2
, 0.1 mm EDTA, and 1 mm
dithiothreitol (DTT)] for 5 min at 30 °C. The reaction was
stopped by the addition of 4 · SDS sample buffer and ana-
lysed by SDS ⁄ PAGE (10%) and autoradiography. PsCIPK
was immunodepleted by addition of PsCIPK antibodies
(IgG) in a standard phosphorylation reaction containing
1mm CaCl
2

and 5 mm MgCl
2
as described [31]. PsCBL
phosphorylation by PsCIPK was also carried out in the
kinase buffer containing 5 mm MgCl
2
without addition of
any exogenous Ca
2+
.
Phospho-amino acid analysis
The phosphorylated 26-kDa band of PsCBL and the
58-kDa band of PsCIPK were separately eluted from the
gel and hydrolysed in 6 n HCl for 2 h at 100 °C. After
hydrolysis, the samples were concentrated in a Speed Vac
and analysed by paper chromatography on Whatman 3 mm
paper. Along with these samples the standard samples
(phosphoserine, phosphotyrosine and phosphothreonine)
were also run. The solvent used was propionic acid: 1 m
NH
4
OH and isopropanol in the ratio 45 : 17.5 : 17.5,
respectively. After chromatography the paper was stained
with ninhydrin spray followed by autoradiography.
Calcium overlay assay
The assay was carried out with both gel electrophoresis and
dot blot methods. For gel electrophoresis, the purified
recombinant PsCBL protein (3 and 4 lg) was run on
SDS ⁄ PAGE (12%) along with appropriate positive
(EhCaBP) [32] and negative (GST and BSA) controls fol-

lowed by electro-transfer of the proteins onto PVDF mem-
brane. The proteins on the membrane were denatured and
then gradually renatured by incubating in 6 m guani-
dine ⁄ HCl (made up in HSM buffer: 25 mm Hepes ⁄ KOH
pH 7.7, 25 mm NaCl, 5 mm MgCl
2
) for 2 · 5 min at 4 °C.
This was followed by incubation for 6 · 10 min in a serial
dilution (1 : 1) of denaturation buffer in HSM buffer 2
(containing 1 mm DTT) at 4 °C. The membrane was
blocked in HSM buffer containing 1 mm DTT, 0.5% NP-
40 and 3% BSA for 1 h at 4 °C, followed by washing the
membrane twice in the same solution containing 1% BSA.
For dot blotting, the purified recombinant PsCBL protein
(2 and 4 lg) along with appropriate controls was spotted
onto the PVDF membrane (in dot blot analysis the proteins
were already in a native condition and thus proceeded with-
out denaturation and renaturation steps). After transferring
or spotting, the membrane was equilibrated in the buffer
containing 10 mm Imidazole ⁄ HCl (pH 6.8), 60 mm KCl,
and 5 mm MgCl
2
for 3 h at room temperature. The radio-
active
45
Ca
2+
(1.97 lCiÆlL
)1
, Amersham, Boston, MA,

USA) was included to the above buffer (3 lLÆmL
)1
) and
the membrane was further incubated for 1 h at room tem-
perature. The membrane was washed with 67% ethanol, air
dried and exposed to X-ray film for 1 day.
CD spectroscopy
The CD spectra of PsCBL and Ca
2+
-bound PsCBL were
measured in a JASCO J-720 W spectrometer (JASCO,
Tokyo, Japan) using a 0.1-mm quartz cuvette in a stock
solution (5 mm Tris ⁄ HCl pH 7.5, 100 mm KCl, 1 mm
DTT and later by the addition of 1 mm CaCl
2
). Succes-
sively, the CD spectrum was also recorded after the addi-
tion of 1.25 mm EGTA. The spectrum of PsCBL was also
Stress-induced CIPK from pea phosphorylate CBL S. Mahajan et al.
922 FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS
recorded after the addition of 1 mm MgCl
2
and later by
the addition of 1.25 mm EDTA.
In vitro interaction of PsCBL with PsCIPK
PsCBL interaction with PsCIPK was studied by far western
method as described previously [33] in the presence or
absence of 1 mm CaCl
2
. Briefly, the proteins were resolved

on SDS ⁄ PAGE, transferred on nylon membrane, stained
with Ponceau-S. The proteins were renatured on the mem-
brane, incubated with second protein, and the interaction
was detected by western blotting using the antibodies
against the second protein [33].
Yeast two-hybrid assay
A Gal4-based two-hybrid system was used as described by
the manufacturer (Clonetech, Palo Alto, CA). The coding
region of PsCBL (678 bp) was amplified by PCR with
primers harbouring restriction sites, cloned in frame into
the Nco1 and EcoR1 sites of the DNA binding domain
vector (pGBKT7, Clonetech). For PCR amplification the
primers used were: Oligo-13 (forward) and Oligo-14
(reverse) (Table 1). This resulted in the construction of the
vector pGBKT7-PsCBL whose sequence was verified before
using for yeast transformation. The coding region of the
PsCIPK (1553 Kb) was amplified by PCR with primers
harbouring restriction sites, cloned in frame into the EcoR1
and Xho1 sites of the activation domain vector (pGADT7,
Clonetech). For PCR amplification the primers used were:
Oligo-15 and Oligo-16 (Table 1). This resulted in the con-
struction of the vector pGADT7-PsCIPK whose sequence
was verified before using for yeast transformation. Both the
above vectors were cotransformed into yeast strain AH109
harbouring two reporter genes (HIS3 and b-galactosidase)
by the lithium acetate method [34]. [Note: AH109 contains
integrated copies of ADE2, HIS3 and lacZ (MAL1) repor-
ter genes under the control of distinct GAL4 upstream acti-
vating sequences (UAS) and TATA boxes. These promoters
yield strong and very specific responses to GAL4]. Yeast

cells carrying both plasmids were selected on the synthetic
medium lacking Leu and Trp (SD-Leu
–
Trp
–
). The yeast
cells were then streaked onto the SD-Leu
–
Trp
–
His
–
plate
containing 15 mm 3-AT to determine the expression of
HIS3 nutritional reporter. The b-galactosidase expression
of the His
+
colonies was analysed by filter-lift assays as
described [11].
In vivo localization by immunofluorescence and
confocal microscopy
Exponentially growing tobacco BY2 suspension cells were
fixed in 4% formaldehyde and permeabilized by cellulase
and layered onto poly L-lysine-coated cover slips. The cells
were treated separately with PsCIPK- and PsCBL-specific
primary antibodies (raised in rabbit) or the rabbit’s preim-
mune serum (as a control) in 1 : 5000 dilution for 3 h, fol-
lowed by four washes of 5 min each with 1 · NaCl ⁄ P
i
. The

cells were then incubated with Alexa fluor 488-labelled goat
antirabbit secondary antibody (Molecular Probes, Eugene,
OR) in 1 : 3000 dilution for 3 h and then washed five times,
5 min each with 1 · NaCl ⁄ P
i
. The cells were counter-
stained with DAPI (0.2 lgÆmL
)1
) for 15 min just before
mounting the slide in Antifade solution (Fluroguard, Bio-
Rad, Hercules, CA, USA). Confocal laser scanning (Radi-
ance 2100, Bio-Rad) was performed under a Nikon micro-
scope (objective Plane Apo 60 ·X ⁄ 1.4 oil, Japan). The
excitation wavelength for Alexa fluorescence was 488 nm
(argon laser) and fluorescence detected through emission fil-
ter HQ515 ⁄ 30 (high-quality band pass), centred at 515 nm
with 30 nm bandwidth. DAPI fluorescence was excited by
blue diode (405 nm) and detected through emission filter
HQ442 ⁄ 45. Image processing was carried out with lazer-
sharp (Bio-Rad) and photoshop 5.5 (Adobe systems, San
Jose, CA) was used for final image assembly.
Acknowledgements
We sincerely thank Dr Renu Tuteja (ICGEB, New
Delhi) and Dr Anil Jaiswal (Baylor College of Medi-
cine, Houston, TX, USA) for critical reading, helpful
comments on the manuscript. We thank the Depart-
ment of Biotechnology, Government of India grant for
partial support and Council of Scientific and Industrial
Research, New Delhi for a fellowship to S.M. An
International Senior Research Fellowship from the

Wellcome Trust (UK) funds the confocal microscopy
facility at ICGEB, New Delhi.
References
1 Sanders D, Brownlee C & Harper JF (1999) Communi-
cating with calcium. Plant Cell 11, 691–706.
2 Rudd JJ & Franklin-Tong VE (2001) Unravelling
response-specificity in Ca2+ signalling pathways in
plant cells. New Phytol 151, 7–33.
3 Zielinski RE (1998) Calmodulin and calmodulin-binding
proteins in plants. Annu Rev Plant Physiol Plant Mol
Biol 49, 697–725.
4 Luan S, Kudla J, Rodriguez-Concepcion M, Yalovsky S
& Gruissem W (2002) Calmodulins and calcineurin
B-like proteins: Calcium sensors for specific signal
response coupling in plants. Plant Cell 14 (Suppl.),
S389–S400.
5 Harmon AC, Gribskov M & Harper JF (2000) CDPKs:
a kinase for every Ca
2+
signal? Trends Plant Sci 5, 154–
159.
S. Mahajan et al. Stress-induced CIPK from pea phosphorylate CBL
FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS 923
6 Sanders D, Pelloux J, Brownlee C & Harper JF (2002)
Calcium at the crossroads of signaling. Plant Cell 14
(Suppl.), S401–S417.
7 Liu J & Zhu JK (1998) A calcium sensor homolog
required for plant salt tolerance. Science 280, 1943–1945.
8 Kudla J, Xu Q, Harter K, Gruissem W & Luan S
(1999) Genes for calcineurin B-like proteins in Arabidop-

sis are differentially regulated by stress signals. Proc
Natl Acad Sci USA 96, 4718–4723.
9 Sanchez-Barrena MJ, Martinez-Ripoll M, Zhu JK &
Albert A (2005) The structure of the Arabidopsis thali-
ana SOS3: molecular mechanism of sensing calcium for
salt stress response. J Mol Biol 345, 1253–1264.
10 Shi J, Kim KN, Ritz O, Albrecht V, Gupta R, Harter
K, Luan S & Kudla J (1999) Novel protein kinases
associated with calcineurin B-like calcium sensors in
Arabidopsis. Plant Cell 11, 2393–2405.
11 Kim KN, Cheong YH, Gupta R & Luan S (2000) Inter-
action specificity of Arabidopsis calcineurine B-like cal-
cium sensor and their target kinases. Plant Physiol 124,
1844–1853.
12 Guo Y, Halfter U, Ishitani M & Zhu JK (2001) Mole-
cular characterization of functional domains in the pro-
tein kinase SOS2 that is required for plant salt
tolerance. Plant Physiol 13, 1383–1400.
13 Albrecht V, Ritz O, Linder S, Harter K & Kudla J
(2001) The NAF domain defines a novel protein–protein
interaction module conserved in Ca
2+
-regulated kinase.
EMBO J 20, 1051–1063.
14 Gong D, Guo Y, Schumaker K & Zhu JK (2004) The
SOS3 family of calcium sensors and SOS2 family of
protein kinases in Arabidopsis. Plant Physiol 134, 919–
926.
15 Kolukisaoglu U, Weinl S, Blazevic D, Batistic O &
Kudla J (2004) Calcium sensors and their interacting

protein kinases: Genomics of the Arabidopsis and rice
CBL-CIPK signaling networks. Plant Physiol 134 , 43–
58.
16 Gong D, Gong Z, Guo Y, Chen X & Zhu JK (2002)
Biochemical and functional characterization of PKS11,
a novel Arabidopsis protein kinase. J Biol Chem 277,
28340–28350.
17 Gong D, Gong Z, Guo Y & Zhu J-K (2002) Expres-
sion, activation and biochemical properties of a novel
Arabidopsis protein kinase. Plant Physiol 129, 225–234.
18 Guo Y, Xiong L, Song CP, Gong D, Halfter U & Zhu
JK (2002) A calcium sensor and its interacting protein
kinase are global regulators of abscisic acid signaling in
Arabidopsis. Dev Cell 3, 233–244.
19 Kim KN, Cheong YH, Grant JJ, Pandey GK & Luan S
(2003) CIPK3, a calcium sensor-associated protein
kinase that regulates abscisic acid and cold signal trans-
duction in Arabidopsis. Plant Cell 15, 411–423.
20 Guo Y, Qiu QS, Quintero FJ, Pardo JM, Ohta M,
Zhang C, Schumaker KS & Zhu JK (2004) Transgenic
evaluation of activated mutant alleles of SOS2 reveals a
critical requirement for its kinase activity and C-term-
inal regulatory domain for salt tolerance in Arabidopsis
thaliana. Plant Cell 16 , 435–449.
21 Pandey GK, Cheonga YH, Kim K-N, Granta JJ, Li L,
Hunga W, D’Angeloc C, Weinl S, Kudla J & Luana S
(2004) The calcium sensor calcineurin B-like 9 modu-
lates abscisic acid sensitivity and biosynthesis in Arabi-
dopsis. Plant Cell 16, 1912–1924.
22 Nagae M, Nozawas A, Koizumi N, Sano H, Hashimoto

H, Sato M & Shimizu T (2003) The crystal structure of
the novel calcium-binding protein at CBL2 from Arabi-
dopsis thaliana. J Biol Chem 278, 42240–42246.
23 Shi H, Kim YS, Guo Y, Stevenson B & Zhu JK (2003)
The Arabidopsis SOS5 locus encodes a cell surface adh-
sion protein and is required for normal cell expansion.
Plant Cell 15, 19–32.
24 Qiu Q-S, Guo Y, Dietrich M, Schumaker KS & Zhu
J-K (2002) Regulation of SOS1, a plasma membrane
Na
+
⁄ H
+
exchanger in Arabidopsis thaliana, by SOS2
and SOS3. Proc Natl Acad Sci USA 99, 8436–8441.
25 Shah J & Klessig DF (1999) In Biochemistry & Molecu-
lar Biology of Plant Hormones (Hooykaas PPJ, Hall
MA & Libbenga KR, eds), pp. 513–541. Elsevier,
Amstradam.
26 Dat JF, Lopez-Delgado H, Foyer CH & Scott IM
(1998) Parallel changes in H
2
O
2
and catalase during
thermotolerance induced by salicylic acid or heat accli-
mation in mustard seedlings. Plant Physiol 116, 1351–
1357.
27 Borsani O, Valpuesta V & Botella MA (2001) Evidence
for a role of salicylic acid in the oxidative damage gen-

erated by NaCl and osmotic stress in Arabidopsis seed-
lings. Plant Physiol 126, 1024–1030.
28 Pandey S, Tiwari SB, Tyagi W, Reddy MK, Upadhyaya
C & Sopory SK (2002) A Ca
2+
⁄ CaM-dependent kinase
from pea is stress regulated and in vitro phosphorylates
a protein that binds to AtCaM5 promoter. Eur J Bio-
chem 269, 3193–3204.
29 Kim KN, Lee JS, Han H, Choi SA, Go SJ & Yoon IS
(2003) Isolation and characterization of a novel rice
Ca
2+
-regulated protein kinase gene involved in
responses to diverse signals including cold, light, cyto-
kinins, sugars and salts. Plant Mol Biol 52, 1191–1202.
30 Yamaguchi-Shinozaki K & Shinozaki K (1994) A novel
cis-acting element in an Arabidopsis gene is involved in
responsiveness to drought, low-temperature, or high-salt
stress. Plant Cell 6, 251–264.
31 Tuteja N, Beven AF, Shaw PJ & Tuteja R (2001) A pea
homologue of human DNA helicase I is localised within
the dense fibrillar component of the nucleolus and sti-
mulated by phosphorylation with CK2 and cdc2 protein
kinases. Plant J 25, 9–17.
32 Yadav N, Chandok MR, Prasad J, Bhattacharya S,
Sopory SK & Bhattacharya A (1997) Characterization
Stress-induced CIPK from pea phosphorylate CBL S. Mahajan et al.
924 FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS
of EhCaBP, a calcium binding protein of Entamoeba

histolytica and its binding proteins. Mol Biochem Parasi-
tol 84, 69–82.
33 Pham XH, Reddy MK, Ehtesham NZ, Matta B &
Tuteja N (2000) A DNA helicase from Pisum sativum is
homologous to translation initiation factor and stimu-
lates topoisomerase I activity. Plant J 24, 219–229.
34 Schiestl RH & Gietz RD (1989) High efficiency trans-
formation of intact yeast cells using single stranded
nucleic acids as a carrier. Curr Genet 16, 339–346.
35 Sanan-Mishra N, Phan XH, Sopory SK & Tuteja N
(2005) Pea DNA helicase 45 overexpression in tobacco
confers high salinity tolerance without affecting yield.
Proc Natl Acad Sci USA 102, 509–514.
36 Vashisht A, Pradhan A, Tuteja R & Tuteja N (2005)
Cold and salinity stress-induced pea bipolar pea DNA
helicase 47 is involved in protein synthesis and stimu-
lated by phosphorylation with protein kinase C. Plant J
44, 76–87.
S. Mahajan et al. Stress-induced CIPK from pea phosphorylate CBL
FEBS Journal 273 (2006) 907–925 ª 2006 The Authors Journal compilation ª 2006 FEBS 925