Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf

cN-crystallin and the evolution of the bc-crystallin
superfamily in vertebrates
Graeme Wistow
1
, Keith Wyatt
1
, Larry David
2
, Chun Gao
1
, Orval Bateman
3
, Steven Bernstein
4
,
Stanislav Tomarev
1
, Lorenzo Segovia
5
, Christine Slingsby
3
and Thomas Vihtelic
6
1 National Eye Institute, National Institutes of Health, Bethesda, MD, USA
2 Oregon Health Sciences University, Portland, OR, USA
3 Department of Crystallography, Birkbeck College, London, UK
4 Department of Ophthalmology, University of Maryland School of Medicine, Baltimore, MD, USA
5IBT⁄ UNAM, Col. Chamilpa, Cuernavaca, Morelos, Mexico
6 Department of Biological Sciences, University of Notre Dame, Notre Dame, IN, USA
Much of the complexity and diversity of life arises
from the multiplication and evolution of gene famil-

ies, increasing the functional repertoire of the gen-
ome. By gene duplication, a single protein function
(or set of functions) can be expanded into a broader
set of more specialized functions. The c-crystallins
are a gene family with a complex history in verteb-
rate evolution. They encode proteins that are highly
abundant components of the eye lens but are also
expressed at lower levels in other parts of the eye,
perhaps with a stress-like role [1–6]. Together with
the related b-crystallins, the c-crystallins belong to an
ancient superfamily (known as the bc-crystallin super-
family) with members ranging from the prokaryotic
sporulation protein, Protein S of Myxococcus xanthus
[7], to AIM1, a protein implicated in the control of
malignancy in melanoma in man [8,9]. In the verteb-
rate lens, the b and c crystallins together account for
the majority of the soluble proteins (the other major
family being the a-crystallins, members of the small
heat-shock protein superfamily [10,11]). Although it
has been suggested that proteins of this superfamily
may have roles in maintenance of cellular architec-
ture [8], little is known about their function. Like the
c-crystallins, b-crystallins have also been detected in
the retina [12], and both have been identified in Dru-
sen bodies, which form with age in retinal pigment
epithelium (RPE) [13].
Keywords
crystallin; eye; gene structure; intron loss;
lens
Correspondence

G. Wistow, Section on Molecular Structure
and Functional Genomics, National Eye
Institute, Bg 7, Rm 201, National Institutes
of Health, Bethesda, MD 20892-0703, USA
Tel: +1 301 402 3452
Fax: +1 301 496 0078
E-mail:
(Received 21 January 2005, revised 23
February 2005, accepted 8 March 2005)
doi:10.1111/j.1742-4658.2005.04655.x
The b and c crystallins are evolutionarily related families of proteins that
make up a large part of the refractive structure of the vertebrate eye lens.
Each family has a distinctive gene structure that reflects a history of succes-
sive gene duplications. A survey of c-crystallins expressed in mammal, rep-
tile, bird and fish species (particularly in the zebrafish, Danio rerio) has led
to the discovery of cN-crystallin, an evolutionary bridge between the b and
c families. In all species examined, cN-crystallins have a hybrid gene struc-
ture, half b and half c, and thus appear to be the ‘missing link’ between
the b and c crystallin lineages. Overall, there are four major classes of
c-crystallin: the terrestrial group (including mammalian cA–F); the aquatic
group (the fish cM-crystallins); the cS group; and the novel cN group. Like
the evolutionarily ancient b-crystallins (but unlike the terrestrial cA–F and
aquatic cM groups), both the cS and cN crystallins form distinct clades
with members in fish, reptiles, birds and mammals. In rodents, cNis
expressed in nuclear fibers of the lens and, perhaps hinting at an ancestral
role for the c-crystallins, also in the retina. Although well conserved
throughout vertebrate evolution, cN in primates has apparently undergone
major changes and possible loss of functional expression.
Abbreviations
EST, expressed sequence tag; RPE, retinal pigment epithelium.

2276 FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS
b and c crystallins are related in their highly sym-
metrical structures built from four characteristic
bc-motifs (modified Greek keys) arranged as two
similar domains [14]. The two families differ in that
c-crystallins are monomers that lack lengthy N-ter-
minal or C-terminal extensions, whereas b-crystallins
have long N-terminal arms and form dimers and
higher oligomers.
The two families also differ in gene structure
[3,10,15]. In b-crystallins, each protein structural motif
is encoded in a separate exon, with other exons enco-
ding the N-terminal arms. The same organization is
seen in the AIM1 gene, and as such presumably repre-
sents the ancestral condition [8].The gene structures of
c-crystallins are clearly related to those of b-crystallins
and AIM1, with precisely conserved intron positions
delineating protein domains; however, in the c-crystal-
lins the introns that divide the sequences encoding the
two motifs of each domain are missing. Thus a c-crys-
tallin gene has ‘fused’ exons corresponding to each
two-motif domain.
The c-crystallins present a particularly interesting
example of the dynamic evolution of a gene family.
They play a key role in determining the optical proper-
ties of the lens, a tissue that is subjected to strong envi-
ronmental selective pressures as species move from
water to land, from dark to light, from the ground to
the air, and the requirements for vision change accord-
ingly. As it has adapted in different evolutionary line-

ages, the lens has changed its protein composition
[3,16]. This has led to considerable variability in the
content and sequence of c-crystallins in different verte-
brates, which are abundant in species with hard lenses
(such as fish and rodents) but at much lower levels or
missing in other terrestrial species. This is in contrast
with the b-crystallins which are well conserved and
have clear orthologs in all vertebrate orders (see for
examples [17–20]).
In fish and amphibians, there are multiple, divergent
c-crystallin genes that may exhibit only about 50%
identity at the protein level [17,19,21]. This is similar
to the level of divergence among the b-crystallins
[18,19,22,23] and suggests a similar antiquity of these
gene families in the vertebrate lens. In contrast, birds,
with soft accommodating lenses, lack the embryonically
expressed c-crystallins that in other vertebrates are
major components of the developing lens, and have
replaced them with the taxon-specific ‘enzyme crystal-
lins’, d and e crystallin [16,24–26].
In placental mammals there is a closely linked clus-
ter of six c-crystallin genes (cA–F) which are generally
expressed in the embryo, and these show 77–97% iden-
tity at the protein level, implying a relatively recent
origin for this family in this lineage. It has been sug-
gested that, as in birds, c-crystallins may have been on
their way to extinction in the ancestors of mammals
but were perhaps ‘reinvented’ by successive duplication
of a surviving gene as mammals adapted to principally
nocturnal, burrowing habits before the extinction of the

dinosaurs [3,16]. Indeed, as some mammals have now
become diurnal, these genes may again be in a process
of change or loss; in humans two of these genes (cE and
cF) are pseudo and others (particularly cA) seem to be
expressed at lower levels than in other mammals [15,27].
Mammals also express cS-crystallin, a divergent outlier
of the family with a short N-terminal arm, which is the
major c-crystallin expressed in the secondary fiber cells
of the mature mammalian lens [27–29].
Little is known about the c-crystallins of marsupials
or reptiles, but it is clear that this family has under-
gone considerable changes, particularly during mam-
malian evolution. These changes illustrate the way in
which gene families may expand, contract and adapt.
They may also help us understand the functions of the
c-crystallin family in vision and elsewhere as most
changes are presumably driven by specific adaptive
requirements in the eyes of different vertebrates.
Here we describe a survey of the evolutionary his-
tory of c-crystallins in vertebrates, including a large
analysis of crystallin gene expression in zebrafish lens,
and the discovery of a new member of the family, cN-
crystallin, which seems to be an evolutionary bridge
between the b and c families.
Results
c-Crystallin and b-crystallin sequences from several verte-
brate species were cloned and sequenced in NEIBank
genomics projects or predicted from bioinformatics
analysis of genome sequences. The novel sequences are
shown in Fig. 1, aligned using the clustalw algorithm,

and their relatedness is illustrated in the phylogenetic
tree in Fig. 2, drawn using the neighbor joining option
in the program mega [30]. Some previously described
sequences are also included to illustrate the overall
distribution of the superfamily members expressed in
vertebrate lenses.
cDNA Libraries
Approximately 1500 clones were sequenced from the
un-normalized mouse whole eye ioip libraries and a
further 1000 and 1300, respectively, from the two
equalized libraries jajbjc and lglh. A total of 1000
clones (code designation mw) were sequenced from a
cDNA library made from western grey kangaroo
G. Wistow et al. cN-crystallin
FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS 2277
cN-crystallin G. Wistow et al.
2278 FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS
kangB
kangD
frgM1-1
frgM1-2
zfgM1
zfgM2a
zfgM2b
zfgM2c
carpgM1
carpgM2
carpgM3
zfgM3
zfgM4

zfgM5
zfgM6
zfgM7
zfgMX
Aquatic
γM
γ−type gene
γs
γN
βA
βB
β
γ−type gene
β−type gene
β−type gene
βγ−hybrid
Terrestrial
γ
γ−type gene
γ
mgB
mgC
mgD
mgE
mgF
mgA
100
100
100
100

91
74
66
98
99
64
92
99
40
56
100
100
100
100
89
32
71
34
57
72
90
69
61
100
100
mbB3
zfbB3
mbB2
zfbB2
zfbA2

mbA2
zfbA4
mbA4
mbA1
zfbA1-1
zfbgx
chickgN
iggN
mgN
zfgN2
zfgN1
zfgSc
zfgSd
kangS
iggS
chickgS
mgS
zfgSb
zfgSaL
zfgSa
100
100
100
0.1
66
98
94
64
99
76

99
45
53
50
94
29
46
Fig. 2. Phylogenetic tree of b and c crystal-
lins in vertebrates. Calculated from the align-
ment in Fig. 1 and drawn using
MEGA,by
neighbor-joining with Poisson correction.
Bootstrap values are indicted for each node.
The major clades are identified. Cartoons of
the exon structure of the motif-encoding
regions of genes in each clade are shown.
Red boxes show the typical c-crystallin exon
encoding two motifs, and blue boxes show
the single-motif exons of b-crystallin genes.
Fig. 1. Protein sequences for representative members of the bc-crystallin superfamily. Sequences are derived from the work described here,
with some examples of fish and amphibian sequences taken from GenBank. Sequence names beginning with ‘m’ are from mouse, ‘ig’ from
iguana, ‘kan’ from kangaroo and ‘zf’ from zebrafish, while carp and chick sequences are so labeled. Sequences were aligned by
CLUSTAL W.
The positions of N-terminal and C-terminal arms, the four structural motifs (I–IV) and the connecting peptide between N-terminal and C-ter-
minal domains are indicated below the alignment. Also shown are the approximate positions of the four b-strands of each motif (a–d), by
analogy with known structures. Yellow highlights show the principal conserved positions of each motif essential for correct folding. Note
that the long C-terminal arm of zfbB3 has been truncated to fit the page.
G. Wistow et al. cN-crystallin
FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS 2279
(Macropus fuliginosus) lens [31]. In a small pilot survey

of expressed genes in a reptile lens,  1000 clones were
sequenced from a PCR-derived library (code designa-
tion hm) made from the lenses of a single individual
iguana. Almost 4000 clones from an adult zebrafish
lens library (code designation nab) were sequenced.
Further details of this and other zebrafish eye libraries
will be described elsewhere.
Vertebrate c-crystallins
Among the collections of sequences obtained for ver-
tebrate lens and eye proteins were a large set of clones
for b and c crystallins. Even the small set of clones
from iguana lens yielded complete coding sequences
for two members of the c-crystallin family. One of
these (GenBank accession number AY788911) was the
iguana ortholog of cS-crystallin, with 178 amino-acid
residues, including initiator methionine. Indeed, our
analyses confirm that cS is well conserved and highly
expressed throughout the vertebrates. The other iguana
sequence (GenBank accession number AF445457) was
a novel protein similar in size to cS (183 residues) and
with an N-terminal arm of the same length. However,
the new protein is clearly distinct from cS; its overall
sequence identity to iguana cS is only 44% and, relat-
ive to cS, the protein has insertions (mainly of gly-
cines), in the c–d loops of motifs I and III and in the
connection between motifs III and IV (Fig. 1). This
protein was given the name cN, for c-new.
From the combined mouse whole eye data, complete
sequences were obtained for cA–F and cS from
C57Bl ⁄ 6 mice. In addition, an almost full-length clone

was obtained for a protein very similar to the iguana
lens cN. The complete coding sequence of mouse cN
(GenBank accession number AF445456) was deduced
from this clone, mouse genome sequence, from an
apparently full-length expressed sequence tag (EST) in
dbEST (CK795274), and from interspecies compari-
sons. Several other ESTs for both mouse and rat cN
eye are also present in dbEST. The mouse gene is on
chromosome 5 at about position 23.2 Mbp, cA–F are
on chromosome 1, and cS is on chromosome 16 [2].
Three full-length c-crystallins were obtained from
kangaroo lens. One was the ortholog of cS, identical
in length and 72% identical in sequence with that of
mouse (GenBank accession number AY898646). The
other two were more similar to the cA–F crystallins,
with no N-terminal arm. Based on their closest mat-
ches in blast searches, these were designated cB, with
the longer connecting peptide and a length of 175
codons (accession number AY898644), and cD, with
174 codons (accession number AY898645), although a
more systematic nomenclature will probably be needed
when all kangaroo c-crystallin sequences are known.
In this small sample, no clones for an ortholog of cN
were detected.
From zebrafish, a total of 16 distinct c-crystallins
were identified along with a b-like sequence (with a
long N-terminal arm) that had some sequence similar-
ity to c-crystallins and several b-crystallins (GenBank
accession numbers AY738742–AY738756). Nine of the
c-crystallins were generally similar to the cM-crystal-

lins previously cloned from carp lenses [32] and were
named accordingly (Figs 1 and 2). Two were named
zfcM1 and zfcM3, and three sequences related to carp
cM2, including one closely related pair, were named
zfcM2a, zf cM2b and zfcM2c. The other cM-like
sequences were named zfcM4–7. All of these sequences
lack the N-terminal arm seen in cS, cN and b crystal-
lins and are similar in size to the cA–F group of mam-
mals. As shown in the phylogenetic tree (Fig. 2), the
cM-crystallins form a distinct clade of ‘aquatic’ c-crys-
tallins.
An additional zebrafish c-crystallin was found to be
generally similar to the cM class in size but is more
divergent in sequence. As shown in Fig. 2, this protein
does not group with either the terrestrial vertebrate
c-crystallins or the aquatic cM class. Provisionally this
has been named zfcMX.
Mammalian species possess just one gene for
cS-crystallin. However, the zebrafish lens has four pro-
teins of the cS class. Although these proteins, named
zfcSa–d, show clear sequence similarity to known
cS-crystallins, they have considerable variability at the
N-terminus. Most of the clones for zf cSa, the single
most abundant species in the zebrafish lens cDNA
library, lack an N-terminal arm altogether. However,
13% of the sequences for zfcSa (zfcSaL) revealed an
alternative splice at the end of the first exon that
added four codons to the coding sequence, enough to
make an N-arm of the same length as in mammalian
cS-crystallins. Like zfcSa, the closely related zfcSb also

lacks an N-arm and so far there is no evidence of
alternative splicing in this gene. A third member of the
cS family in zebrafish, zfcSc has an N-arm that is lon-
ger than in other species (although it contains three
methionines near the N-terminus that could potentially
give rise to alternative translation products), and a
fourth member, zfcSd, has a short arm of just a single
residue.
In addition to the cM and cS crystallins, two of the
zebrafish c-crystallins, zfcN1 and zfcN2, are members
of the cN family. These two proteins have N-terminal
arms identical in length with those of mouse and
iguana cN and they also exhibit the characteristic
cN-crystallin G. Wistow et al.
2280 FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS
insertions in the c–d loops of motifs I and III and in
the link between motifs III and IV. As shown in the
phylogenetic tree, these sequences group with other
members of the cN class in a distinct clade that is
essentially separate from both b and c crystallins. In
the tree shown, the cN branch is weakly linked to the
b-crystallin family, but overall the cN family is an
intermediate in the wider bc superfamily.
The b-crystallins are represented in the phylogenetic
tree by five members cloned from the zebrafish lens lib-
rary (zfbA1-1, zfbA2, zfbA4, zfbB2 and zfbB4) and
their orthologs from mouse. As expected, each fish
sequence is closely related to its mammalian ortholog,
in marked contrast with the relationships among cA–F
and cM crystallins. The designation of zfbA1-1 reflects

the fact that the lens library also contains cDNAs for
a second, and possibly a third, bA1-like protein which
has not yet been completely characterized. One
remaining zebrafish sequence from the lens library is
an outlier of the b-crystallin family. Indeed, in simple
blast comparisons, this sequence is slightly more closely
related to cN-crystallins than to other crystallins,
although it has a long N-terminal arm like a b-crystallin.
In the phylogenetic tree it is placed as an early offshoot
of the main b-crystallin lineages. For its currently ambi-
guous status, this has been named zfbcX.
In current versions of the zebrafish genome, not
all assembled regions have been assigned to specific
chromosomes. However, there is evidence of some clus-
tering of crystallin genes. zfcM1, zfcM2b, zfcM2c and
zfcM6 are all located between positions 12.79 and
12.86 Mbp on chromosome 2, and zfcM3 and zfcM5
are both close to position 29.24 Mbp on chromosome 8.
It has been known for a long time that bird lenses
lack most c-crystallins, although there has been evi-
dence for the presence of cS in its former guise as
bS-crystallin [33–35]. Although no cDNAs are yet
available, inspection of the chicken genome using blat
reveals the presence of well-conserved genes for both
cS and cN crystallins. The predicted sequences are pre-
sented in Fig. 1, and in the phylogenetic tree (Fig. 2)
they group in their respective subfamilies. Chicken cN
is located at about position 5.7 Mbp on chromosome
2, and cS is at about 9.3 Mbp on chromosome 9. The
expression of these genes in the chicken remains to be

examined in detail.
Novel gene structure of cN-crystallins
Genes for cN orthologs are present in mouse, rat,
chicken, and zebrafish, and, as described below,
orthologous genes are also present in the human and
chimp genomes. The most striking feature of the crygn
gene in all these genomes, conserved across over
400 Myr of evolution, is its exon ⁄ intron structure
(Fig. 3). The first half of the gene has the typical struc-
ture of a c-crystallin gene [3], with a short first exon
encoding the start codon and the short N-terminal
‘arm’ similar to that of cS. A phase 0 intron separates
that exon from a larger exon, exon 2, which encodes
the first two structural motifs, and hence the N-ter-
minal domain of the protein, just as in the genes for
cS and cA–F. However, the second half of the gene
has the structure of a b-crystallin gene, with two exons
encoding the two motifs of the C-terminal domain.
The crygn gene is thus a hybrid of b and c crystallin
gene structures, apparently an intermediate in the evo-
lution of the c-crystallins from the b-crystallins. This
observation is concordant with the position of the cN
family in the protein sequence phylogenetic tree, where
it is an intermediate between the b and c crystallins.
cN in primates: a nonfunctional gene?
A search of the human genome for an ortholog of cN
located a highly conserved gene sequence on chromo-
some 7q36.1, and a very similar gene is present in the
chimp genome, located in an unassembled portion of
chromosome 6. This gene sequence contains a well-

conserved coding sequence for the cN protein, with
one notable exception. The stop codon in rodents is
TAG, but in the human and chimp genes, this codon
has a single base change to CAG (glutamine) (Fig. 4).
In principle, this could allow the translation of a larger
version of cN with an 11-kDa C-terminal extension
rich in glycine and proline (not shown). However, no
cDNA clones for a human cN transcript have emerged
from any of the NEIBank analyses. In an attempt to
Fig. 3. Correspondence of exon structure and protein structure for
cN-crystallin. Red boxes show coding sequence, green boxes show
untranslated regions. Protein structure is indicated by the stylized
Greek key folding pattern of the bc motif. The four motifs are labe-
led I–IV, as are the corresponding exon sequences that encode
those motifs.
G. Wistow et al. cN-crystallin
FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS 2281
identify human transcripts, PCR was performed on
template made from human lens, retina, and
RPE ⁄ choroid libraries. No products were obtained
from lens or retina (a negative result in this procedure
is not proof of absence). A product was obtained from
RPE ⁄ choroid template using primers located in exons
2 and 3, equivalent to the N-terminal and C-terminal
domains (Fig. 4). However, sequencing showed that
the amplified product contained sequences for the
N-terminal domain of human cN with splice-site skip-
ping and use of a cryptic splice junction in intron 2.
Such an alternative splice could produce a truncated,
one-domain protein (Fig. 4). However, the crystallin

coding sequence does not appear to be part of a trans-
latable ORF in this transcript. Interestingly, an EST
apparently corresponding to a similar transcript from
human hippocampus (BM548090) is present in dbEST,
suggesting that the PCR product from RPE may repre-
sent a transcript found at low levels in neural tissue,
but not one that could produce a viable protein.
Screening of available Invitrogen full-length Gene-
Trapper-ready cDNA libraries showed that cN tran-
scripts were detectable only in human testis. Two
positive clones were obtained from this tissue (Gen-
Bank accession number AF445455). The testis tran-
script included the first exon (the N-terminal arm
region) and exon 2 (the N-terminal domain). For the
C-terminal domain, however, only exon 3 (the third
motif) was included. The exon corresponding to the
fourth motif was skipped and instead an unrelated,
cryptic downstream exon was included (Fig. 4). This
exon has no similarity to the bc motif sequence and
could not produce a polypeptide capable of completing
the C-terminal domain of the protein.
Currently there is no evidence for expression of
canonical cN in primates. This leaves open the ques-
tion of whether the gene for cN retains any function
in humans. At the very least, the human gene has
clearly changed its expression and may indeed be head-
ing for extinction, joining cE and cF [15].
Recombinant mouse cN
Recombinant mouse cN was synthesized in a bacterial
host (Fig. 5A), purified and verified by MS. Initial

Fig. 4. Variant splice forms of the human CRYGN gene. Exons are
shown by boxes and labeled as in Fig. 3. For the full-length cDNA
from human testis, red boxes show the coding sequence corres-
ponding to the cN ORF; the blue box shows the coding sequence
of the cryptic exon; green boxes show untranslated regions; red
lines show the testis splice pattern. The change of the stop codon
seen in other species to CAG causes an increase in the potential
ORF of the exons encoding motif IV. Potential coding sequence
from intron read-through seen in clones from human RPE is shown
in orange, and the alternative splice of this variant is shown by the
orange lines.
A
B
Fig. 5. Recombinant mouse cN-crystallin is less stable than
cD-crystallin. Expression of recombinant mouse cN. Lane 1, pET-cN
E. coli whole cell lysate (uninduced); lane 2, pET-cN E. coli whole
cell lysate (induced); lane 3, purified cN. Denaturation profiles for
recombinant mouse cN and human cD in increasing urea concen-
trations.
cN-crystallin G. Wistow et al.
2282 FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS
attempts at obtaining a mass measurement of the cova-
lent structure of cN by MS resulted in a spectrum with
a large number of peaks (including the value calcu-
lated from the sequence), probably due to binding of
multiple sodium ions, making deconvolution difficult.
However, prewarming the sample at 37 °C resulted in
an almost single peak spectrum of 21 270 Da, corres-
ponding to cN lacking the initiator methionine.
In solution studies, this protein behaved as a mono-

mer, similar to c-crystallins and in contrast with the
multimeric b-crystallins. Indeed, c-crystallins in solu-
tion tend to behave as if they were even smaller than
expected for 20-kDa monomers and cN exhibits the
most extreme version of this behavior seen so far. An
estimate of the protein oligomeric size was gained from
gel filtration using two different chemical supports. On
both columns, cN was eluted with a higher elution vol-
ume than human cD-crystallin. On preparative gel fil-
tration on Sephacryl S300, cN was eluted at 103.7 mL.
Under the same conditions, human cD-crystallin was
eluted at 98.5 mL. On analytical gel filtration on Supe-
rose 12, cN was eluted at 16.05 mL whereas human
cD-crystallin was eluted at 14.96 mL. These results
indicate that cN is eluted at a smaller apparent size
than another monomeric c-crystallin. As the two poly-
peptide chains have a similar molecular mass, these
data suggest that cN behaves even more anomalously
on gel filtration than other c-crystallins, possibly
through interactions with the column [36,37]. To pro-
vide unambiguous evidence of the oligomer size of cN,
light scattering was performed. The molecular mass of
the protein at 5 mgÆmL
)1
was evaluated by dynamic
light scattering. The average over 15 readings gave a
diffusion coefficient (D
T
) of 974.5 · 10
)13

m
2
Æs
)1
. The
data were of high standard, with baseline values within
the range 1.000 ± 0.001. Sum-of-squares values were
below 5, and the majority were below 2, showing that
the quality of the data was statistically valid. This
measured diffusion coefficient gives an estimated
molecular mass of 23.14 kDa. The results showed
clearly that in free solution at  5mgÆmL
)1
the protein
was monomeric. The likely explanation for the differ-
ent molecular sizes in the gel filtration systems is the
propensity for the crystallin molecule to interact with
the column matrix [36,37]. However, efforts to crystal-
lize the protein were unsuccessful.
Recombinant mouse cN is less soluble than other
c-crystallins. Although not rigorously tested, it seemed
that a concentration of 5 mgÆmL
)1
was limiting.
Unlike other lens c-crystallins, mouse cN, which has a
calculated pI of 6.27, was not soluble when exposed
for significant lengths of time to pH 5, precluding the
use of cation chromatography for purification. Samples
of cN were turbid after storage at 4 °C or when
thawed. Cooling-induced precipitation was not fully

reversible. Thus, although cN exhibits some of the
characteristics of the phase-separation-driven phenom-
enon known as ‘cold cataract’, its behavior is not con-
sistent with a simple liquid-liquid phase transition seen
for some other c-crystallins [38].
Typically, c-crystallins also exhibit very high con-
formational stability [39]. Recombinant mouse cN was
subjected to unfolding in urea under equilibrium con-
ditions and compared with human cD-crystallin
(Fig. 5B). The data show that under conditions in
which cD is unchanged, as judged by fluorescence, cN
completely unfolds, suggesting a much lower conform-
ational stability. In common with other c-crystallins,
the tryptophans of cN are more quenched when buried
in the folded protein than when exposed to the denatu-
rant [40].
cN expression in mouse eye
Eye-specific expression of cN was confirmed by Nor-
thern blotting. In mouse multi-tissue Northern blot
analysis, cN was detectable only in eye (Fig. 6A). In
Northern blot analysis of rat tissues, cN was detec-
ted only in retina (Fig. 6B). Lens was not included
on these blots. Expression of cN protein in lens was
examined by 2D gels and MS. Figure 7A shows a
Ponceau S-stained blot of soluble protein from a
newborn mouse. The identities of major crystallins
were known from earlier work [41]. After destaining,
the blot was probed with antibody to cN (Fig. 7B).
A single immunoreactive spot was observed just
below bA2. The immunoreactive spot was not visible

in Ponceau stain, but Coomassie blue staining of a
larger 2D electrophoresis gel of soluble protein from
newborn mouse lens did detect a protein spot at this
position (cN, Fig. 7C). This spot was confirmed to
be cN by in-gel digestion and LC ⁄ MS ⁄ MS analysis
of tryptic fragments that identified seven distinct cN
peptides covering 48% of the protein sequence (data
not shown).
The antibody to cN was used in immunofluores-
cence studies of mouse eye sections (Fig. 8). In the
anterior segment of the eye (Fig. 8A), cN immunoreac-
tivity was seen specifically in the lens nucleus, the pri-
mary site of expression for cA–F crystallins, but not in
secondary fibers or lens epithelium, where cS-crystallin
is expressed. No expression was evident in other tissues
of the anterior chamber. In the retina (Fig. 8B),
expression was seen in the outer plexiform layer (con-
taining photoreceptor axons and synapses) and photo-
receptor outer segments.
G. Wistow et al. cN-crystallin
FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS 2283
Discussion
In phylogenetic analyses, the b-crystallins form a dis-
tinct clade with bA (acidic) and bB (basic) branches.
As has previously been observed, and is illustrated in
Fig. 2, most b-crystallins have clear orthologs in all
vertebrates so that mammalian and zebrafish bA2
sequences, for example, are close together on the same
branch of the tree. In contrast, the cA–F-crystallins
that are expressed in most mammals have no orthologs

in fish and form a distinct branch of their own that
includes c-crystallins of similar size from amphibians
(two of which, from a frog, Rana catesbeiana [42], are
shown), and from marsupials in a ‘terrestrial’ branch
of the family. However, even on this branch, different
orders do not appear to have truly orthologous crys-
tallins, i.e. the frog sequences are not orthologs of any
gene in mammals.
Whereas most of the zebrafish c-crystallins are sim-
ilar in size to the mammalian cA–F group, with no
N-terminal arm, they too form a distinct branch of the
overall family. This branch includes the cM-crystallins
which have previously been identified in carp, so it
seems appropriate to name this subfamily the cM-crys-
tallins and to number the new zebrafish sequences
A
B
Fig. 6. Expression of cN transcripts is eye specific in rodents. (A)
Northern blot of multiple mouse tissues with probe for mouse cN.
Br, brain; Ey, eye; He, heart; Lu, lung; Li, liver; Sp, spleen; Ki,
kidney; Pa, pancreas; Sm, skeletal muscle, Th, thymus. Staining
pattern for 28S and 18S rRNA is shown below. (B) Northern blot of
multiple rat tissues with probe for mouse cN. Ret, retina (two pre-
parations); Lu, lung; Ki, kidney; Te, testis; Li, liver; Sp, spleen; Br,
brain; He, heart. The staining pattern for 28S rRNA is shown below.
Fig. 7. Expression of cN protein in newborn mouse lens. (A) Ponc-
eau S-stained blot of 2D electrophoresis gel of soluble protein from
a newborn mouse lens showing major crystallin spots. (B) Western
blot of destained 2D electrophoresis gel blot shown in (A) using
antibody to cN. A single spot is detected at the same relative posi-

tion occupied by cN in part (C). (C) Coomassie blue-stained large
2D electrophoresis gel of soluble protein from a newborn mouse
(from [41]). Protein marked with an arrow was confirmed to be cN
by MS.
cN-crystallin G. Wistow et al.
2284 FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS
accordingly (however, the previous cM nomenclature
for Rana may not be appropriate in this overall con-
text). As is seen elsewhere in the family tree, several of
the zebrafish sequences (such as cE and cF in mam-
mals) appear to be the result of relatively recent gene
duplications, probably the result of large-scale genome
duplication events in these and other fish [43].
Mammal, bird and fish cS sequences form a third,
more ancient branch. In this subfamily, a pair of
zebrafish genes (cSa and cSb) are close in sequence to
those of chicken and mouse, and a second pair (cSc
and cSd) belong to an earlier offshoot. This may indi-
cate that there were two cS genes in the common
ancestor of fish, birds and mammals and that only one
of these survived in the terrestrial species while both
survived in fish and indeed underwent a subsequent
duplication in some species. A predicted cS from
chicken and one cloned from iguana belong to this
clade and appear to be orthologs of mammalian
cS-crystallin.
The cN family is newly discovered. In terms of
structure and solution behavior, cN most closely
resembles c-crystallins. However, in the phylogenetic
tree, the cN sequences do not associate strongly with

either the b or c subbranches. Genes from mammals,
chicken and zebrafish all show a hybrid gene structure
with both c-like and b-like exons. Overall, the cN fam-
ily appears to be an evolutionary intermediate between
the wider b and c crystallin families.
It seems likely that the b-crystallin ⁄ AIM1 group of
genes represents the original gene organization state of
the superfamily, with genes built up by successive dupli-
cation from an ancestral gene that encoded an individ-
ual motif (although, as an individual bc motif could not
be a stable structure alone, the protein product must
have been an obligate dimer), resulting in each motif
A
B
Fig. 8. Immunofluorescence localization of cN-crystallin in mouse eye. (A) Expression of cN in the anterior segment. Left panel shows DAPI
staining for nuclei; center panel shows immunofluorescence stain (red) for cN; right panel shows a control with no primary antibody. (B)
Expression in the posterior segment. Left panel shows combined DAPI (blue) staining of cell nuclei and immunofluorescence (red) signal for
cN. GCL, Ganglion cell layer; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer, OS,
outer segments. Right panel shows control with no primary antibody. White arrows show positive stain in OPL and OS layers.
G. Wistow et al. cN-crystallin
FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS 2285
being encoded by a separate exon [44]. All the protein
products of this part of the superfamily also have N-ter-
minal (and sometimes C-terminal) extensions.
The cN family represents a first step into a new spe-
cialization for the superfamily, retaining only a short
N-terminal arm at the protein level. At the same time,
perhaps with no major functional consequences, the
ancestral cN gene lost the intron dividing the exons
encoding the first domain. The next step in the evolu-

tion of the c-crystallins was cS-crystallin, in which a
second, symmetrical intron loss occurred to give the
‘modern’ c pattern. It has previously been speculated
that intron loss in the c-lineage (or gain in the b-crys-
tallin lineage) must have occurred in a one domain
ancestor which later duplicated [4,45]. cN suggests that
intron loss occurred at the two-domain stage and pro-
ceeded in two steps. The mechanism for this is unclear.
It is thought that intron loss occurs through gene con-
version with intronless pseudogene copies of genes
[46]. However, no such examples of pseudogenes are
known for the b and c crystallin families.
In mouse it seems that cN and cS have distinct pat-
terns of expression in the eye, with cS in the epithe-
lium and secondary fibers of the lens, the cornea and
retinal ganglion cells (unpublished observations),
whereas cN is in primary lens fibers, the outer plexi-
form layer and photoreceptor outer segments. This
suggests functional specialization for different regions
of the eye. The expression of cN in the central regions
of the lens, fiber cells that were laid down before birth,
is consistent with the familiar pattern of expression of
the principally embryonic cA–F genes in the rodent
lens [41,47]. The absence of expression in outer layers
of the lens contrasts with the expression of cS, to
which cN is superficially most similar in structure, and
suggests the possibility that the two genes have com-
plementary roles in the lens, one in the embryonic pri-
mary fibers, the other in the more mature lens.
The relatively lower stability and solubility of cNis

also consistent with a different role from other crystal-
lins. Although they may have multiple functions, crys-
tallins are required to exist for long periods of time
at high concentrations in order to serve as abundant,
structural components of the lens, giving the tissue its
refractive properties. The lower level of expression of
cN and its thermodynamic properties suggest that it is
not well adapted for the high concentration role of a
normal crystallin and may instead have a separate
function.
The expression of cN in the retina is particularly
interesting. There is evidence for expression of cSin
the retina and cornea, but the specific location of cN,
particularly in photoreceptors seems to be novel. It
draws an interesting parallel with a recent observation
in Xenopus laevis of a putatively c-crystallin-like pro-
tein (XAP-1) expressed in the retina and associated
with photoreceptor disc shedding [48]. In evolution,
functional retinas preceded the evolution of a focusing
lens [3,49]. The proteins of the lens arose by the recruit-
ment of genes with pre-existing functions [16,26], so it
is possible that cN recalls an ancestral function of
c-crystallins in retina that predates the lens. However,
if this attractive idea is true, it suggests that there has
been a recent change in this ancient mechanism in the
primate retina, as human (and chimp) cN appears to
have undergone major changes in its expression and
may be on its way to extinction. Evolution has given
rise to many specific adaptations in the primate visual
system (including relatively advanced color vision)

when compared with other mammals. A change in the
ancient role of cN may be one part of a suite of
molecular adaptations in the eye in the human lineage.
In addition to the evolution of cN and cS crystal-
lins, even more specialization in the c-crystallins has
occurred with the loss of the N-terminal arm in the
ancestor of the cM and cA–F groups. The cM sub-
family appears to be specialized for fish. These have
very hard lenses, with high refractive index and low
water content. It has been suggested that lens c-crystal-
lins evolved specifically for the requirements of this
type of lens [16]. As has been noted, fish cM-crystallins
tend to have high sulfur, particularly methionine, con-
tent [32] and this may be part of a specific adaptation
for very high protein concentration. Although mam-
malian c-crystallins have lower sulfur content than
cM, they still possess several cysteine residues which
are potentially vulnerable to oxidation [33,50]. Presum-
ably these have an important function in spite of the
risk they present. It has been suggested that the sulfur-
containing amino acids contribute to the intramole-
cular and intermolecular interactions upon which the
stability of these proteins and their ability to pack
closely without aggregation depend [50]. However, in
terrestrial species, with a need for softer, accommoda-
ting lenses of lower refractive index, there has been a
strong tendency to lose, or reduce the concentrations
of, c-crystallins in the lens, often replacing them with
taxon-specific ‘enzyme crystallins’ through gene recruit-
ment [16]. In mammals, the highly similar cA–F genes,

with no clear orthologs in other orders, may have
been the result of the rescue of a family heading for
extinction by reduplication of a surviving gene, fol-
lowed by another decline in expression in some line-
ages, particularly primates.
In addition to the distinctive grouping of b and c
crystallins in the phylogenetic tree, there are two outly-
cN-crystallin G. Wistow et al.
2286 FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS
ing sequences from the zebrafish lens. One, zfcMX, is
cM-like in terms of length and overall structure but
does not group convincingly with either cMorcA–F
subfamilies. Possibly this represents an ancestor of
both classes and a bridge between the c-crystallins with
N-terminal arms (cS and cN) and those with none.
The other unusual sequence is zfbcX. This protein
comes from a gene that is clearly of the b-type (with
individual exons for each bc motif) but, in contrast
with other members of this family, the protein is not
orthologous to any other b-crystallin. In blast
searches, this protein sequence gives a slightly closer
match to cN sequences than to others, but is essen-
tially an outlier from both b and c families.
Overall, these data show a broader and more com-
plex view of the evolution of the bc superfamily in
the vertebrate eye and the adaptive ‘choices’ made in
different lineages. This dynamic evolutionary history
of b and c crystallins is part of the remarkably varied
history of molecular modification of the lens in ter-
restrial vertebrates through the direct gene recruit-

ment of existing proteins, usually enzymes, as
crystallins in different lineages [16]. This leads to the
question of the functional origin of the b and c crys-
tallins themselves. Connections with stress response or
with maintenance of cell structure have been sugges-
ted, but these are still speculative [8,16]. b-Crystallins
seem to represent the oldest branch, retaining the
ancient similarity in gene structure to AIM1 [8].
c-Crystallins may be eye-specific adaptations of
b-crystallins, initially with roles in the retina, later
being recruited to the newly evolving lens. Serial evo-
lutionary events led to the diversification, specializa-
tion, extinction and even re-invention of c-crystallin
families to suit the needs of different vertebrate lines.
Primates seem to be at the cutting edge of this pro-
cess at the present time, with modification and per-
haps loss of the ancient cN family as a relatively
recent, lineage-specific event. A deeper understanding
of the role of cN may therefore shed light on specific
processes in the primate eye that differ from those in
other mammals.
Experimental procedures
cDNA libraries and sequencing
Approximately 100 eyes from adult C57Bl ⁄ 6 mice were
extracted with RNAzol (Tel.Test Inc., Friendswood, TX,
USA), yielding 2 mg total RNA. Poly(A)-rich RNA cDNA
(38 lg) was prepared by oligo(dT)-cellulose affinity chroma-
tography, of which 5 lg was used to synthesize cDNA
using the Superscript II systems and directional cloning in
the SalI ⁄ NotI sites of the pSport1 vector (Invitrogen, Carls-

bad, CA, USA), essentially as described previously [27,51].
The unamplified library was cloned as two sublibraries, des-
ignated io and ip, which were combined for subsequent
sequence analysis.
In addition, to reduce the content of highly abundant
clones, libraries were constructed using two PCR suppres-
sion ‘equalization’ methods. The first procedure [52] gave
rise to three subfractions (ja, jb, jc) which were similar in
content and were pooled for further analysis, while the sec-
ond procedure [53] similarly produced two pooled subli-
braries (lg, lh). All mouse libraries were constructed at
Bioserve Biotechnologies (Laurel, MD, USA).
For zebrafish (Danio rerio) a total of 500 lenses were dis-
sected from 1-year-old AB wild-type fish raised at the Uni-
versity of Notre Dame. Lenses were stabilized in RNAlater
(Ambion, Austin, TX, USA) upon dissection. RNA was
extracted and poly(A)-rich RNA was isolated as above.
From this, 490 lg total RNA and 4.7 lg poly(A)-rich
RNA were obtained. cDNA was synthesized and cloned
into pCMVSport6, as described previously [27].
For iguana (Iguana iguana), a cDNA library was con-
structed from 75 ng total RNA, extracted from two lenses
from a single adult, at Bioserve Biotechnologies. The
cDNA was synthesized according to the manufacturer’s
protocol for SMART cDNA synthesis by LD PCR (BD
Biosciences Clontech, Palo Alto, CA, USA). LD PCR was
optimized at 18 cycles using the 5¢ PCR and CDS III ⁄ 3¢
PCR primers. cDNA was digested with SFI I, run on
a Croma spin 400 column and cloned into the plasmid
pTriplEx2.

A kangaroo (Macropus fuliginosus) lens cDNA library in
kZap was described previously [31]. Mass excision of pBlue-
script II was performed, following the manufacturer’s
instruction (Stratagene Systems, La Jolla, CA, USA) to
generate plasmid suitable for high throughput sequencing.
For all libraries, clones were randomly selected for
sequencing at the NIH Intramural Sequencing Center, as
described previously [27].
The GeneTrapper method (Invitrogen) was used to
screen a full-length cDNA library from human testis at Life
Technologies (now Invitrogen). Libraries were screened for
human cN-crystallin expression by PCR, using these prim-
ers: NgcdsA, TCTCTATGAAGGCAAGCACTTCACAGG;
NgcdsB, CCGTCCCCGTACACCTTGATGGTGTTC. The
following oligonucleotides were used as bait to hybridize
clones from the positive library: Hngtrap1, ATGAACCGA
GTGAACTCCATCCAC; Hngtrap2, ACTTCTTCCGCTG
GAACAGCCACA. The resultant clones were sequenced
in-house, using the CEQ2000 system (Beckman Coulter,
Fullerton, CA, USA).
All use of animals complied with the ARVO Statement
for the Use of Animals in Ophthalmic and Vision Research
and the Intramural Animal Care and Use program of the
National Institutes of Health (NIH).
G. Wistow et al. cN-crystallin
FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS 2287
PCR methods
Samples of complete cDNA libraries (lens [27], retina [51]
or RPE [54]) representing at least one million primary
clones were amplified and plasmid was isolated using

reagents from Qiagen (Valencia, CA, USA). Fragments
were amplified from these library templates using either
Taq (Roche, Indianapolis, IN, USA) or Elongase (Life
Technologies, Gaithersburg, MD, USA) polymerase sys-
tems and following the manufacturer’s protocols. PCR pri-
mers located in the second and third exons of the human
CRYGN gene were used for amplification: NgcdsA, TCTC
TATGAAGGCAAGCACTTCACAGG; NgcdsB, CCGTC
CCCGTACACCTTGATGGTGTTC. Bands were only
obtained from the RPE library template.
Northern blot
The multi-tissue mouse northern blot was purchased from
Seegene (Seoul, Korea). The multi-tissue rat northern blot
was prepared as described previously [55]. A cDNA insert
for mouse cN was obtained from the whole eye library and
labeled using the Prime-it II kit (Stratagene) and
[
32
P]dCTP. Blots were prehybridized in Hybrisol II (Oncor,
Gaithersburg, MD, USA) for 4 h, followed by hybridiza-
tion with the specific radiolabeled cDNA probe at 63 °C
for 18 h. Membranes were washed in 0.2 · NaCl ⁄ Cit ⁄ 0.1%
(v ⁄ v) SDS at 63 °C and exposed to Kodax XAR or BMR
photographic film for various lengths of time at )70 °C.
Bioinformatics
Sequence data from the EST analysis of all libraries were
processed for quality and to remove vector and other non-
cDNA sequences using phred [56], RepeatMasker (A. Smit
and P. Green) and CrossMatch (P. Green) as described pre-
viously [57]. Insert sequences were analyzed using grist

[58] to group and identify sequences according to blast
[59] matches to the databases and self matches.
Human and chimp cN and chicken crystallin sequences
were identified from genome sequence using blast searches
at NCBI () and blat [60] searches
at UCSC (). Small upstream coding
exons not detectable by blat were located by inspection.
Cladistic analysis used the program mega [30]. For this
procedure, gaps and missing data were handled by pairwise
deletion, Poisson correction was applied, and the neighbor-
joining option was used to generate trees of related sequen-
ces. Phylogeny was tested by 650 bootstrap replications.
Antibody and immunochemical methods
A mouse cN peptide, CRPVGMHGEHFRID, that was
predicted to be antigenic and to discriminate among related
proteins was synthesized at Biosource (Hopkinton, MA,
USA), conjugated to carrier, and used to immunize rabbits.
The most potent bleeds were selected and subjected to affin-
ity purification at Biosource.
For localization of cN on 2D electrophoresis gels, soluble
lens proteins from newborn C57Bl ⁄ 6 mice were isolated,
separated on 10-cm pH 5–9 immobilized pH gradient gels
in the first dimension, and 12% BisTris Criterion XT pre-
cast gels (Bio-Rad, Hercules, CA, USA) in the second
dimension as previously described [61] except that 240 lL
reswelling solution containing 50 lg protein was used.
Proteins were transferred to poly(vinylidene difluoride)
membranes, reversibly stained with Ponceau S, and photo-
graphed. Blots were processed by following the protocols of
the Immuno-Blot AP Assay Kit With BCIP ⁄ NBT (Bio-

Rad) and were incubated with primary antibody (1 : 1000)
for 1 h at room temperature.
Immunofluorescence localization
Frozen sections (10 lm) from 2-day-old mouse eye were
used for immunofluorescence staining. Sections on Super-
frost ⁄ Plus slides (Daigger, Wheeling, IL, USA) were dried
at room temperature, fixed in 4% paraformaldehyde in
NaCl ⁄ P
i
for 10 min, washed, permeabilized in 0.25% Tri-
ton X-100 in NaCl ⁄ P
i
for 10 min, and incubated for 1 h at
room temperature in NaCl ⁄ P
i
⁄ 5% (v ⁄ v) goat serum block-
ing buffer. Slides were incubated with primary antibody
(1 : 300 dilution) overnight at 4 °C, washed, and incubated
with goat anti-rabbit Alexa Fluor 488 antibody (Molecular
Probes, Eugene, OR, USA; 1 : 400 dilution) for 1 h at
room temperature. After being washed, the slides were
incubated with DAPI (D-3571; Molecular Probes; 1 : 2500
dilution) for 10 min, washed, cover-slipped, and sealed.
Samples were examined under a Zeiss AxioPlan 2 micro-
scope with epifluorescence. Images were captured with a
CCD camera (Opelco, Sterling, VA, USA) with excitation
of 470 ⁄ 40 nm and emission of 525 ⁄ 50 nm. For controls, no
primary antibody was used.
MS identification of mouse lens cN
A 400 l g portion of soluble lens proteins from C57Bl ⁄ 6

mice was separated by 2D electrophoresis as described pre-
viously [41]. After staining with Coomassie Blue, a spot
corresponding in position to the positive reaction with cN
antibody was excised, digested with trypsin, and analyzed
by LC ⁄ MS as described previously [62]. Peptide sequences
were matched to MS ⁄ MS spectra using sequest software
[63] (ThermoFinningan, San Jose, CA, USA) and mouse
sequences from Swiss-Prot (Release 42.0, October 2003:
Swiss Institute of Bioinformatics, Geneva, Switzerland)
with the addition of mouse cN. Peptides identified by
Sequest were considered correct if the cross-correlation
cN-crystallin G. Wistow et al.
2288 FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS
scores (Xcorr) were greater than 1.5, 2.0, and 3 for the +1,
+2, and +3 ions.
Recombinant protein
The coding sequence of mouse cN was cloned by PCR from
cDNA template, confirmed by sequencing and cloned into
NdeI ⁄ XhoI sites of pET31b (Novagen, Madison, WI, USA).
The plasmid was transformed into Escherichia coli
BL21(DE3) pLysS (Novagen). Induction yielded high expres-
sion of cN. Pellets were resuspended in Bugbuster (Novagen;
10 mL per pellet from 500 mL culture), and stored at )20 °C
after the addition of 5 lL Pefabloc (Roche Biochemicals,
Indianapolis, IN, USA).
For protein isolation, pellet was thawed and incubated with
10 lL Benzonase (Novagen) for 30 min at room temperature.
Sonication followed by centrifugation at 12 000 g for 20 min
at 4 °C removed remaining solid material. The supernatant
was loaded on to a HiPrep 16 ⁄ 10 Q FF column (GE Health)

run in 25 mm Tris ⁄ HCl (pH 7.5)⁄ 1mm dithiothreitol (buffer
A) and eluted with a linear gradient of buffer B (buffer
A ⁄ 1 m NaCl). Recombinant mouse cN was eluted as a single
major peak around 20% buffer B. Protein identity was
checked by electrospray MS (Micromass, Cheshire, UK).
Protein concentration was estimated from a calculated
absorption coefficient of 1.76 for a 1 mgÆmL
)1
protein solu-
tion measured at 280 nm in a 1 cm cell.
Recombinant human cD-crystallin protein was purified
by anion-exchange and cation-exchange chromatography as
described previously [64]. Protein for the unfolding study
was subjected to a supplementary gel-filtration step in order
to match the solution conditions of cN.
Size determination of mouse cN
The size was determined by two methods. After anion-
exchange chromatography, a 200-lL sample of cN
(2 mgÆmL
)1
) was subjected to analytical gel filtration on a
Superose 12 HR 10 ⁄ 30 column, with elution in buffer com-
prising 25 mm BisTris ⁄ propane, 100 mm KCl, pH 7.0, and
0.02% (w ⁄ v) NaN
3
. A 200-lL sample of human cD-crystal-
lin at 2.6 mgÆmL
)1
was eluted using the same conditions.
The size was also measured by light scattering, in which

case further purification of cN was performed by prepara-
tive gel filtration. The peaks from several anion-exchange
runs (QFF) were batched, concentrated in an Amicon
Ultrafiltration cell fitted with a YM 10 membrane, and
loaded on to a HiPrep 16 ⁄ 60 Sephacryl S300 HR column
equlibrated in 25 mm Tris ⁄ HCl, pH 7.5, containing 250 mm
NaCl and 1 mm dithiothreitol. This protein was concentra-
ted to 5 mgÆmL
)1
, and the size estimated by light scattering
using a dp 801 right angle laser light scattering (RALLS)
instrument and a plot obtained from standard globular pro-
teins (DynaPro International, Milton Keynes, Bedfordshire,
UK).
Urea-induced unfolding
Solutions were prepared of recombinant mouse cN-crystal-
lin or human cD-crystallin at 0.2 mgÆmL
)1
in 25 mm
Tris ⁄ HCl, pH 7.5, containing 250 mm NaCl and 1 mm
dithiothreitol, ranging from 0 to 8 m urea in 1 m steps.
Solutions were incubated overnight at 4 °C and then equili-
brated to 21 °C before measurement of their fluorescence
spectra in a Hitachi F-2500 fluorescence spectrophotometer.
Each sample was excited at 280 nm and fluorescence emis-
sion was measured at 350 nm, the wavelength of maximum
difference between the folded and unfolded fluorescence
spectra. The excitation and emission slits were 10 nm, and
the samples were placed in 1-cm path-length cell (Helma
Ltd, Helma, NY, USA).

Acknowledgements
We particularly thank Dr Robert Skurla of Bioserve
Biotechnologies, for his expertise in cDNA library con-
struction, Michael Riviere and NEI Core Grant
EY10572, for 2D electrophoresis and MS analysis of
mouse cN digests, and Drs Gerry Bouffard and Alice
Young of the NIH Intramural Sequencing Center for
expert high-throughput sequencing.
References
1 Jaworski C & Wistow G (1996) LP2, a differentiation-
associated lipid-binding protein expressed in bovine lens.
Biochem J 320, 49–54.
2 Sinha D, Esumi N, Jaworski C, Kozak CA, Pierce E &
Wistow G (1998) Cloning and mapping the mouse
Crygs gene and non-lens expression of [gamma]S-crys-
tallin. Mol Vis 4,8.
3 Wistow G (1995) Molecular Biology and Evolution of
Crystallins: Gene Recruitment and Multifunctional Pro-
teins in the Eye Lens. R.G. Landes Company, Austin, TX.
4 Lubsen NHM, Aarts HJ & Schoenmakers JGG (1988)
The evolution of lenticular proteins: the beta- and
gamma-crystallin super gene family. Prog Biophys Mol
Biol 51, 47–76.
5 Xi J, Farjo R, Yoshida S, Kern TS, Swaroop A & And-
ley UP (2003) A comprehensive analysis of the expres-
sion of crystallins in mouse retina. Mol Vis 9, 410–419.
6 Jones SE, Jomary C, Grist J, Makwana J & Neal MJ
(1999) Retinal expression of gamma-crystallins in the
mouse. Invest Ophthalmol Vis Sci 40, 3017–3020.
7 Wistow G, Summers L & Blundell T (1985) Myxococcus

xanthus spore coat protein S may have a similar struc-
ture to vertebrate lens beta gamma-crystallins. Nature
315, 771–773.
8 Ray ME, Wistow G, Su YA, Meltzer PS & Trent JM
(1997) AIM1, a novel non-lens member of the beta-
G. Wistow et al. cN-crystallin
FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS 2289
gamma-crystallin superfamily, is associated with the
control of tumorigenicity in human malignant mela-
noma. Proc Natl Acad Sci USA 94, 3229–3234.
9 Teichmann U, Ray ME, Ellison J, Graham C, Wistow
G, Meltzer PS, Trent JM & Pavan WJ (1998) Cloning
and tissue expression of the mouse ortholog of AIM1, a
betagamma-crystallin superfamily member. Mamm Gen-
ome 9, 715–720.
10 Wistow GJ & Piatigorsky J (1988) Lens crystallins: the
evolution and expression of proteins for a highly specia-
lized tissue. Annu Rev Biochem 57, 479–504.
11 de Jong WW & Bloemendal H (1981) Evolution of lens
and crystallins. In Evolution of Lens and Crystallins in
Molecular and Cellular Biology of the Eye Lens, pp.
221–278. Wiley-Interscience, New York.
12 Head MW, Sedowofia K & Clayton RM (1995) b B2-
crystallin in the mammalian retina. Exp Eye Res 61,
423–428.
13 Crabb JW, Miyagi M, Gu X, Shadrach K, West KA,
Sakaguchi H, Kamei M, Hasan A, Yan L, Rayborn
ME, Salomon RG & Hollyfield JG (2002) Drusen pro-
teome analysis: an approach to the etiology of age-
related macular degeneration. Proc Natl Acad Sci USA

99, 14682–14687.
14 Slingsby C & Clout NJ (1999) Structure of the crystal-
lins. Eye 13, 395–402.
15 Brakenhoff RH, Aarts HJ, Reek FH, Lubsen NH &
Schoenmakers JG (1990) Human gamma-crystallin
genes. A gene family on its way to extinction. J Mol
Biol 216, 519–532.
16 Wistow G (1993) Lens crystallins: gene recruitment and
evolutionary dynamism. Trends Biochem Sci 18, 301–306.
17 Gause GG Jr, Tomarev SI, Zinovieva RD, Arutyunyan
KG, Dolgilevich SM & Duncan G (1985) Crystallin
sequences of the frog Rana temporaria.InTopics in Aging
Research in Europe. The Lens: Transparency and Catar-
act, pp. 171–179. Eurage, Rijswijk, the Netherlands.
18 Wistow G (1995) Peptide sequences for beta-crystallins
of a teleost fish. Mol Vis 1,1.
19 Pan FM, Chang WC, Lu SF, Hsu AL & Chiou SH
(1995) Sequence analysis of one major basic beta-crys-
tallin (beta Bp) of amphibian lenses: evolutionary com-
parison and phylogenetic relatedness between beta- and
gamma-crystallins. Biochem Biophys Res Commun 217,
940–949.
20 Duncan MK, Banerjee-Basu S, McDermott JB & Piati-
gorsky J (1996) Sequence and expression of chicken beta
A2- and beta B3-crystallins. Exp Eye Res 62, 111–119.
21 Chang T, Lin CL, Chen PH & Chang WC (1991)
Gamma-crystallin genes in carp: cloning and characteri-
zation. Biochim Biophys Acta 1090, 261–264.
22 Chen JY, Chang BE, Chen YH, Lin CJ, Wu JL & Kuo
CM (2001) Molecular cloning, developmental expres-

sion, and hormonal regulation of zebrafish (Danio rerio)
beta crystallin B1, a member of the superfamily of beta
crystallin proteins. Biochem Biophys Res Commun 285,
105–110.
23 Berbers GA, Hoekman WA, Bloemendal H, de Jong
WW, Kleinschmidt T & Braunitzer G (1984) Homology
between the primary structures of the major bovine
b-crystallin chains. Eur J Biochem 139, 467–479.
24 Wistow G, Anderson A & Piatigorsky J (1990) Evidence
for neutral and selective processes in the recruitment of
enzyme-crystallins in avian lenses. Proc Natl Acad Sci
USA 87, 6277–6280.
25 Piatigorsky J, O’Brien WE, Norman BL, Kalumuck K,
Wistow GJ, Borras T, Nickerson JM & Wawrousek EF
(1988) Gene sharing by delta-crystallin and argininosuc-
cinate lyase. Proc Natl Acad Sci USA 85, 3479–3483.
26 Wistow GJ, Mulders JW & de Jong WW (1987) The
enzyme lactate dehydrogenase as a structural protein in
avian and crocodilian lenses. Nature 326, 622–624.
27 Wistow G, Bernstein SL, Wyatt MK, Behal A, Touchman
JW, Bouffard G, Smith D & Peterson K (2002) Expressed
sequence tag analysis of adult human lens for the NEI-
Bank Project: over 2000 non-redundant transcripts, novel
genes and splice variants. Mol Vis 8, 171–184.
28 van Rens GL, Raats JM, Driessen HP, Oldenburg M,
Wijnen JT, Khan PM, de Jong WW & Bloemendal H
(1989) Structure of the bovine eye lens gamma s-crystal-
lin gene (formerly beta s). Gene 78, 225–233.
29 Wistow G, Sardarian L, Gan W & Wyatt MK (2000)
The human gene for gammaS-crystallin: alternative

transcripts and expressed sequences from the first
intron. Mol Vis 6, 79–84.
30 Kumar S, Tamura K & Nei M (1994) MEGA: Molecu-
lar Evolutionary Genetics Analysis software for micro-
computers. Comput Appl Biosci 10, 189–191.
31 Kim RY, Gasser R & Wistow GJ (1992) mu-crystallin
is a mammalian homologue of Agrobacterium ornithine
cyclodeaminase and is expressed in human retina. Proc
Natl Acad Sci USA 89, 9292–9296.
32 Chang T, Jiang YJ, Chiou SH & Chang WC (1988)
Carp gamma-crystallins with high methionine content:
cloning and sequencing of the complementary DNA.
Biochim Biophys Acta 951, 226–229.
33 Harding JJ & Crabbe MJC (1984) The lens: development,
proteins, metabolism and cataract. In The Eye (Davson
H, ed.), pp. 207–492. Academic Press, New York.
34 Treton JA, Jones RE, King CR & Piatigorsky J (1984)
Evidence against gamma-crystallin DNA or RNA
sequences in the chick. Exp Eye Res 39, 513–522.
35 van Rens GL, de Jong WW & Bloemendal H (1991) One
member of the gamma-crystallin gene family, gamma s,
is expressed in birds [letter]. Exp Eye Res 53, 135–138.
36 Bateman OA, Lubsen NH & Slingsby C (2001) Associa-
tion behaviour of human betaB1-crystallin and its trun-
cated forms. Exp Eye Res 73, 321–331.
37 Lampi KJ, Oxford JT, Bachinger HP, Shearer TR,
David LL & Kapfer DM (2001) Deamidation of human
cN-crystallin G. Wistow et al.
2290 FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS
beta B1 alters the elongated structure of the dimer. Exp

Eye Res 72, 279–288.
38 Broide ML, Berland CR, Pande J, Ogun OO & Benedek
GB (1991) Binary-liquid phase separation of lens pro-
tein solutions. Proc Natl Acad Sci USA 88, 5660–5664.
39 Bloemendal H, De Jong W, Jaenicke R, Lubsen NH,
Slingsby C & Tardieu A (2004) Ageing and vision:
structure, stability and function of lens crystallins. Prog
Biophys Mol Biol 86, 407–485.
40 Kosinski-Collins MS, Flaugh SL & King J (2004) Prob-
ing folding and fluorescence quenching in human gam-
maD crystallin Greek key domains using triple
tryptophan mutant proteins. Protein Sci 13, 2223–2235.
41 Ueda Y, Duncan MK & David LL (2002) Lens proteo-
mics: the accumulation of crystallin modifications in the
mouse lens with age. Invest Ophthalmol Vis Sci 43,
205–215.
42 Lu SF, Pan FM & Chiou SH (1996) Characterization of
gamma-crystallin from the eye lens of bullfrog: com-
plexity of gamma-crystallin multigene family as revealed
by sequence comparison among different amphibian
species. J Protein Chem 15, 103–113.
43 Venkatesh B (2003) Evolution and diversity of fish
genomes. Curr Opin Genet Dev 13, 588–592.
44 Wistow G (1990) Evolution of a protein superfamily:
relationships between vertebrate lens crystallins and
microorganism dormancy proteins. J Mol Evol 30, 140–
145.
45 D’Alessio G (2002) The evolution of monomeric and
oligomeric betagamma-type crystallins. Facts and hypo-
theses. Eur J Biochem 269, 3122–3130.

46 Roy SW, Fedorov A & Gilbert W (2003) Large-scale
comparison of intron positions in mammalian genes
shows intron loss but no gain. Proc Natl Acad Sci USA
100, 7158–7162.
47 Siezen RJ, Wu E, Kaplan ED, Thomson JA & Benedek
GB (1988) Rat lens gamma-crystallins. Characterization
of the six gene product and their spatial and temporal
distribution resulting from differential synthesis. J Mol
Biol 199, 475–490.
48 Wohabrebbi A, Umstot ES, Iannaccone A, Desiderio
DM & Jablonski MM (2002) Downregulation of a
unique photoreceptor protein correlates with improper
outer segment assembly. J Neurosci Res 67, 298–308.
49 Land MF & Fernald RD (1992) The evolution of eyes.
Annu Rev Neurosci 15, 1–29.
50 Wistow G, Turnell B, Summers L, Slingsby C, Moss D,
Miller L, Lindley P & Blundell T (1983) X-ray analysis
of the eye lens protein gamma-II crystallin at 1.9 A
˚
resolution. J Mol Biol 170, 175–202.
51 Wistow G, Bernstein SL, Wyatt MK, Ray S, Behal
A, Touchman JW, Bouffard G, Smith D & Peterson
K (2002) Expressed sequence tag analysis of human
retina for the NEIBank Project: retbindin, an abun-
dant, novel retinal cDNA and alternative splicing of
other retina-preferred gene transcripts. Mol Vis 8,
196–204.
52 Luk’ianov KA, Gurskaia IG, Matts MV, Khaspekov GL,
D’Iachenko LB, Chenchik AA, Il’evich-Stuchkov SG &
Luk’ianov SA (1996) [A method for obtaining the nor-

malized cDNA libraries based on the effect of suppression
of polymerase chain reaction]. Bioorg Khim 22, 686–690.
53 Sasaki YF, Ayusawa D & Oishi M (1994) Construction
of a normalized cDNA library by introduction of a
semi-solid mRNA–cDNA hybridization system. Nucleic
Acids Res 22, 987–992.
54 Wistow G, Bernstein SL, Wyatt MK, Fariss RN, Behal
A, Touchman JW, Bouffard G, Smith D & Peterson K
(2002) Expressed sequence tag analysis of human
RPE ⁄ choroid for the NEIBank Project: over 6000 non-
redundant transcripts, novel genes and splice variants.
Mol Vis 8, 205–220.
55 Bernstein SL & Wong P (1998) Regional expression of
disease-related genes in human and monkey retina. Mol
Vis 4, 24.
56 Ewing B & Green P (1998) Base-calling of automated
sequencer traces using phred. II. Error probabilities.
Genome Res 8, 186–194.
57 Bouffard GG, Iyer LM, Idol JR, Braden VV, Cunning-
ham AF, Weintraub LA, Mohr-Tidwell RM, Peluso
DC, Fulton RS, Leckie MP & Green ED (1997) A col-
lection of 1814 human chromosome 7-specific STSs.
Genome Res 7, 59–64.
58 Wistow G, Bernstein SL, Touchman JW, Bouffard G,
Wyatt MK, Peterson K, Behal A, Gao J, Buchoff P &
Smith D (2002) Grouping and identification of sequence
tags (GRIST): bioinformatics tools for the NEIBank
database. Mol Vis 8 , 164–170.
59 Altschul SF, Gish W, Miller W, Myers EW & Lipman
DJ (1990) Basic local alignment search tool. J Mol Biol

215, 403–410.
60 Kent WJ (2002) BLAT: the BLAST-like alignment tool.
Genome Res 12, 656–664.
61 Lampi KJ, Shih M, Ueda Y, Shearer TR & David LL
(2002) Lens proteomics: analysis of rat crystallin
sequences and two-dimensional electrophoresis map.
Invest Ophthalmol Vis Sci 43, 216–224.
62 Wilmarth PA, Taube JR, Riviere MA, Duncan MK &
David LL (2004) Proteomic and sequence analysis of
chicken lens crystallins reveals alternate splicing and
translational forms of beta B2 and beta A2 crystallins.
Invest Ophthalmol Vis Sci 45, 2705–2715.
63 Yates JR, 3rd Eng JK, McCormack AL & Schieltz D
(1995) Method to correlate tandem mass spectra of
modified peptides to amino acid sequences in the pro-
tein database. Anal Chem 67, 1426–1436.
64 Evans P, Wyatt K, Wistow GJ, Bateman OA, Wallace
BA & Slingsby C (2004) The P23T cataract mutation
causes loss of solubility of folded gammaD-crystallin.
J Mol Biol 343, 435–444.
G. Wistow et al. cN-crystallin
FEBS Journal 272 (2005) 2276–2291 ª 2005 FEBS 2291