Tài liệu Báo cáo khoa học: Electron transfer chain reaction of the extracellular flavocytochrome cellobiose dehydrogenase from the basidiomycete Phanerochaete chrysosporium doc

Electron transfer chain reaction of the extracellular
flavocytochrome cellobiose dehydrogenase from the
basidiomycete Phanerochaete chrysosporium
Kiyohiko Igarashi
1
, Makoto Yoshida
1
, Hirotoshi Matsumura
2
, Nobuhumi Nakamura
2
,
Hiroyuki Ohno
2
, Masahiro Samejima
1
and Takeshi Nishino
3
1 Department of Biomaterials Sciences, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Japan
2 Department of Biotechnology, Tokyo University of Agricultural and Technology, Japan
3 Department of Biochemistry and Molecular Biology, Nippon Medical School, Tokyo, Japan
Cellulose is the most abundant natural polymer on
earth, and its degradation is thus an important compo-
nent of the carbon cycle. Although cellulose is often
referred to as a b-linked glucose polymer, cellobiose, a
b-1,4-linked glucose dimer, should strictly be regarded
as the repeating unit of cellulose, because adjacent
glucoses show opposing faces to each other in the cel-
lulose chain [1,2]. Many microorganisms recognize this
repeating unit and hydrolyze cellulose to cellobiose as
an initial step in the metabolism [3]. In filamentous

fungi, cellulose degradation had been thought to pro-
ceed via two-step hydrolysis, i.e. cellulose is hydrolyzed
to cellobiose by various cellulases and the product is
further hydrolyzed to glucose by b-glucosidase. How-
ever, recent cytochemical, kinetic, and transcriptional
studies [4–6] have supported another hypothesis
Keywords
cellobiose dehydrogenase; cellulose
degradation; electron-transfer;
Phanerochaete chrysosporium
Correspondence
K. Igarashi, Department of Biomaterials
Sciences, Graduate School of Agricultural
and Life Sciences, The University of Tokyo,
Bunkyo-ku, Tokyo 113-8657, Japan
Fax: +81 3 5841 5273
Tel: +81 3 5841 5258
E-mail:
(Received 27 February 2005, revised
26 March 2005, accepted 6 April 2005)
doi:10.1111/j.1742-4658.2005.04707.x
Cellobiose dehydrogenase (CDH) is an extracellular flavocytochrome con-
taining flavin and b-type heme, and plays a key role in cellulose degrada-
tion by filamentous fungi. To investigate intermolecular electron transfer
from CDH to cytochrome c, Phe166, which is located in the cytochrome
domain and approaches one of propionates of heme, was mutated to Tyr,
and the thermodynamic and kinetic properties of the mutant (F166Y) were
compared with those of the wild-type (WT) enzyme. The mid-point
potential of heme in F166Y was measured by cyclic voltammetry, and was
estimated to be 25 mV lower than that of WT at pH 4.0. Although pre-

steady-state reduction of flavin was not affected by the mutation, the rate
of subsequent electron transfer from flavin to heme was halved in F166Y.
When WT or F166Y was reduced with cellobiose and then mixed with
cytochrome c, heme re-oxidation and cytochrome c reduction occurred syn-
chronously, suggesting that the initial electron is transferred from reduced
heme to cytochrome c. Moreover, in both enzymes the observed rate of
the initial phase of cytochrome c reduction was concentration dependent,
whereas the second phase of cytochrome c reduction was dependent on the
rate of electron transfer from flavin to heme, but not on the cytochrome c
concentration. In addition, the electron transfer rate from flavin to heme
was identical to the steady-state reduction rate of cytochrome c in both
WT and F166Y. These results clearly indicate that the first and second
electrons of two-electron-reduced CDH are both transferred via heme, and
that the redox reaction of CDH involves an electron-transfer chain mech-
anism in cytochrome c reduction.
Abbreviations
CDH, cellobiose dehydrogenase; F166Y, Phe166Tyr mutant CDH; NHE, normal hydrogen electrode; WT, wild-type CDH.
FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS 2869
concerning the contribution of cellobiose dehydroge-
nase (CDH; EC 1.1.99.18) to the extracellular cellulose
metabolism of the white-rot fungus Phanerochaete
chrysosporium, and the importance of a combination
of hydrolytic and oxidative reactions in cellulose-
degrading fungi as discussed previously [7–13].
CDH is the only extracellular flavocytochrome
known to be secreted by filamentous fungi during cel-
lulose degradation [11–13]. This enzyme carries flavin
and a b-type heme in different domains, and the flavin
domain catalyzes the dehydrogenation of cellobiose
and cello-oligosaccharides to the corresponding d-lac-

tones [8,9,14,15]. Although this enzyme was initially
characterized as an oxidase (cellobiose oxidase;
EC 1.1.3.25) [8], its higher affinity for quinones and
ferric compounds than for oxygen [16–18] and the low-
spin character of the heme in both the ferric and fer-
rous states [19] indicate that the electron acceptor of
this enzyme is not molecular oxygen. Although many
candidates have been proposed for the electron accep-
tor of CDH, its natural electron acceptor and the phy-
siological function of the oxidative half reaction of this
enzyme are still uncertain.
In a previous kinetic study, we showed the pre-
steady-state two-electron reduction of flavin, followed
by interdomain one-electron transfer from flavin to
heme, resulting in the formation of the flavin semi-
quinone radical and reduced heme [20]. In order to
achieve full understanding of the redox reaction of
CDH, the reduction mechanism of the electron accep-
tor should be clarified. However, several groups have
proposed two possible mechanisms for this reaction;
electron transfer chain and electron sink mechanisms
[21–23]. In the putative electron transfer chain reac-
tion, ferric compounds such as cytochrome c are
reduced by heme after one-electron transfer from fla-
vin, whereas the flavin radical or fully reduced flavin is
an electron donor in the electron sink mechanism. In
this study, Phe166, which approaches heme propion-
ate, as shown in Fig. 1, was mutated to Tyr, and the
slow interdomain electron transfer mutant F166Y was
produced using the heterologous expression system of

Pichia pastoris. Presteady-state reduction of cyto-
chrome c and re-oxidation of heme in the recombinant
wild-type (WT) and mutant enzymes were observed by
sequential mixing in a three-syringe stopped-flow spec-
trophotometer to clarify the redox mechanism of
CDH.
Results
Redox properties of WT and F166Y CDH
The redox potentials of WT and F166Y were com-
pared at various pH values, as shown in Fig. 2A. The
potential of F166Y was lower than that of WT at all
pH values, but the difference was larger at lower pH
than at neutral pH. The potentials of WT and F166Y
were estimated to be 176 and 151 mV vs. normal
hydrogen electrode (NHE) at pH 4.0. Although the
potential of F166Y is 25 mV lower than that of WT, it
is still high enough to receive the electron from
reduced flavin, because addition of cellobiose causes
spectral changes in F166Y from the oxidized to the
reduced form (Fig. 2B). Reduced F166Y has typical
absorption maxima of CDH at 562, 533 and 428 nm
due to a-, b- and c-(Soret) bands, respectively, and
the absorption decreased at around 480 nm mainly
because of flavin reduction. These results are essen-
tially the same as those for the WT enzyme [24] and
suggest that both flavin and heme are active in the
mutant enzyme.
Presteady-state and steady-state kinetics
of F166Y
The presteady-state reduction of flavin and the subse-

quent electron transfer from flavin to heme in WT and
F166Y were observed by stopped-flow spectrophoto-
metry (Fig. 3). The addition of cellobiose caused rapid
reduction of flavin, and the absorption at the isosbestic
point of heme (449.0 nm) decreased similarly in both
Fig. 1. Stereo representation of the heme in
CDH and the amino acids within 4 A
˚
of the
heme. Heme and Phe166 are indicated in
color. The model was generated from PDB
1D7C [35] using the software
PYMOL
(DeLano Scientific LLC, San Francisco, CA,
USA).
Electron transfer chain reaction of CDH K. Igarashi et al.
2870 FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS
WT and F166Y (Fig. 3A). The observed rates (k
obs
)of
WT and F166Y reduction were 53.0 ± 1.0 and
50.0 ± 1.3 s
)1
, respectively. In contrast, an apparent
difference in heme reduction was observed between
WT and F166Y, as shown in Fig. 3B. In WT CDH,
 90% of heme was reduced within 0.1 s, whereas in
F166Y, 13% of heme was still in the oxidized form at
0.2 s after mixing with the substrate. The k
obs

values
for heme reduction of WT and F166Y were
30.2 ± 1.2 and 12.5 ± 0.9 s
)1
, respectively. These
results suggest that only the electron transfer step from
flavin to heme was halved in F166Y, whereas the ini-
tial flavin reduction was not affected by the muta-
tion. Presteady-state kinetic experiments for flavin and
heme reduction were carried out at various substrate
concentrations, as shown in Fig. 4. The k
obs
values for
flavin reduction were identical for WT and F166Y
(Fig. 4A), whereas those of heme reduction in F166Y
was almost half of that of WT at all substrate concen-
trations tested (Fig. 4B). The dissociation constants of
WT (K
WT
d
) and F166Y (K
F166Y
d
) obtained from the
plots were 107 ± 6.6 and 111 ± 6.5 lm, respectively.
As shown in a previous presteady-state kinetic study
of WT CDH, heme reduction was inhibited at high
substrate concentrations. In this study, this phenom-
A
B

Fig. 2. (A) pH dependence of the midpoint potential of heme in WT
(h) and F166Y (d). (B) Absorption spectra of oxidized (solid line)
and reduced (dotted line) forms of F166Y. Midpoint potentials of
heme in CDH were measured by cyclic voltammetry as described
in Experimental procedures. For the absorption spectra, 2.0 l
M
F166Y was scanned with or without 50 lM cellobiose in 50 mM
sodium acetate buffer, pH 4.0.
A
B
Fig. 3. Presteady-state reduction of WT and F166Y by cellobiose.
(A) Time courses of absorption at 449 nm for monitoring flavin
reduction. (B) Time courses of absorption at 562 nm for monitoring
heme reduction. Solid line, F166Y; dashed line, WT. CDH and cello-
biose (final concentrations of 5 and 100 l
M, respectively) were
mixed in 50 m
M sodium acetate buffer (pH 4.0), and the absorption
changes were monitored by stopped-flow photometry at 30 °C.
K. Igarashi et al. Electron transfer chain reaction of CDH
FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS 2871
enon was also observed in F166Y, and the sub-
strate inhibition constant of F166Y (K
F166Y
i
¼
1130 ± 130 lm) was similar to that of WT (K
WT
i
¼

1230 ± 180 lm), reflecting the similar K
d
values of the
two enzymes. The limiting rates of heme reduction for
WT (k
WT
lim
) and F166Y (k
F166Y
lim
) were 46.9 ± 6.8 and
18.8 ± 1.0 s
)1
, respectively.
The steady-state kinetic parameters are summarized
in Table 1. As expected from the presteady-state
experiment, there is no difference in these parameters
between WT and F166Y using ubiquinone as an
electron acceptor, whereas the mutation affected the
kinetic parameters when the redox reaction was mon-
itored in terms of cytochrome c reduction. The k
cat
values of cellobiose oxidation monitored in terms of
cytochrome c reduction were quite similar to the k
lim
values of heme reduction in both WT and F166Y.
Interestingly, an increase in cytochrome c concentra-
tion inhibited its reduction only in the case of
F166Y.
Sequential mixing experiment of WT and F166Y

To monitor the redox state of heme in CDH and cyto-
chrome c independently in the same reaction mixture,
the oxidized and reduced spectra of CDH and cyto-
chrome c were compared, as shown in Fig. 5. In each
hemoprotein, there are four isosbestic points in the
500–600 nm region, where the a- and b-bands of heme
absorb. We selected 549.0 and 556.7 nm to monitor
cytochrome c and heme in CDH, respectively, because
these gave the maximum absorption difference.
After the initial mixing of WT or F166Y with cello-
biose, cytochrome c was added to the reaction mixture
and the changes in absorption at 549.0 and 556.7 nm
were monitored (Fig. 6). The reduction of cyto-
chrome c and re-oxidation of heme in CDH were
observed synchronously, and the k
obs
values for cyto-
chrome c reduction by WT and F166Y were estima-
ted as 662 ± 17 and 643 ± 10 s
)1
, respectively
(Fig. 6A,C) i.e. almost the same value for the two
enzymes. The k
obs
values for the secondary phase,
however, were 27.7 ± 2.1 (WT) and 13.3 ± 4.1
(F166Y). These values are quite similar to those of
A
B
Fig. 4. Cellobiose concentration dependence of the observed rate

(k
obs
) for flavin (A) and heme (B) reduction in WT (s) and F166Y
(j). k
obs
values for both prosthetic groups were obtained under the
same conditions as in Fig. 3, using 25–500 l
M cellobiose as a sub-
strate. The fitting of the data was performed as described in
Experimental procedures.
Table 1. Steady-state kinetic constants for WT and F166Y. All measurements were carried out at 30 °Cin50mM sodium acetate buffer,
pH 4.0. Cellobiose oxidation was monitored by following the reduction of 1 m
M ubiquinone or 50 lM cytochrome c as described in Experi-
mental procedures. ND, no significant substrate inhibition was observed.
Cellobiose oxidation with electron acceptors
Ubiquinone Cytochrome c
Ubiquinone
reduction Cytochrome c reduction
K
m
(lM)
k
cat
(s
)1
)
K
m
(lM)
k

cat
(s
)1
)
K
i
(lM)
K
m
(lM)
k
cat
(s
)1
)
K
m
(lM)
k
cat
(s
)1
)
K
i
(lM)
WT 57.9 ± 7.1 40.1 ± 1.2 28.6 ± 1.6 43.5 ± 0.9 2510 ± 380 326 ± 35 44.2 ± 1.4 1.46 ± 0.12 37.2 ± 0.3 ND
F166Y 56.0 ± 5.5 36.8 ± 0.9 17.9 ± 3.0 19.2 ± 0.9 3540 ± 310 293 ± 16 46.4 ± 0.8 0.67 ± 0.11 19.0 ± 0.5 233 ± 42
Electron transfer chain reaction of CDH K. Igarashi et al.
2872 FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS

heme reduction in both enzymes at the same cellobiose
concentration. As shown in Fig. 6B,D, heme in WT
and F166Y remained oxidized during this phase, but
was re-reduced with reduction of cytochrome c. The
k
obs
of cytochrome c reduction depended on the con-
centration of cytochrome c in the region tested (5–
20 lm, data not shown), and was almost identical for
WT and F166Y with limiting values of 1460 ± 140
and 1380 ± 80 s
)1
, respectively.
Discussion
Two mechanisms, electron transfer chain and electron
sink, have been proposed for the redox reaction of
CDH, and several previous kinetic studies have attemp-
ted to clarify the overall reaction of this enzyme [21–23].
However, uncertainty remains, possibly because of the
special features of this enzyme. The optimum pH values
of flavin reduction by cellobiose (pH 4.5–5.0) and of
electron transfer from flavin to heme (pH 3.5–4.0) differ
from each other, and the rate-limiting step of the reac-
tion thus depends on the pH of the reaction mixture
[20,25]. Moreover, a higher concentration of substrate
(cellobiose) inhibits presteady-state heme reduction, but
not flavin reduction [20,26], suggesting that binding of
substrate to the active site of the flavin domain inhibits
electron transfer from flavin to heme. This phenomenon
makes it difficult to solve the redox mechanism of this

enzyme using kinetic results obtained with only WT
CDH. In this study, therefore, we compared the ther-
modynamic and kinetic features of recombinant WT
and the slow electron transfer mutant F166Y.
The presteady-state electron transfer from flavin to
heme was halved in F166Y compared with WT. This
was expected from the thermodynamic result that the
redox potential of heme in F166Y was lower than that
of WT. However, when the electron transfer rate k
(s
)1
) and the driving force DG (eV) were analyzed in
terms of electron transfer theory, which was recently
developed by Dutton’s group [27], the edge-to-edge
distance R and the reorganization energy k of F166Y
were higher than those of WT when one of these
parameters was fixed and used for the calculation (data
not shown). This indicates that the halved electron
transfer rate of F166Y is due not only to thermody-
namic factors, but also involves kinetic changes in this
mutant; for example, the change of Phe to Tyr may
change the charge of the protein surface, resulting in a
change in the interaction between the two domains.
This would produce a higher R or k value for F166Y
compared with the WT enzyme. That only F166Y
shows significant substrate (cytochrome c) inhibition
might be because of the weaker domain interaction of
this mutant enzyme. The F166Y mutant is, however,
useful for monitoring the electron transfer step of
CDH, because the mutation affects only the electron

transfer step from flavin to heme, but not initial flavin
reduction or cytochrome c reduction.
WT or F166Y was first mixed with cellobiose, and
then the cellobiose–CDH mixture was mixed with cyto-
chrome c after 0.1 s (WT) or 0.2 s (F166Y). At the
second mixing time,  90% of heme is in the ferrous
state and the flavin forms a semiquinone, as confirmed
A
B
Fig. 5. Absorption spectra of heme in CDH (A) and cytochrome c
(B) for comparison of the isosbestic points. The spectra of the oxi-
dized (solid line) and reduced (dashed line) forms are compared in
the range of 450–650 nm. Dotted lines at 549.0 (left) and 556.7
(right) show the isosbestic points of heme in CDH and cyto-
chrome c, respectively.
K. Igarashi et al. Electron transfer chain reaction of CDH
FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS 2873
previously by EPR [20], suggesting that most of the
enzyme is in the two-electron reduced form. In previous
studies, prereduced CDH was often used to observe the
electron transfer from heme to cytochrome c with cello-
biose or ascorbate as an electron donor [22,23,28]. With-
out a sequential mixing technique, however, it is difficult
to monitor cytochrome c reduction, because premixing
with the electron donors produces one- (ascorbate) or
three- (cellobiose) electron-reduced CDH, but not the
two-electron-reduced form with flavin radical and
reduced heme. Soon after the two-electron-reduced
CDH was mixed with cytochrome c, synchronous cyto-
chrome c reduction and re-oxidation of heme were

clearly observed in WT and F166Y with similar bio-
molecular rate constants (6 · 10
6
m
)1
Æs
)1
). This indicates
that, at the initial phase, the electron is transferred from
heme to cytochrome c. In contrast, the second phase of
cytochrome c reduction was not concentration depend-
ent, but depended on electron transfer from flavin to
heme. Considering that the k
cat
value for cytochrome c
reduction was almost identical to the k
lim
value for heme
reduction in both WT and F166Y, the two electrons in
reduced CDH are sequentially transferred from reduced
flavin to cytochrome c via heme. Cameron and Aust [22]
recently demonstrated that the reduction rate of cyto-
chrome c by fully (three-electron) reduced CDH was
lower than the rate under steady-state turnover, and
suggested that the flavin radical reduces cytochrome c.
AB
CD
Fig. 6. Time courses of redox state of heme in WT (A, B) and F166Y (C, D) after sequential mixing with cellobiose and cytochrome c.
Absorptions at 556.7 (solid line) and 549.0 (dashed line) nm were used for monitoring the heme in CDH and cytochrome c, respectively. WT
or F166Y (5 l

M) was mixed with 100 lM cellobiose, and 20 lM cytochrome c was then added and mixed after 0.1 s (WT) or 0.2 s (F166Y)
using a sequential mixing stopped-flow apparatus. The absorption changes were monitored after mixing with cytochrome c, and the initial
(0–0.020 s) and secondary (0–0.2 s) phase are seen in left (A, C) and right (B, D) panels, respectively. Conditions: 50 m
M sodium acetate buf-
fer (pH 4.0) at 30 °C.
Electron transfer chain reaction of CDH K. Igarashi et al.
2874 FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS
In the same report, moreover, they proposed that the
heme in CDH acts as an electron sink, because Rogers
and co-workers reported that heme is oxidized during
steady-state cytochrome c reduction [28]. Although this
phenomenon was also observed in the second phase of
presteady-state cytochrome c reduction, it is because of
the significant difference between the electron transfer
rate from flavin to heme (30 s
)1
) and that from heme to
cytochrome c ( 1500 s
)1
). After the electron is loaded
from flavin to heme, it is transferred to cytochrome c
without any significant time lag. Consequently, all the
results obtained in this study apparently indicate that
the overall redox reaction of CDH occurs through
the electron transfer chain mechanism, as shown in
Scheme 1.
Although this study clearly demonstrates an electron
transfer chain mechanism of CDH when cytochrome c
is used as an electron acceptor, it is too early to con-
clude that the mechanism is also used during cellulose

degradation by the fungus because its natural electron
acceptor is still uncertain. Considering the kinetic effi-
ciency of cytochrome c for CDH is quite high com-
pared with other ferric compounds, it is possible that
the filamentous fungi produce a cytochrome c-like
hemoprotein extracellularly and utilize it as an electron
acceptor of CDH. Indeed, there are several hypo-
thetical proteins with a secretion signal and a cyto-
chrome c-binding motif encoded in the total genome
sequence of P. chrysosporium [29]. To clarify the true
role of CDH, therefore, it is important to consider the
interaction with other extracellular redox proteins. As
demonstrated in our kinetic studies, including this
work, the redox reaction of CDH is regulated by
cellobiose concentration and pH at the interdomain
electron transfer step. This might provide a clue to
identify the redox system of CDH in vivo.
Experimental procedures
Materials
d-Cellobiose was purchased from ICN Biomedicals (Irvine,
CA, USA). Ubiquinone (2,3-dimethoxy-5-methyl-1,4-benzo-
quinone) and bovine heart cytochrome c were purchased
from Wako Pure Chemical Industries (Osaka, Japan). To
assess the pH dependence of the mid-point potential of heme,
50 mm buffers were used as described previously [20,30].
Steady-state enzyme assays
To obtain the steady-state kinetic parameters of cellobiose
oxidation, the reduction rate of 1 mm ubiquinone or 50 lm
cytochrome c was plotted against concentration of cello-
biose (0–1 mm). Reduction rates for ubiquinone and

cytochrome c were also measured at various concentrations
(0–1 mm for ubiquinone and 0–50 lm for cytochrome c)
using 500 lm cellobiose as a substrate. The reductions of
ubiquinone and cytochrome c were monitored photometri-
cally at 406 nm (De
406
¼ 0.745 mm
)1
cm
)1
) and 550 nm
(De
550
¼ 17.5 mm
)1
cm
)1
), respectively. Because apparent
substrate inhibition was observed when cytochrome c was
used as an electron acceptor, the obtained substrate
dependence plots were fitted to the Michaelis–Menten equa-
tion with a substrate inhibition constant (K
i
). Unless other-
wise noted, steady-state kinetic parameters (K
m
and k
cat
)
were estimated by nonlinear fitting of the data to the

Michaelis–Menten equation using deltagraph v. 5.5 (SPSS
Inc., Cary, NC, USA and Redrock Software, Inc., Salt
Lake City, UT, USA) and kaleidagraph v. 3.0.8 (Synergy
Software, Reading, PA, USA).
Preparation of wild-type CDH and F166Y mutant
Recombinant wild-type P. chrysosporium CDH was hetero-
logously expressed in the methylotropic yeast Pichia past-
oris and purified as described previously [24]. Site-directed
mutagenesis was carried out based on the overlap extension
and nested primers methods, as described elsewhere
[31–34]. Synthetic oligonucleotides, F166Y-F, 5¢-CACAC
CGAC
TACGGCTTCTT-3¢ (mutated nucleotides are
underlined); AP1-EcoRI-F, 5¢-TTTTCAGCGTTCTCGGA
ATTCCAGAGTGCCTCACAGTTTACCGAC-3¢; AP1-F,
Scheme 1. Proposed catalytic cycle of CDH using cellobiose and
cytochrome c as electron donor and electron acceptor, respectively.
CB, cellobiose; CBL, cellobionolactone; F, flavin; H, heme; ox, oxi-
dized form; red; reduced form; sq: semiquinone form.
K. Igarashi et al. Electron transfer chain reaction of CDH
FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS 2875
5¢-TCAGCGTTCTCGGAATTC-3¢; AP2-Xba-R, 5¢-TTTT
ACAGTAATATAAAGAATTTCGCTCTAGATCAAGGA
CCTCCCGCAAGCGCGAG-3¢; and AP2-R, 5¢-TTACA
GTAATATAAAGAATTTCGCTCTAGA-3¢, were used to
obtain the nucleotide fragment of F166Y (f166y ). The frag-
ment was subcloned into the pCR
Ò
4Blunt-TOPO vector
(Invitrogen, Carlsbad, CA, USA) as described in the manu-

facturer’s instructions, and the vector pCR4
Ò
Blunt-
TOPO ⁄ f166y was digested with EcoRI and XbaI (TaKaRa
Bio, Shiga, Japan) and ligated into the pPICZa-A vector
(Invitrogen) at the same restriction sites. The vector
pPICZa-A ⁄ f166y was then linearized with Bpu1102I
(TaKaRa Bio) and transformed into Pichia pastoris KM-
71H using a MicroPulser electroporation device (Bio-Rad
Laboratories, Hercules, CA, USA). The Zeocin-resistant
transformant was cultivated in a growth medium (1% yeast
extract, 2% polypeptone, 1% glycerol; w ⁄ v) for 24 h at
30 °C, followed by the induction medium (1% yeast
extract, 2% polypeptone, 1% methanol; w ⁄ v) for 48 h at
26.5 °C, and F166Y was purified from the culture filtrate
with the same protocol as described previously [24]. The
purity of wild-type CDH and F166Y was confirmed by
SDS ⁄ PAGE and by the absorption spectrum.
Measurement of midpoint potential of heme
in CDH
A direct electrochemical technique was used to measure the
mid-point potential according to our previous report [30].
Glassy carbon, platinum, and Ag ⁄ AgCl were used as the
working, counter, and reference (+205 mV vs. NHE at
25 °C) electrodes, respectively. Cyclic voltammetry was
performed in the presence of 50 mm MgCl
2
using an ALS
Electrochemical Analyzer 624A, and the potential was deter-
mined by averaging the anodic and cathodic peak potentials.

Presteady-state kinetic studies
Presteady-state reduction of flavin and heme was monitored
at the appropriate isosbestic point using an Applied Photo-
physics SX-18MV kinetic spectrophotometer and the
observed rate (k
obs
) was estimated by fitting to the double
exponential curve (flavin reduction) or single exponential
curve with lag (heme reduction) according to our previous
report [20]. Because apparent substrate inhibition was
observed in heme reduction, the substrate inhibition con-
stant (K
i
) was used to estimate the limiting rates (k
lim
)of
heme reduction as described previously [20]. Rapid reduc-
tion of cytochrome c by reduced CDH and re-oxidation of
heme in CDH were monitored with the same equipment,
but using a sequential mixing mode as follows. Wild-type
CDH and F166Y were first mixed with cellobiose, and the
solution was then mixed with cytochrome c at 0.1 s (WT)
or 0.2 s (F166Y) after the initial mixing, when almost 90%
of heme was reduced. Final concentrations of WT, F166Y,
cellobiose and cytochrome c were 5.0, 5.0, 100 and 5–
20 lm, respectively. To monitor the reduction of heme in
CDH and cytochrome c independently, absorption at the
isosbestic points, 549.0 nm for cytochrome c (De
549.0
¼

16.8 mm
)1
Æcm
)1
) and 556.7 nm for heme in CDH
(De
556.7
¼ 9.29 mm
)1
Æcm
)1
), was monitored. All presteady-
state measurements were carried out at least three times in
50 mm sodium acetate buffer pH 4.0 at 30 °C, and the data
were analyzed as described previously [20].
Acknowledgements
This research was supported by Grants-in-Aid for Sci-
entific Research to KI (No. 15780206), MS (No.
14360094), and TN (No. 16205021), and by Grant-in-
Aid for Scientific Research on Priority Area to TN
(No. 12147208) from the Ministry of Education, Cul-
ture, Sports, Science and Technology, and a Research
Fellowship to MY (No. 08446) from the Japan Society
for the Promotion of Science.
References
1 Nishiyama Y, Sugiyama J, Chanzy H & Langan P
(2003) Crystal structure and hydrogen bonding system
in cellulose 1a, from synchrotron X-ray and neutron
fiber diffraction. J Am Chem Soc 125, 14300–14306.
2 Nishiyama Y, Langan P & Chanzy H (2002) Crystal

structure and hydrogen-bonding system in cellulose 1b
from synchrotron X-ray and neutron fiber diffraction.
J Am Chem Soc 124, 9074–9082.
3 Clarke AJ (1997) Biodegradation of Cellulose: Enzymo-
logy and Biotechnology. Technomic Publishing, Lancas-
ter, PA.
4 Igarashi K, Samejima M, Saburi Y, Habu N & Eriksson
K-EL (1997) Localization of cellobiose dehydrogenase
in cellulose-grown cultures of Phanerochaete chrysospor-
ium. Fungal Genet Biol 21, 214–222.
5 Igarashi K, Samejima M & Eriksson K-EL (1998) Cel-
lobiose dehydrogenase enhances Phanerochaete chryso-
sporium cellobiohydrolase I activity by relieving product
inhibition. Eur J Biochem 253, 101–106.
6 Yoshida M, Igarashi K, Kawai R, Aida K & Samejima
M (2004) Differential transcription of b-glucosidase and
cellobiose dehydrogenase genes in cellulose degradation
by the basidiomycete Phanerochaete chrysosporium.
FEMS Microbiol Lett 235, 177–182.
7 Eriksson K-E & Pettersson B (1974) Oxidation: an
important enzyme reaction in fungal degradation of cel-
lulose. FEBS Lett 49, 282–285.
8 Ayers AR, Ayers SB & Eriksson K-E (1978) Cellobiose
oxidase, purification and partial characterization of a
hemoprotein from Sporotrichum pulverulentum. Eur J
Biochem 90, 171–181.
Electron transfer chain reaction of CDH K. Igarashi et al.
2876 FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS
9 Bao W, Usha SN & Renganathan V (1993) Purification
and characterization of cellobiose dehydrogenase, a

novel extracellular hemoflavoenzyme from the white-rot
fungus Phanerochaete chrysosporium. Arch Biochem
Biophys 300, 705–713.
10 Bao W & Renganathan V (1992) Cellobiose oxidase of
Phanerochaete chrysosporium enhances crystalline cellu-
lose degradation by cellulases. FEBS Lett 302, 77–80.
11 Eriksson K-EL, Habu N & Samejima M (1993) Recent
advances in fungal cellobiose oxidoreductases. Enzyme
Microb Technol 15, 1002–1008.
12 Henriksson G, Johansson G & Pettersson G (2000) A
critical review of cellobiose dehydrogenases. J Biotech-
nol 78, 93–113.
13 Cameron MD & Aust SD (2001) Cellobiose dehydro-
genase. An extracellular fungal flavocytochrome.
Enzyme Microb Technol 28, 129–138.
14 Morpeth FF (1985) Some properties of cellobiose oxi-
dase from the white-rot fungus Sporotrichum pulverulen-
tum. Biochem J 228, 557–564.
15 Henriksson G, Pettersson G, Johansson G, Ruiz A &
Uzcategui E (1991) Cellobiose oxidase from Phanero-
chaete chrysosporium can be cleaved by papain into two
domains. Eur J Biochem 196, 101–106.
16 Wilson MT, Hogg N & Jones GD (1990) Reactions
of reduced cellobiose oxidase with oxygen. Is cello-
biose oxidase primarily an oxidase? Biochem J 270,
265–267.
17 Kremer SM & Wood PM (1992) Evidence that cello-
biose oxidase from Phanerochaete chrysosporium is pri-
marily an Fe(III) reductase. Kinetic comparison with
neutrophil NADPH oxidase and yeast flavocytochrome

b
2
. Eur J Biochem 205, 133–138.
18 Samejima M & Eriksson K-EL (1992) A comparison of
the catalytic properties of cellobiose: quinone oxido-
reductase and cellobiose oxidase from Phanerochaete
chrysosporium. Eur J Biochem 207, 103–107.
19 Cox MC, Rogers MS, Cheesman M, Jones GD, Thom-
son AJ, Wilson MT & Moore GR (1992) Spectroscopic
identification of the heme ligands of cellobiose oxidase.
FEBS Lett 307, 233–236.
20 Igarashi K, Momohara I, Nishino T & Samejima M
(2002) Kinetics of inter-domain electron transfer in fla-
vocytochrome cellobiose dehydrogenase from the white-
rot fungus Phanerochaete chrysosporium. Biochem J 365,
521–526.
21 Henriksson G, Johansson G & Pettersson G (1993) Is cel-
lobiose oxidase from Phanerochaete chrysosporium a one-
electron reductase? Biochim Biophys Acta 1144, 184–190.
22 Cameron MD & Aust SD (2000) Kinetics and reactivity
of the flavin and heme cofactors of cellobiose dehydro-
genase from Phanerochaete chrysosporium. Biochemistry
39, 13595–13601.
23 Mason G, Nicholls P, Divne C, Hallberg BM, Henriks-
son G & Wilson MT (2003) The heme domain of
cellobiose oxidoreductase: a one-electron reducing sys-
tem. Biochim Biophys Acta 1604, 47–54.
24 Yoshida M, Ohira T, Igarashi K, Nagasawa H, Aida K,
Hallberg BM, Divne C, Nishino T & Samejima M
(2001) Production and characterization of recombinant

Phanerochaete chrysosporium cellobiose dehydrogenase
in the methylotrophic yeast Pichia pastoris. Biosci Bio-
technol Biochem 65, 2050–2057.
25 Samejima M, Phillips RS & Eriksson K-EL (1992)
Cellobiose oxidase from Phanerochaete chrysosporium:
stopped-flow spectrophotometric analysis of pH-depen-
dent reduction. FEBS Lett 306, 165–168.
26 Jones GD & Wilson MT (1988) Rapid kinetic studies of
the reduction of cellobiose oxidase from the white-rot
fungus Sporotrichum pulverulentum by cellobiose. Bio-
chem J 256, 713–718.
27 Page CC, Moser CC & Dutton PL (2003) Mechanism
for electron transfer within and between proteins. Curr
Opin Chem Biol 7, 551–556.
28 Rogers MS, Jones GD, Antonini G, Wilson MT &
Brunori M (1994) Electron transfer from Phanerochaete
chrysosporium cellobiose oxidase to equine cytochrome c
and Pseudomonas aeruginosa cytochrome c-551. Biochem
J 298, 329–334.
29 Martinez D, Larrondo LF, Putnam N, Gelpke MD,
Huang K, Chapman J, Helfenbein KG, Ramaiya P,
Detter JC, Larimer F et al. (2004) Genome sequence of
the lignocellulose degrading fungus Phanerochaete chrys-
osporium strain RP78. Nat Biotechnol 22, 695–700.
30 Igarashi K, Verhagen MFJM, Samejima M, Schu
¨
lein
M, Eriksson K-EL & Nishino T (1999) Cellobiose dehy-
drogenase from the fungi Phanerochaete chrysosporium
and Humicola insolens: a flavohemoprotein from Humi-

cola insolens contains 6-hydroxy-FAD as the dominant
active cofactor. J Biol Chem 274, 3338–3344.
31 Higuchi R, Krummel B & Saiki RK (1988) A general
method of in vitro preparation and specific mutagenesis
of DNA fragments: study of protein and DNA inter-
actions. Nucleic Acids Res 16, 7351–7367.
32 Ho SN, Hunt HD, Horton RM, Pullen JK & Pease LR
(1989) Site-directed mutagenesis by overlap extension
using the polymerase chain reaction. Gene 77, 51–59.
33 Merino E, Osuna J, Bolivar F & Soberon X (1992) A
general, PCR-based method for single or combinatorial
oligonucleotides-directed mutagenesis on pUC ⁄ M13 vec-
tors. Biotechniques 12, 508–510.
34 Rouwendal GJA, Wolbert EJH, Zwiers L-H & Springer J
(1993) Simultaneous mutagenesis of multiple sites: appli-
cation of the ligase chain reaction using PCR products
instead of oligonucleotides. Biotechniques 15, 68–76.
35 Hallberg BM, Bergfors T, Backbro K, Pettersson G,
Henriksson G & Divne C (2000) A new scaffold for
binding haem in the cytochrome domain of the extracel-
lular flavocytochrome cellobiose dehydrogenase. Struct
Fold Design 8, 79–88.
K. Igarashi et al. Electron transfer chain reaction of CDH
FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS 2877