Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx

Identification of ATP-NADH kinase isozymes and their
contribution to supply of NADP(H) in Saccharomyces
cerevisiae
Feng Shi
1,2
, Shigeyuki Kawai
1
, Shigetarou Mori
1
, Emi Kono
1
and Kousaku Murata
1
1 Department of Basic and Applied Molecular Biotechnology, Division of Food and Biological Science, Graduate School of Agriculture,
Kyoto University, Uji, Kyoto, Japan
2 School of Biotechnology, Southern Yangtze University, Wuxi, Jiangsu, China
The genomic DNA sequence of the widely studied
yeast Saccharomyces cerevisiae, which is a model
organism for eukaryotic cells, contains three NAD kin-
ase homologues, namely, Utr1p, Pos5p and Yel041wp
[1–3]. NAD kinase (EC 2.7.1.23) catalyses NAD phos-
phorylation by using phosphoryl donors (ATP or inor-
ganic polyphosphate [poly(P)]), constituting the last
step of the NADP biosynthetic pathway [4,5]. For the
Keywords
ATP-NADH kinase; Pos5p; Saccharomyces
cerevisiae; Utr1p; Yef1p
Correspondence
K. Murata, Department of Basic and Applied
Molecular Biotechnology, Division of Food
and Biological Science, Graduate School of

Agriculture, Kyoto University, Uji,
Kyoto 611-0011, Japan
Fax: +81 774 38 3767
Tel: +81 774 38 3766
E-mail:
(Received 23 August 2004, revised 25 April
2005, accepted 3 May 2005)
doi:10.1111/j.1742-4658.2005.04749.x
ATP-NAD kinase phosphorylates NAD to produce NADP by using ATP,
whereas ATP-NADH kinase phosphorylates both NAD and NADH. Three
NAD kinase homologues, namely, ATP-NAD kinase (Utr1p), ATP-NADH
kinase (Pos5p) and function-unknown Yel041wp (Yef1p), are found in the
yeast Saccharomyces cerevisiae. In this study, Yef1p was identified as an
ATP-NADH kinase. The ATP-NADH kinase activity of Utr1p was also
confirmed. Thus, the three NAD kinase homologues were biochemically
identified as ATP-NADH kinases. The phenotypic analysis of the single,
double and triple mutants, which was unexpectedly found to be viable, for
UTR1, YEF1 and POS5 demonstrated the critical contribution of Pos5p to
mitochondrial function and survival at 37 °C and the critical contribution
of Utr1p to growth in low iron medium. The contributions of the other
two enzymes were also demonstrated; however, these were observed only in
the absence of the critical contributor, which was supported by comple-
mentation for some pos5 phenotypes by the overexpression of UTR1 and
YEF1. The viability of the triple mutant suggested that a ‘novel’ enzyme,
whose primary structure is different from those of all known NAD and
NADH kinases, probably catalyses the formation of cytosolic NADP in
S. cerevisiae. Finally, we found that LEU2 of Candida glabrata, encoding
b-isopropylmalate dehydrogenase and being used to construct the triple
mutant, complemented some pos5 phenotypes; however, overexpression of
LEU2 of S. cerevisiae did not. The complementation was putatively attri-

buted to an ability of Leu2p of C. glabrata to use NADP as a coenzyme
and to supply NADPH.
Abbreviations
CgLEU2, LEU2 of yeast Candida glabrata; FOA, 5-fluoroorotic acid; GFP, green fluorescent protein; KNDE, 10 m
M potassium phosphate,
pH 7.0, containing 0.1 m
M NAD, 0.5 mM dithiothreitol and 1.0 mM EDTA; poly(P), inorganic polyphosphate; ScLEU2, LEU2 of yeast
Saccharomyces cerevisiae; SD, synthetic dextrose; SG, synthetic glycerol; SD+FOA+Ura, synthetic dextrose ⁄ 5-fluoroorotic acid ⁄ uracil;
WT, wild type; YPD, yeast extract ⁄ peptone ⁄ dextrose; YPG, yeast extract ⁄ peptone ⁄ glycerol.
FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3337
phosphoryl donor, the enzyme using ATP and poly(P)
is termed poly(P) ⁄ ATP-NAD kinase [4] and that using
ATP, but not poly(P), is termed ATP-NAD kinase [6].
For the phosphoryl acceptor, the enzyme specific to
NAD is designated NAD kinase and that phosphory-
lating both NAD and NADH is NADH kinase (EC
2.7.1.86) [2,3,7].
Utr1p, which was initially identified as an ATP-
NAD kinase, was proposed to participate in the ferri-
reductase system [1,8]. It was required for the reduc-
tion of extracellular ferric chelates to their ferrous
counterparts and for the uptake of extracellular iron.
This system consists of three components, namely,
Fre1p, NADH dehydrogenase and Utr1p. Utr1p was
proposed to contribute to the system by supplying
NADP [1,8]. However, the NADH kinase activity of
Utr1p has not yet been reported [1]. Pos5p was iden-
tified as an ATP-NADH kinase; it was shown to be
localized in the mitochondrial matrix and to be
important to several NADPH-requisite mitochondrial

processes, e.g. resistance to a broad range of oxida-
tive stress, respiration, arginine biosynthesis, mito-
chondrial iron homeostasis and mitochondrial DNA
stability [2,3]. The pos5 cell exhibits poor growth in
the presence of oxidative damage, glycerol as the sole
carbon source and in a medium lacking arginine [2].
This mutant accumulates high mitochondrial iron and
is defective in the mitochondrial Fe–S cluster-contain-
ing enzymes [2]. The disruption of POS5 increases
frame-shift mutations in the mitochondrial DNA [3].
However, the function of Yel041wp remains unidenti-
fied.
Although Pos5p is believed to play a significant role
in NADPH biosynthesis in mitochondria [2,3], the con-
tribution of Yel041wp and Utr1p to cellular function
and the precise function of Yel041wp is yet to be clar-
ified. In the cytosol, NADPH is mainly supplied from
NADP by NADP-dependent glucose-6-phosphate
dehydrogenase (EC 1.1.1.49) (Zwf1p) [9–11]. Cytosolic
NADPH is required for methionine biosynthesis [2,10].
The zwf1 cell is methionine auxotrophic due to the
depletion of NADPH [2,9–11], but is not arginine
auxotrophic, whereas the pos5 cell exhibits arginine
auxotrophy, but not methionine auxotrophy [2],
thereby suggesting that NADPH is synthesized in the
cytosol, separate from the mitochondria [2].
In this study, we identified the functions of
Yel041wp (designated as Yef1p) and Utr1p as ATP-
NADH kinases. We also examined the phenotypes of
single and double mutants, as well as the triple

mutant, which was unexpectedly viable, for UTR1,
YEF1 and POS5 and attempted to clarify the roles of
these three enzymes.
Results
Identification of Yel041wp (Yef1p) as ATP-NAD
kinase
First, we attempted to identify the function of
Yel041wp. We referred to Yel041wp as ‘Yef1p’ based
on the designation of this protein in the SWISS-PROT
database ( />bfind?sptrembl). YEF1 consists of 1488 nucleotides
encoding a polypeptide of 496 amino acid residues
with a calculated molecular mass of 55.9 kDa and a
calculated pI of 5.46. The YEF1 locus on genomic
DNA does not contain introns.
YEF1 was expressed in Escherichia coli as a fusion
recombinant protein with a V5 epitope and His
6
tag
at the C terminus. The fusion protein, referred to as
Yef1p, consisted of 533 amino acid residues and exhib-
ited the calculated molecular mass of 60.1 kDa. The cell
extract of E. coli MK746 expressing YEF1 showed
0.078 UÆmg
)1
ATP-NAD kinase activity, while that of
control strain SK45 carrying vector alone exhibited an
activity of 0.00086 UÆmg
)1
. When metaphosphate and
polyphosphate were used at 1.0 mgÆmL

)1
as poly(P)
instead of ATP, no NAD kinase activity was detected,
thereby suggesting that Yef1p is indeed an ATP-NAD
kinase. Yef1p was purified to homogeneity from the cell
extract of MK746 (Table 1). The purified enzyme
migrated as a single protein band corresponding to
60 kDa on SDS ⁄ PAGE (Fig. 1A) and was eluted as a
single peak, consisting of a protein of  480 kDa on gel
filtration chromatography (Fig. 1B), thereby indicating
that the enzyme was a homooctamer composed of 60-
kDa subunits. ATP and other nucleoside triphosphates
(especially dATP) at 5 mm were utilized by Yef1p as
phosphoryl donors as follows: nucleoside triphosphates,
relative activity: ATP, 100%; dATP, 91%; CTP, 43%;
UTP, 14%; GTP, 13%; TTP, 6%. Poly(P)s (pyrophos-
phate, tripolyphosphate and trimetaphosphate at 5 mm
and polyphosphate, metaphosphate and hexametaphos-
phate at 1 mgÆmL
)1
) and phosphorylated compounds
(phosphocreatine, glucose-6-phosphate and phospho-
Table 1. Purification of Yef1p.
Total
protein
(mg)
Total
activity
(U)
Yield

(%)
Specific
activity
(UÆmg
)1
)
Purification
(fold)
Cell extract 2808 218 100 0.078 1
DEAE–Toyopearl 331 205 94 0.619 8.0
Butyl-Toyopearl 15.1 13.4 6.1 0.886 11.4
Ni–chelate AF
Toyopearl
0.9 8.5 3.9 9.475 122
Saccharomyces cerevisiae NADH kinases F. Shi et al.
3338 FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS
enolpyruvate at 5 mm) were not utilized, thereby indi-
cating that Yef1p was an ATP-NAD kinase. K
m
for
NAD and ATP were 1.9 mm and 0.17 mm, respectively.
Properties of Yef1p and identification of Yef1p
and Utr1p as ATP-NADH kinases
The enzyme had an optimum pH of 8.5 in Tris ⁄ HCl
(Fig. 2A), the optimal temperature was 45 °C (Fig. 2B)
and half of its activity was lost on treatment at 54 °C
for 10 min (Fig. 2C). Bivalent metal ions such as Mg
2+
,
Mn

2+
,Co
2+
and Ca
2+
were indispensable for ATP-
NAD kinase activity. In the presence of 1 mm metal
ions, the ATP-NAD kinase activity was as follows.
Metal ions, relative activity: Mg
2+
, 100%; Mn
2+
, 77%;
Co
2+
, 32%, Ca
2+
, 26%. On the other hand, no activity
was detected in the presence of 1 mm Zn
2+
,Fe
2+
,
Cu
2+
, and monovalent metal ions (Na
+
and Li
+
).

NADPH and NADH slightly inhibited Yef1p; however,
NADP and intermediates involved in NAD biosynthesis
(nicotinic acid mononucleotide, nicotinic acid adenine
dinucleotide, nicotinic acid and quinolinic acid) did not
inhibit Yef1p (Table 2). HgCl
2
inhibited enzyme activity
(Table 2), thereby indicating the importance of the SH
group of the enzyme for its catalytic activity.
We also found that Yef1p exhibited NADH kinase
activity in the presence of ATP, but not poly(P)
(1 mgÆmL
)1
metaphosphate). On assaying the NADH
kinase activity of purified Utr1p [1], a similar result
was obtained. K
m
for NADH of Yef1p was 2.0 mm
AB
Fig. 1. Molecular mass of Yef1p. (A) SDS ⁄
PAGE of Yef1p. Lane 1, protein markers
(Bio-Rad); lane 2, purified enzyme (1.5 lg).
(B) Gel filtration of Yef1p. Purified Yef1p
was loaded on a Superdex 200 pg column
and was eluted as described in Experimen-
tal procedures. The arrow (s) indicates the
elution volume (Ve) of the purified Yef1p.
Protein standards (d) were as follows:
(a) blue dextran 2000 (2000 kDa); (b)
tyroglobulin (669 kDa); (c) ferritin (440 kDa);

(d) catalase (232 kDa); (e) BSA (67 kDa);
(f) ovalbumin (43 kDa); and (g) chymotry-
psinogen A (25 kDa).
Fig. 2. Effect of pH and temperature on Yef1p activity and stability. (A) Effect of pH on ATP-NAD kinase activity. NAD kinase activity was
assayed by the stop method as described in Experimental procedures by using potassium phosphate (r), Tris ⁄ HCl (
) and glycine ⁄ NaOH
(m). Activity in the presence of Tris ⁄ HCl (pH 8.5) was taken relatively as 100%. (B) Effect of temperature on ATP-NAD kinase activity. NAD
kinase activity was assayed by the stop method as described in Experimental procedures at indicated temperatures. The activity at 45 °C
was taken relatively as 100%. (C) Effect of temperature on the stability of Yef1p. Purified Yef1p was incubated for 10 min at indicated tem-
peratures in KNDE, cooled in an ice-water bath and the residual activity was determined by the stop method as described in Experimental
procedures. The activity after incubation at 30 °C was taken relatively as 100%.
F. Shi et al. Saccharomyces cerevisiae NADH kinases
FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3339
and that of Utr1p was 3.9 mm; this was similar to and
higher than the K
m
value of the NAD of Yef1p
(1.9 mm) and Utr1p (0.5 mm) [1], respectively. V
max
for the NADH of Yef1p was 1.9 mmÆmin
)1
ÆU
)1
and
that of Utr1p was 3.5 mmÆmin
)1
ÆU
)1
; this was also
similar to and higher than the V

max
value of the NAD
of Yef1p (1.7 mmÆmin
)1
ÆU
)1
) and Utr1p (1.2 mmÆ
min
)1
ÆU
)1
), respectively. K
m
and V
max
for NAD and
NADH of Pos5p have not been reported [2,3].
Constructions of double and triple mutants for
UTR1, YEF1 and POS5
To examine the roles of Yef1p, Utr1p and Pos5p, we
attempted to construct double and triple mutants for
UTR1, YEF1 and POS5. Tables 3, 4 and 5 list the yeast
strains, plasmids and primers, respectively, used in this
study. We hypothesized that the triple mutant (utr1yef1-
pos5) may be lethal due to the proposed significance of
intracellular NADP and NADPH; therefore, we con-
structed a triple mutant carrying UTR1 on YCplac33
(MK1208, utr1yef1pos5 YCp-UTR1) by replacing
POS5 in MK933 (utr1yef1 YCp-UTR1) with CgLEU2
(LEU2 of Candida glabrata, GenBank ID CGU90626)

and examined the viability of the triple mutant after the
loss of YCp-UTR1 by using synthetic dextrose⁄ 5-fluoro-
orotic acid ⁄ uracil (SD+FOA+Ura) medium [12]. The
MK1208 (utr1yef1pos5 YCp-UTR1) was able to grow
in SD+FOA+Ura liquid medium as well as on the
SD+FOA+Ura solid medium (data not shown). The
resultant triple mutant (MK1219, utr1yef1pos5) that
grew on the SD+FOA+Ura media was believed to
lose YCp-UTR1 [12]. The loss of YCp-UTR1 was con-
firmed by the Ura– phenotype of MK1219 (require-
Table 2. Effect of compounds on ATP-NAD kinase activity of
Yef1p. The effect of compounds on the activity of Yef1p was stud-
ied by assaying ATP-NAD kinase activity in a reaction mixture con-
taining compounds at the indicated concentrations as described in
Experimental procedures. The effect of NADP and HgCl
2
was
examined by the stop method and others, by the continuous
method. Activity in the absence of each compound was taken relat-
ively as 100%.
Compound
Concentration
(m
M)
Relative
activity (%)
None 100
NADPH 0.05 100
0.1 84
NADH 0.05 86

0.1 75
NADP 0.05 100
0.1 100
Nicotinic acid mononucleotide 1.0 100
Nicotinic acid adenine dinucleotide 1.0 100
Nicotinic acid 1.0 100
Quinolinic acid 1.0 100
2-Mercaptoethanol 1.0 100
Dithiothreitol 1.0 100
Glutathione (reduced form) 1.0 100
HgCl
2
0.1 13
0.25 6
Table 3. S. cerevisiae strains used in this study.
Strain Genotype Source
BY4742 MATa leu2D0 lys2D0 ura3D0 his3D1 EUROSCARF
MK424 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 EUROSCARF
MK425 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 EUROSCARF
MK426 MATa leu2D0 lys2D0 ura3D0 his3D1 yef1::kanMX4 EUROSCARF
MK353 MATa leu2D0 lys2D0 ura3D0 his3D1 ftr1::kanMX4 EUROSCARF
MK710 MATa leu2D0 lys2D0 ura3D0 his3D1 zwf1::kanMX4 EUROSCARF
MK743 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 yef1::HIS3 This study
MK803 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 pos5::HIS3 This study
MK804 MATa leu2D0 lys2D0 ura3D0 his3D1 yef1::kanMX4 pos5::HIS3 This study
MK933 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 yef1::HIS3 YCp-UTR1 This study
MK1208 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 yef1::HIS3 pos5::CgLEU2 YCp-UTR1 This study
MK1219 MATa leu2D0 lys2D0 ura3D0 his3D1 utr1::kanMX4 yef1::HIS3 pos5::CgLEU2 This study
MK751 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 YEp13 This study
MK1223 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 pRS415 This study

MK1224 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::CgLEU2 This study
MK342 MATa leu2D0 lys2D0 ura3D0 his3D1 YEplac195 This study
MK739 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 YEp-UTR1 This study
MK740 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 YEp-POS5 This study
MK741 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 YEp-YEF1 This study
MK742 MATa leu2D0 lys2D0 ura3D0 his3D1 pos5::kanMX4 YEplac195 This study
Saccharomyces cerevisiae NADH kinases F. Shi et al.
3340 FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS
ment of uracil for growth; data not shown). Thus, the
triple mutant was unexpectedly viable.
Growth phenotypes of mutants for UTR1, YEF1
and POS5
We examined the growth phenotypes of single, double
and triple mutants, i.e. utr1, yef1, pos5, utr1yef1,
utr1pos5, yef1pos5 and utr1yef1pos5 cells. These
mutants did not exhibit any severe growth defects at
30 °C in SD, YPD, YPD high dextrose (20% glucose),
YPD low dextrose (0.2% glucose) liquid media (Fig. 3)
and on SD solid medium (Fig. 4A, control). However,
in yeast extract ⁄ peptone ⁄ glycerol (YPG; 3% glycerol)
medium, pos5 mutants (pos5, yef1pos5 and utr1pos5)
showed a longer doubling time than the other single
Table 4. Plasmids used in this study. YGRC, Yeast Genetic Resource Centre, Osaka University, Japan.
Plasmid Description Source
pET-DEST42 Gateway destination vector, Ap
r
Invitrogen
pET-YEF1 YEF1 in pET-DEST42 This study
pFA6a-His3MX6 Gene deletion vector, HIS3,Ap
r

[34]
pCgLEU2 Gene deletion vector, CgLEU2
a
,Ap
r
YGRC
YEplac195 E. coli ⁄ S. cerevisiae shuttle vector, URA3,2lm, Ap
r
[13]
YEp-UTR1 UTR1 flanking 5¢ 503 bp in YEplac195 This study
YEp-POS5 POS5 flanking 5¢ 406 bp in YEplac195 This study
YEp-YEF1 YEF1 flanking 5¢ 503 bp in YEplac195 This study
YCplac33 E. coli ⁄ S. cerevisiae shuttle vector, URA3, CEN,Ap
r
[13]
YCp-UTR1 UTR1 flanking 5¢ 503 bp in YCplac 33 This study
YEp13 E. coli ⁄ S. cerevisiae shuttle vector, ScLEU2
b
,2lm, Ap
r
[13]
pRS415 E. coli ⁄ S. cerevisiae shuttle vector, ScLEU2
b
, CEN,Ap
r
[13]
pFA6a-GFP(F64A, S65T, Gene modification vector, GFP, HIS3,Ap
r
[29]
R80Q, V163A) -His3MX6

a
LEU2 of C. glabrata.
b
LEU2 of S. cerevisiae.
Table 5. Primers used in this study. The start and stop codons are specified in bold. The Shine–Dalgarno sequence is indicated by double
underlining. The sequence corresponding to the genomic DNA sequence of S. cerevisiae is underlined.
Primer Oligonucleotide sequences
yef1-attB1FSD AAAAAGCAGGCTCC
GAAGGAGATATAAAA
ATGAAAACTGATAGATTACTG
yef1-attB2R AGAAAGCTGGGTG
GATTGCAAAATGAGCCTGAC
attB1 ACAAGTTTGTACAAAAAAGCAGGCT
attB2 ACCACTTTGTACAAGAAAGCTGGGT
yef1hisf
CAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAAT
ATGCGTACGCTGCAGGTCGAC
yef1hisr
GAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCG
TTAATCGATGAATTCGAGCTCG
pos5hisf
CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA
ATGCGTACGCTGCAGGTCGAC
pos5hisr
CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT
TTAATCGATGAATTCGAGCTCG
pos5leu21.6f
CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA
ATGCCAATTCTGTGTTTCCCGGAAATG
pos5leu21.6r

CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT
TTAGTAAAGTTCGTTTGCCGATACATG
yef1up0.5kb
CGTTATGAAAATCACTATTATCCCC
yef1-HindIII AAAAGC
TTAGATTGCAAAATGAGCCTGACGA
pos5up0.4kb
GCTATGAAAGTCAATCCTTTTAATCG
pos5-HindIII GAAAGC
TTAATCATTATCAGTCTGTCTCTTGG
utr1up0.5kb
GCCACTGCCATCTCTTCCATTCTTTG
utr1-BamHI ATGGATCC
TTATACTGAAAACCTTGCTTGAGAAG
F. Shi et al. Saccharomyces cerevisiae NADH kinases
FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3341
and double mutants and the wild-type (WT, BY4742)
cell, although the triple mutant (utr1yef1pos5) did not
(Fig. 3). The growth defect of pos5 mutants probably
reflected the mitochondrial dysfunction caused by the
deletion of POS5 [2,3]. The absence of growth defects
in the triple mutant suggested that CgLEU2, which
was used for the disruption of POS5 in the utr1yef1
cell to construct triple mutant, can complement the
growth defect of pos5 mutants.
All mutants exhibited proper growth on solid med-
ium lacking methionine (data not shown), the med-
ium on which we confirmed that the zwf1 cell
exhibited growth defect as reported elsewhere [2,9–
11] (data not shown). Growth defects of the pos5

cell on medium lacking arginine, on medium contain-
ing oxidative stress (2 mm hydrogen peroxide) and
on synthetic glycerol (SG) medium were previously
reported [2] and confirmed in this study (Fig. 4A),
thereby indicating that Pos5p is a critical contributor
to mitochondrial functions [2,3]. We found that utr1-
pos5 and yef1pos5 cells appeared to grow somewhat
less than pos5 cells on solid medium lacking argi-
nine, on solid medium containing hydrogen peroxide
and on solid SG medium (Fig. 4A); this was con-
firmed using liquid media lacking arginine (Table 6).
However, utr1yef1 and other single mutants showed
no growth defects on these solid media (Fig. 4A).
These growth defects indicate that Utr1p or Yef1p
can partially contribute to the mitochondrial function
only in the absence of the critical contributor
(Pos5p), i.e. partial contribution was observed only
in the absence of the critical contributor. However,
the utr1yef1pos5 cell exhibited no growth defects on
the solid and liquid media, unlike the other pos5
mutants (Fig. 4A and Table 6), thereby suggesting
that CgLEU2 can complement the growth defects of
pos5 mutants. In liquid medium lacking arginine, leu-
cine slightly inhibited the growth of the triple
mutant (Table 6).
Fig. 3. Doubling times for the growth of single, double and triple
mutants for UTR1, YEF1 and POS5. The mutants and BY4742 (WT)
cells that were cultivated in YPD liquid medium to saturation were
washed three times in sterilized water and inoculated into 3 mL SD
(2% glucose), YPD (2% glucose), YPD high dextrose (20% glu-

cose), YPD low dextrose (0.2% glucose) and YPG (3% glycerol)
liquid media until D
600
of 0.05. The cells were cultivated aerobically
at 30 °C and their growth was monitored by following D
600
every
4 h. Averages in two independent experiments are provided.
A
B
Fig. 4. Growth phenotypes of the mutants
for UTR1, YEF1 and POS5. (A) The mutants
and WT cells that were cultivated in SD
liquid medium to saturation were washed
three times in sterilized water and spotted
as described in Experimental procedures on
SD solid medium (control), SD solid media
without arginine (–Arg), with 2 m
M hydrogen
peroxide (+H
2
O
2
) and SG solid medium
(SG). (B) pos5 mutants lacking ScLEU2
(pos5), carrying ScLEU2 on high copy vector
(pos5 YEp13), low copy vector (pos5
pRS415) and carrying CgLEU2 on chromo-
some (pos5::CgLEU2) were treated and
spotted as in (A).

Saccharomyces cerevisiae NADH kinases F. Shi et al.
3342 FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS
Complementing abilities of LEU2, UTR1 and YEF1
for the growth defects of the pos5 mutant
To confirm the complementing ability of LEU2 for the
growth defects of the pos5 mutant, we examined the
growth of pos5 cells containing CgLEU2 instead of
POS5 on the chromosome, ScLEU2 (LEU2 of S. cere-
visiae) on a high copy vector (YEp13) [13] and on a
low copy vector (pRS415) [13], i.e. MK1224 (pos5::
CgLEU2), MK751 (pos5 YEp13) and MK1223 (pos5
pRS415), on several media on which pos5 mutants,
except for the triple mutant, showed growth defects
(Fig. 4A). The pos5::CgLEU2 cell was able to grow on
these media, whereas pos5 YEp13, pos5 pRS415 and
pos5 cells were unable to grow (Fig. 4B), thereby indi-
cating that CgLEU2 on the chromosome, but not
ScLEU2 on YEp13 and pRS415, could complement
the growth defect of the pos5 cell. The effect of leucine
on the growth of pos5::CgLEU2, pos5 YEp13 and
pos5 pRS415 cells were not detected on these solid
media (data not shown).
The expression of POS5, UTR1 and YEF1 via a
high-copy vector complemented the poor growth of
the pos5 cell on SG solid medium and on and in solid
and liquid media lacking arginine (Fig. 5 and Table 6),
thereby supporting the partial contribution of Utr1p
and Yef1p to mitochondrial functions (Fig. 4A).
Temperature sensitivity of the mutants for UTR1,
YEF1 and POS5

At higher temperature (37 °C) on SD solid medium,
pos5 single mutant showed a slight growth defect, and
the deletion of UTR1 or YEF1 and particularly of
both UTR1 and YEF1 from the pos5 cell enhanced the
growth defect (Fig. 6). However, utr1yef1 and the
other single mutants did not exhibit growth defects at
37 °C (Fig. 6), thereby indicating that Pos5p is a crit-
ical contributor to the survival of the cells at 37 °Con
SD solid medium; Utr1p or Yef1p and in particular,
both Utr1p and Yef1p can contribute significantly to
the survival only in the absence of main contributor
(Pos5p). On YPD solid medium, the growth defect was
alleviated (Fig. 6).
Growth phenotypes of mutants for UTR1, YEF1
and POS5 in low iron medium
Because Utr1p is proposed to participate in the ferri-
reductase system required for low iron uptake, the utr1
cell was expected to exhibit growth defect on the low
iron medium [1,8]. As expected, utr1 exhibited lower
growth in the low iron medium than the yef1 and pos5
single mutants (Fig. 7). The deletion of YEF1 or POS5
from utr1 further decreased the growth of utr1 to the
same level as that of the ftr1 mutant, which lacks a
high-affinity iron transporter and shows severe growth
defects in the low iron medium [14] (Fig. 7). Further-
more, the deletion of both YEF1 and POS5 from utr1
Table 6. Doubling time of WT (BY4742) and pos5 mutants. Means
of two independent experiments are provided. Arginine concentra-
tions are specified in parentheses in mgÆL
)1

. In this study, 20
mgÆL
)1
arginine was usually added. NG, No growth; ND, not deter-
mined.
Strains
Doubling time (h)
Arg (0) Arg (0.2) Arg (2) Arg (20)
WT 2.1 2.0 2.2 1.9
pos5 NG 6.9 6.1 2.9
utr1pos5 NG 14.8 8.8 2.6
yef1pos5 NG 10.8 8.8 2.7
utr1yef1pos5 2.7 2.6 3.2 3.1
utr1yef1pos5
a
2.1 2.3 2.3 2.2
WT YEplac195 1.8 ND 1.9 1.9
pos5 YEplac195 15.6 ND 8.5 4.0
pos5 YEp-UTR1 6.3 ND 6.0 3.1
pos5 YEp-POS5 2.8 ND 2.8 2.7
pos5 YEp-YEF1 6.6 ND 5.8 4.9
a
This strain was grown in media lacking leucine. The other strains
were grown in media containing leucine.
Fig. 5. Complementation of pos5 cell. Indi-
cated pos5 and WT cells carrying each gene
on a high-copy vector or high-copy vector
alone were treated as in Fig. 4A and spotted
on SD solid media (glucose) with (control)
and without (–Arg) arginine and SG solid

media (glycerol) with (+Arg) and without
(–Arg) arginine.
F. Shi et al. Saccharomyces cerevisiae NADH kinases
FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3343
decreased the growth to a level that was much lower
than that of the ftr1 mutant (Fig. 7). It should be
noted that in the presence of Utr1p, the mutants (yef1,
pos5 and yef1pos5 cells) did not exhibit growth defects
(Fig. 7), thereby indicating that Utr1p is a critical con-
tributor to growth in the low iron medium and that
Yef1p or Pos5p and, in particular, both Yef1p and
Pos5p can contribute significantly to this kind of
growth only in the absence of the critical contributor
(Utr1p).
Discussion
The genomic sequence of the yeast S. cerevisiae con-
tains three NAD kinase homologues, i.e. Utr1p, Pos5p
and Yel041wp [1–3]. In this study, we termed
Yel041wp ‘Yef1p’. Among the three proteins, only the
function of Yef1p was not identified biochemically;
therefore, it was termed the ‘function-unknown’ pro-
tein. We identified that Yef1p functions as an ATP-
NADH kinase by using recombinant protein expressed
in E. coli. We also confirmed that Utr1p, initially
identified as an ATP-NAD kinase [1], was in fact an
ATP-NADH kinase. Thus, the three isozymes of NAD
kinase, namely, Utr1p, Yef1p and Pos5p, were bio-
chemically identified as ATP-NADH kinases [1–3].
Yef1p exhibited a homooctameric structure consist-
ing of 60-kDa subunits, while Utr1p exhibited a homo-

hexameric structure consisting of 60-kDa subunits [1];
however, the structure of Pos5p has not been deter-
mined [2,3]. The homooctameric structure of Yef1p
shows good agreement with that of the NADH kinase
found in C. utilis (a homooctamer consisting of
32-kDa subunits) [15] and pigeon liver NAD kinase
(a homooctamer consisting of 34-kDa subunits) [16].
However, it was not in agreement with the NAD kin-
ase structure of humans (a homotetramer consisting
of 49-kDa subunits) [17] and that in Mycobacterium
tuberculosis (a homodimer or homotetramer with
33–35-kDa subunits) [4,18–20]. No regulators for
Yef1p activity were found (Table 5). Intermediates of
NAD biosynthesis, particularly quinolinic acid, did not
affect Yef1p, although poly(P) ⁄ ATP-NAD kinase of
the Gram-positive bacterium Bacillus subtilis is acti-
vated by this compound [21]. NADPH, NADH, and
NADP at 0.05 mm also exerted a slight effect on
Yef1p activity, although these inhibited the ATP-NAD
kinase activity of Utr1p; the residual activity of Utr1p
was 0%, 59% and 61% in the presence of 0.05 mm
Fig. 6. Temperature sensitivity of the
mutants for UTR1, YEF1 and POS5.The
mutants and WT cells were treated and
spotted on SD and YPD solid media as des-
cribed in Fig. 4A and were grown at 30 °C
and 37 °C as indicated.
Fig. 7. Growth of mutants for UTR1, YEF1 and POS5 in low iron
medium. In order to exhaust the intracellular iron content, the
mutants and WT cells were cultivated in a low iron liquid medium

to saturation and further cultivated for 24 h after a 100-fold dilution
of the saturated culture by the same fresh medium. The cells were
washed three times in sterilized redistilled water and inoculated
into 3 mL SD (filled bar) and low iron (open bar) liquid media to give
D
600
of 0.05 (SD) and of 0.20 (low iron). The cells were cultivated
aerobically at 30 °C, and growth was monitored by following the
D
600
. Bars represent the relative D
600
(%) of the cultures in the sta-
tionary phase (SD, after 34 h; low iron, after 100 h), taking D
600
(%) of the WT cell in each medium (SD, D
600
of 5.8; low iron, D
600
of 2.4) as 100%. Means of two independent experiments are pro-
vided.
Saccharomyces cerevisiae NADH kinases F. Shi et al.
3344 FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS
NADPH, NADH and NADP [1], respectively, thereby
suggesting a difference in the regulation of Yef1p and
Utr1p by these compounds.
The viability of the triple mutant for the three
NADH kinase genes (UTR1, YEF1 and POS5)at
30 °C was unexpected. NAD and NADH kinases have
been regarded as the sole enzymes producing NADP

and NADPH [5]. Accordingly, NAD kinase was
recently reported to be essential to bacteria such as
B. subtilis [22] and M. tuberculosis [23]. Taking into
account the fact that no NAD kinase homolog other
than Utr1p, Yef1p and Pos5p is found in the genome
sequence of S. cerevisiae, we propose that a ‘novel’
enzyme, whose primary structure is different from
those of all known NAD and NADH kinases, cata-
lyses the formation of NADP or NADPH in S. cere-
visiae. Furthermore, we believe that the novel enzyme
was able to catalyse the formation of cytosolic NADP,
but not cytosolic NADPH and mitochondrial
NADP(H) for the following reasons: (a) methionine
auxotrophy of the zwf1 mutant [2,9–11] indicates that
cytosolic NADPH is not supplied by the novel enzyme
in this mutant; (b) viability and methionine prototro-
phy of the triple mutant (utr1yef1pos5) (data not
shown) supports the possibility that cytosolic NADP,
which is probably converted to NADPH by Zwf1p, is
supplied by the novel enzyme; and (c) the decreased
mitochondrial NADPH level in the pos5 mutant [2,3]
(Fig. 4A) indicates that mitochondrial NADPH and ⁄ or
NADP are not supplied by the novel enzyme in the
pos5 mutant.
The viability of the triple mutant (utr1yef1pos5)
might imply that the three NADH kinases are dispen-
sable (Utr1p, Yef1p and Pos5p). However, the pheno-
typic analysis of the single, double and triple mutants
for UTR1, YEF1 and POS5 and previous reports [2,3]
showed the critical contribution of Pos5p to mitoch-

ondrial functions and survival at 37 °C, and the critical
contribution of Utr1p in supporting growth in a low
iron medium. The contributions of the other two
enzymes were shown only in the absence of the critical
contributor, which was supported by the complementa-
tion of certain pos5 phenotypes through the over-
expression of UTR1 or YEF1 (Figs 4A,5,6,7; Table 6).
Furthermore, the alleviated temperature sensitivity of
the pos5 mutants on YPD solid medium when com-
pared with that on SD solid medium (Fig. 6) may be
indicative of the significance of NADP and NADPH
in biosynthetic reactions, which is in agreement with
the well-accepted concept that NADP and NADPH
are involved primarily in biosynthetic reactions, while
NAD and NADH are involved primarily in catabolic
reactions [24].
Although the critical contribution of Yef1p alone to
specific cellular function was not observed in this
study, a difference in the regulation of Yef1p and
Utr1p by NADPH, NADH and NADP (Table 2) [1],
and the different transcriptional patterns and protein–
protein interactions of Yef1p, Utr1p and Pos5p [25–
27] may be indicative of a certain critical contribution
of Yef1p. In brief, for example, transcriptions of
YEF1 are repressed under anaerobic conditions and in
the presence of ethanol stress; however, those of
UTR1 and POS5 are not affected [25,26]. Two-hybrid
analysis indicated that Yef1p interacted with Utr1p
and the ‘function-unknown’ proteins (Yor315wp,
Yhr115cp and Ykl009wp). On the other hand, Utr1p

interacted with Yef1p and Nup119p (nuclear pore
complex involved in nucleocytoplasmic transport), and
Pos5p interacted with Gts1p (putative transcription
factor) [27]. The interaction of Yef1p with Utr1p is of
biological interest and may be related to the pro-
nounced requirement of both Yef1p and Utr1p in the
absence of Pos5p.
The elucidation of the localization of Utr1p and
Yef1p would be helpful in understanding the critical
contribution of Yef1p as well as the molecular mech-
anism underlying the findings described in this study.
The localizations of Yef1p and Utr1p were predicted
by computer program analysis using ipsort [28], which
detects the mitochondrial targeting sequence and
N-terminal signal sequence for targeting proteins to
the ER. ipsort did not show any positive sequence in
Yef1p and Utr1p, although it detected a mitochondrial
targeting sequence in Pos5p [2,3], thereby implying
that Yef1p and Utr1p are not, at least, mitochondrial
enzymes. We attempted to examine the localization of
Yef1p and Utr1p by inserting the green fluorescent
protein (GFP) gene into the 3¢ terminus of YEF1 and
UTR1 on the chromosome by using the pFA6a-
GFP(F64A, S65T, R80Q, V163A)-His3MX6 [29] gene
modification plasmid in order to express them as
GFP-fusion proteins, and then observing them using
fluorescence microscopy or detecting them by western
blotting with anti-GFP Ig (Molecular probes, Eugene,
OR, USA). However, their localization could not
be confirmed, possibly due to the low expression of

the GFP-fusion proteins and ⁄ or the sensitivity of the
detection system.
Finally, we also found that CgLEU2 (LEU2 of
C. glabrata), but not ScLEU2 (LEU2 of S. cerevisiae),
complemented certain pos5 phenotypes (Fig. 4). LEU2
encodes b-isopropylmalate dehydrogenase that cata-
lyses the oxidation of b-isopropylmalate by using
NAD, but not NADP [30]. ScLeu2p reportedly uses
NAD, but not NADP (< 5% efficiency) [30]; it was
F. Shi et al. Saccharomyces cerevisiae NADH kinases
FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3345
also reported to be localized in the cytosol [31]. No
positive sequence was detected in ScLeu2p during the
computer program analysis using ipsort, thereby sup-
porting the cytosolic localization of ScLeu2p. The co-
enzyme specificity and localization of CgLeu2p have
not been reported. However, ipsort did not show any
positive sequence in CgLeu2p, possibly suggesting that
CgLeu2p was localized in the cytosol. Collectively, we
assume that cytosolic CgLeu2p has the ability to utilize
NADP and that it supplies cytosolic NADPH, whereas
cytosolic ScLeu2p cannot provide NADPH due to its
specificity to NAD. In the triple mutant (utr1yef1pos5),
cytosolic NADP might be supplied by the ‘novel’
enzyme, being different from Utr1p, Yef1p, and Pos5p,
as discussed above. In this context, we assume that the
adequate amount of cytosolic NADPH that is being
provided by CgLeu2p is possibly transported into the
mitochondria via an unidentified transporter localized
in the mitochondrial membrane. This results in comple-

mentation of the pos5 phenotypes caused by low
mitochondrial NADPH levels [2,3], although an
NADPH supply of this kind is not adequate for com-
plementing the growth defects of the triple mutant at
37 °C and in a low iron medium (Figs 6 and 7). This
assumption is also supported by the complementation
of pos5 phenotypes through the expression of UTR1
or YEF1 via a high-copy vector (Fig. 5 and Table 6),
wherein it is implied that Utr1p and Yef1p are not
mitochondrial enzymes, as mentioned above. The slight
growth inhibition of the triple mutant by leucine in
liquid medium lacking arginine (Table 6) might imply
that the expression and ⁄ or activity of CgLeu2p are sup-
pressed by leucine.
Experimental procedures
Materials
Yeast extract, tryptone, glucose-6-phosphate and NADH
were from Nacalai Tesque (Kyoto, Japan). Glutamate
dehydrogenase (EC 1.4.1.3), ATP, NAD, NADP and
NADPH were from Oriental Yeast (Tokyo, Japan). Ferro-
zine, pyrophosphate, tripolyphosphate, trimetaphosphate,
glucose-6-phosphate dehydrogenase and other nucleotides
were from Sigma (St. Louis, MO, USA). Polyphosphate,
metaphosphate, hexametaphosphate, quinolinic acid and
5-fluoro-orotic acid (FOA) were from Wako Pure Chemical
Industries (Osaka, Japan). Yeast nitrogen base without
amino acids was from Difco (Sparks, MD, USA), and yeast
nitrogen base without ferric chloride and copper sulfate
was from Q-Bio Gene (Carlsbad, CA, USA). Purified Utr1p
was obtained as described elsewhere [1]. Sources of other

materials are provided in the text.
Strains
Strains of S. cerevisiae were cultured at 30 °C in nutrient-
rich yeast extract ⁄ peptone ⁄ dextrose (YPD) medium [1%
(w ⁄ v) yeast extract, 2% (w ⁄ v) peptone, 2% (w ⁄ v) glucose;
pH 5.0), if necessary, with 0.2 mgÆmL
)1
geneticin or in syn-
thetic dextrose (SD) medium [0.67% (w ⁄ v) yeast nitrogen
base without amino acids, 2% (w ⁄ v) glucose, and appropri-
ate amino acids; pH 5.0]. Glucose was replaced with 3%
(v ⁄ v) glycerol in the synthetic glycerol (SG) medium and
the YPG medium. The concentration of glucose was chan-
ged to 0.2% and 20% (w ⁄ v) for YPD low dextrose medium
and YPD high dextrose medium, respectively. The low iron
medium was composed of 0.67% (w ⁄ v) yeast nitrogen base
without ferric chloride and copper sulfate, 40 lgÆmL
)1
CuCl
2
,2%(w⁄ v) glucose, 50 mm 2-morpholinoethanesulf-
onic acid, pH 6.1, 1 mm ferrozine and appropriate amino
acids [14]. The SD+FOA+Ura medium was composed of
0.7% (w ⁄ v) yeast nitrogen base without amino acid, 2%
(w ⁄ v) glucose, 0.1% FOA, 50 mgÆL
)1
uracil and appropri-
ate amino acids [12]. The SD+FOA+Ura medium was
similar; however, FOA and uracil were not included. In
order to prepare solid media, liquid media were solidified

using 2% agar. To check the growth on solid media, the
cells were cultured to saturation at 30 °C, collected, washed
three times in sterilized water and diluted in water to yield
A
600
of 2.0, 0.2 and 0.02. The diluted cell suspensions
(5 lL) were spotted on appropriate solid media. After
5 days, photographs were taken. Culture conditions for
derivative strains of E. coli BL21(DE3) (Novagen, Madi-
son, WI, USA) are given below. In order to serve as a host
for plasmid amplification, E. coli DH5a was routinely
cultured at 37 °C in Luria–Bertani medium (1% tryptone,
0.5% yeast extract, 1% NaCl; pH 7.2) supplemented with
100 lgÆmL
)1
ampicillin or 30 lgÆmL
)1
kanamycin as
required.
Construction of YEF1 expression plasmid and
strain
YEF1 was amplified from genomic DNA of S. cerevisiae
BY4742 with PfuUltra high-fidelity DNA polymerase
(Stratagene, La Jolla, CA, USA) by using PCR and
was cloned into pET-DEST42 (Invitrogen, Carlsbad, CA,
USA) to produce pET-YEF1 in accordance with the
manufacturer’s protocol. The primers used were as follows:
yef1-attB1FSD, yef1-attB2R, attB1 and attB2. A Shine–
Dalgarno sequence (GAAGGAG) with optimal spacing
(ATATAAAA) for appropriate translation initiation in

E. coli was inserted upstream of the start codon of YEF1
(Table 5). The use of pET-DEST42 enabled us to fuse a V5
epitope and a His
6
tag to the C-terminal of Yef1p. E. coli
BL21(DE3) was transformed with pET-YEF1 and pET-
DEST42 to yield MK746 and SK45, respectively.
Saccharomyces cerevisiae NADH kinases F. Shi et al.
3346 FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS
Expression of YEF1 in E. coli
For YEF1 expression, MK746 was inoculated into 400 mL
of Luria–Bertani medium supplemented with 100 lgÆmL
)1
ampicillin and subsequently cultured at 37 °C aerobically
until D
600
reached 1.2. This culture was transferred to the
same medium (12.0 L), and aerobic cultivation was contin-
ued at 37 °C for 5 h until D
600
reached 0.80. Isopropyl
thio-b-d-galactoside was then added to a final concentra-
tion of 0.4 mm, and cultivation was continued further at
37 °C aerobically for 5 h. As a control, SK45 in 10 mL
medium was treated in a similar manner.
Assay of NAD kinase activity
ATP-NAD kinase activity was assayed at 30 °C as des-
cribed previously with a slight modification [4]. In brief, the
formation of NADPH was continuously measured at A
340

in a reaction mixture (1.0 mL) consisting of 5.0 mm NAD,
5.0 mm ATP, 5.0 mm glucose-6-phosphate, 0.5 U glucose-
6-phosphate dehydrogenase, 5.0 mm MgCl
2
, 100 mm
Tris ⁄ HCl (pH 8.0) and an appropriate amount of enzyme.
Enzyme solution of less than 100 lL was routinely added
to the reaction mixture. In some cases, NAD kinase activity
was also assayed by a stop method [4]. In brief, glucose-
6-phosphate and glucose-6-phosphate dehydrogenase were
removed from the initial reaction mixture described above.
After the reaction was terminated by immersing the test
tube in boiling water for 5 min, 0.1 mL of 50 mm glucose-
6-phosphate was added to the mixture, and the amount of
NADP formed was determined enzymatically with 0.5 U
glucose-6-phosphate dehydrogenase. In the examination for
metal ion requirements, 0.1 mL of 50 mm MgCl
2
was also
added to the mixture to support glucose-6-phosphate dehy-
drogenase activity. One unit (U) of enzyme activity was
defined as 1.0 lmol NADP produced for 1 min at 30 °Cin
an initial mixture (1.0 mL), and specific activity was
expressed in UÆmg
)1
protein. Protein concentrations were
determined in accordance with the method of Bradford [32]
by using BSA as the standard.
Assay of NADH kinase activity
A reaction mixture (1.0 mL) consisting of 2.0 mm NADH,

5.0 mm ATP, 5.0 mm MgCl
2
, 100 mm Tris ⁄ HCl (pH 8.0)
and an appropriate amount of enzyme was incubated at
30 °C. Enzyme solution of less than 100 lL was routinely
added to the reaction mixture. The reaction was terminated
by the addition of 0.1 mL of 1 m NaOH followed by imme-
diate immersion of the test tube in boiling water for
1.5 min. The mixture was neutralized by the addition of
0.3 mL neutralization solution consisting of 500 mm trieth-
anolamine ⁄ HCl (pH 7.8), 400 mm Tris ⁄ HCl (pH 7.8),
25 mm NH
4
Cl and 25 mm a-ketoglutarate. NADH and the
NADPH thus formed were enzymatically oxidized to NAD
and NADP by the addition of 12.5 U glutamate dehydroge-
nase, followed by incubation at 30 °C for 10 min. Oxida-
tion was monitored by observing the decrease in A
340
.
After the oxidation reaction was terminated by immersing
the test tube in boiling water for 5 min, the amount of
NADP was determined as described above. One unit (U) of
enzyme activity was defined as 1.0 lmol NADPH produced
for 1 min at 30 °C in an initial reaction mixture (1.0 mL),
and specific activity was expressed in UÆmg
)1
protein. V
max
was determined using 1.0 U Yef1p or Utr1p, being defined

by an assay of NAD kinase activity.
Purification of Yef1p
Yef1p was purified by measuring ATP-NAD kinase activity
(Table 1). All centrifugations were conducted at 20 000 g at
4 °C for 20 min. The cells of MK746 overexpressing Yef1p
were collected and suspended in 60 mL of KNDE (10 mm
potassium phosphate pH 7.0, 0.1 mm NAD, 0.5 mm dithio-
threitol 1.0 mm EDTA). The cells were then disrupted by
sonication by using Insonator 201 m (Kubota, Tokyo,
Japan). After the sonicated cell suspension was centrifuged,
the clear supernatant (cell extract) was applied to a DEAE–
Toyopearl 650M column (4 · 30 cm) (Tosoh, Tokyo,
Japan) equilibrated with KNDE. Yef1p was eluted with a
linear gradient of NaCl (0–500 mm) in KNDE (1000 mL).
Fractions containing Yef1p that were obtained on elution
with 160–205 mm NaCl were combined, saturated with
ammonium sulfate (11.5%), and then applied to a Butyl-
Toyopearl 650M column (2.0 · 19 cm) (Tosoh) equilibrated
with KNDE saturated with ammonium sulfate (11.5%).
Yef1p was eluted with a linear gradient of ammonium sul-
fate (11.5%)0%) in KNDE (120 mL). Fractions containing
Yef1p that were obtained on elution with 9–3% ammonium
sulfate were combined and, then, dialysed overnight against
a nickel-chelating start buffer (500 mm NaCl, 10 mm imi-
dazole, 10 mm potassium phosphate (pH 7.0), 0.1 mm
NAD and 0.5 mm dithiothreitol). The dialysate was applied
to a nickel-chelating AF–Chelate Toyopearl 650M column
(1.5 · 6.5 cm) (Tosoh) equilibrated with the start buffer
and eluted with a linear gradient of imidazole (10–500 mm)
in a start buffer (50 mL). Fractions containing Yef1p that

were obtained on elution with 150–220 mm imidazole were
combined, dialysed against KNDE and used as purified
Yef1p.
Other analyses
SDS ⁄ PAGE was conducted using a 12.5% polyacrylamide
gel as described elsewhere [33]. The proteins in the gel were
visualized with Coomassie brilliant blue R-250. The
molecular mass of the enzyme was calculated by gel filtra-
tion chromatography on a Superdex 200 pg column
(1.6 · 60 cm) (Amersham Pharmacia Biotech, Piscataway,
NJ, USA) with A
¨
KTA purifier (Amersham Pharmacia Bio-
F. Shi et al. Saccharomyces cerevisiae NADH kinases
FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3347
tech) by using KNDE containing 150 mm NaCl as the elu-
tion buffer, as recommended by the manufacturer. The
molecular mass and pI of the polypeptide were calculated
with the genetyx program (Software Development, Tokyo,
Japan). The localization of proteins was predicted by
ipsort ( [28],
which predicts the mitochondrial targeting sequence and
the N-terminal signal sequence for targeting proteins to the
endoplasmic reticulum for subsequent transport through
the secretory pathway.
Construction of mutants for UTR1, YEF1 and
POS5
Mutants for UTR1, YEF1 and POS5 were constructed by
PCR targeting [34] as follows: HIS3 flanking approximately
40 nucleotides upstream and downstream of YEF1 was

amplified by PCR from plasmid pFA6a-His3MX6 by using
primers yef1hisf and yef1hisr and was introduced into
MK424 (utr1) using natural transformation [35] to replace
YEF1 with HIS3, thereby resulting in MK743 (utr1yef1).
Similarly, HIS3 flanking approximately 40 nucleotides
upstream and downstream of POS5 was obtained using
primers pos5hisf and pos5hisr and was introduced into
MK424 (utr1) and MK426 (yef1), yielding MK803 (utr1-
pos5) and MK804 (yef1pos5).
CgLEU2 flanking approximately 40 nucleotides upstream
and downstream of POS5 was amplified by PCR from
plasmid pCgLEU2 by using primers pos5leu21.6f and
pos5leu21.6r and was introduced into BY4742 and MK933
(utr1yef1 YCp-UTR1) in order to replace POS5 with
CgLEU2, thereby resulting in the formation of MK1224
(pos5::CgLEU2) and MK1208 (utr1yef1pos5 YCp-UTR1),
respectively. The triple mutant utr1yef1pos5 (MK1219) was
obtained by streaking MK1208 (utr1yef1pos5 YCp-UTR1)
onto SD+FOA+Ura solid medium to remove plasmid
YCp-UTR1. The disruption of each gene was confirmed by
PCR [34].
Construction of other plasmids and strains
UTR1, POS5 and YEF1 flanking 503 bp, 406 bp and
503 bp upstream of each gene were amplified by PCR from
the genomic DNA of BY4742 with KOD-plus polymerase
(Toyobo, Osaka, Japan) by using the following primers:
utr1up0.5kb, utr1-BamHI (UTR1), pos5up0.4kb, pos5-Hin-
dIII (POS5), yef1up0.5kb and yef1-HindIII (YEF1). They
were then inserted into the SmaI site of YEplac195 to pro-
duce YEp-UTR1, YEp-POS5 and YEp-YEF1. S. cerevisiae

MK425 (pos5) was transformed with YEp-UTR1, YEp-
POS5, YEp-YEF1 and YEplac195, thereby yielding
MK739 (pos5 YEp-UTR1), MK740 (pos5 YEp-POS5),
MK741 (pos5 YEp-YEF1) and MK742 (pos5 YEplac195).
UTR1 in addition to upstream 503 bp DNA was inserted
into the SmaI site of YCplac33 in order to produce
YCp-UTR1, which was then introduced into MK743
(utr1yef1), yielding MK933 (utr1yef1 YCp-UTR1). pos5
single mutant (MK425) was transformed with YEp13 and
pRS415, yielding MK751 (pos5 YEp13) and MK1223 (pos5
pRS415), respectively.
Acknowledgements
We thank Dr S. Harashima, Osaka University, for
helping us receive pCgLEU2 from the Yeast Genetic
Resource Centre. This work was supported in part
by a Grant-in-Aid from the Ministry of Education,
Culture, Sports, Science and Technology of Japan
(15780212) and by the Program for Promotion of
Basic Research Activities for Innovative Biosciences
(PROBRAIN).
References
1 Kawai S, Mori S, Suzuki S & Murata K (2001) Molecu-
lar cloning and identification of UTR1 of a yeast Sac-
charomyces cerevisiae as a gene encoding an NAD
kinase. FEMS Microbiol Lett 200, 181–184.
2 Outten CE & Culotta VC (2003) A novel NADH kinase
is the mitochondrial source of NADPH in Saccharo-
myces cerevisiae. EMBO J 22, 2015–2024.
3 Strand MK, Stuart GR, Longley MJ, Graziewicz MA,
Dominick OC & Copeland WC (2003) POS5 gene of

Saccharomyces cerevisiae encodes a mitochondrial
NADH kinase required for stability of mitochondrial
DNA. Eukaryot Cell 2, 809–820.
4 Kawai S, Mori S, Mukai T, Suzuki S, Hashimoto W,
Tamada T & Murata K (2000) Inorganic polyphosphate ⁄
ATP-NAD kinase of Micrococcus flavus and Myco-
bacterium tuberculosis H37Rv. Biochem Biophys Res
Commun 276, 57–63.
5 McGuinnes ET & Bulter JR (1985) NAD kinase-a
review. Int J Biochem 17 , 1–11.
6 Kawai S, Mori S, Mukai T, Hashimoto W & Murata K
(2001) Molecular characterization of Escherichia coli
NAD kinase. Eur J Biochem 268, 4359–4365.
7 Iwahashi Y, Hitoshio A, Tajima N & Nakamura T
(1989) Characterization of NADH kinase from Sac-
charomyces cerevisiae. J Biochem (Tokyo) 105, 588–
593.
8 Lesuisse E, Casteras-Simon M & Labbe P (1996) Evi-
dence for the Saccharomyces cerevisiae ferrireductase
system being a multicomponent electron transport
chain. J Biol Chem 271, 13578–13583.
9 Minard KI, Jennings GT, Loftus TM, Xuan D &
McAlister-Henn L (1998) Sources of NADPH and
expression of mammalian NADP+-specific isocitrate
dehydrogenases in Saccharomyces cerevisiae. J Biol
Chem 273, 31486–31493.
Saccharomyces cerevisiae NADH kinases F. Shi et al.
3348 FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS
10 Slekar KH, Kosman DJ & Culotta VC (1996) The yeast
copper ⁄ zinc superoxide dismutase and the pentose phos-

phate pathway play overlapping roles in oxidative stress
protection. J Biol Chem 271, 28831–28836.
11 Thomas D, Cherest H & Surdin-Kerjan Y (1991) Identi-
fication of the structural gene for glucose-6-phosphate
dehydrogenase in yeast. Inactivation leads to a nutri-
tional requirement for organic sulfur. EMBO J 10, 547–
553.
12 Boeke JD, Trueheart J, Natsoulis G & Fink GR (1987)
5-Fluoroorotic acid as a selective agent in yeast mole-
cular genetics. Methods Enzymol 154, 164–175.
13 Gietz RD & Sugino A (1988) New yeast-Escherichia coli
shuttle vectors constructed with in vitro mutagenized
yeast genes lacking six-base pair restriction sites. Gene
74, 527–534.
14 Stearman R, Yuan DS, Yamaguchi-Iwai Y, Klausner
RD & Dancis A (1996) A permease-oxidase complex
involved in high-affinity iron uptake in yeast. Science
271, 1552–1557.
15 Bulter JR & McGuinness ET (1982) Candida utilis
NAD+ kinase: purification, properties and affinity gel
studies. Int J Biochem 14, 839–844.
16 Apps DK (1975) Pigeon-liver NAD kinase. The struc-
tural and kinetic basis of regulation of NADPH. Eur J
Biochem 55, 475–483.
17 Lerner F, Niere M, Ludwing A & Ziegler M (2001)
Structural and functional characterization of human
NAD kinase. Biochem Biophys Res Commun 288, 69–74.
18 Raffaelli N, Finaurini L, Mazzola F, Pucci L, Sorci L,
Amici A & Magni G (2004) Characterization of Myco-
bacterium tuberculosis NAD kinase: functional analysis

of the full-length enzyme by site-directed mutagenesis.
Biochemistry 43, 7610–7617.
19 Garavaglia S, Raffaelli N, Finaurini L, Magni G &
Rizzi M (2004) A novel fold revealed by Mycobacterium
tuberculosis NAD kinase, a key allosteric enzyme in
NADP biosynthesis. J Biol Chem 279, 40980–40986.
20 Mori S, Yamasaki M, Maruyama Y, Momma K, Kawai
S, Hashimoto W, Mikami B & Murata K (2005) NAD-
binding mode and the significance of intersubunit con-
tact revealed by the crystal structure of Mycobacterium
tuberculosis NAD kinase-NAD complex. Biochem Bio-
phys Res Commun 327, 500–508.
21 Garavaglia S, Galizzi A & Rizzi M (2003) Allosteric
regulation of Bacillus subtilis NAD kinase by quinolinic
acid. J Bacteriol 185, 4844–4850.
22 Kobayashi K, Ehrlich SD, Albertini A, Amati G,
Andersen KK, Arnaud M, Asai K, Ashikaga S, Ayme-
rich S, Bessieres P et al. (2003) Essential Bacillus subtilis
genes. Proc Natl Acad Sci USA 100, 4678–4683.
23 Sassetti CM, Boyd DH & Rubin EJ (2003) Genes
required for mycobacterial growth defined by high den-
sity mutagenesis. Mol Microbiol 48, 77–84.
24 Moat AG & Foster JW (1987) Biosynthesis and salvage
pathways of pyridine nucleotides. In Pyridine Nucleotide
Coenzymes Part a (Avramovic DDO & Poulson R, eds),
pp. 1–24. John Wiley & Sons, Inc, NY.
25 Alexandre H, Ansanay-Galeote V, Dequin S & Blondin
B (2001) Global gene expression during short-term etha-
nol stress in Saccharomyces cerevisiae. FEBS Lett 498,
98–103.

26 ter Linde JJM, Liang H, Davis RW, Steensma HY, van
Dijken JP & Pronk JT (1999) Genome-wide transcrip-
tional analysis of aerobic and anaerobic chemostat cul-
tures of Saccharomyces cerevisiae. J Bacteriol 181, 7409–
7413.
27 Ito T, Chiba T, Ozawa R, Yoshida M, Hattori M &
Sakaki Y (2001) A comprehensive two-hybrid analysis
to explore the yeast protein interactions. Proc Natl Acad
Sci USA 98, 4569–4574.
28 Bannai H, Tamada Y, Maruyama O, Nakai K &
Miyano S (2002) Extensive feature detection of N-term-
inal protein sorting signals. Bioinformatics 18, 298–305.
29 Longtine MS, McKenzie A 3rd, Demarini DJ, Shah
NG, Wach A, Brachat A, Philippsen P & Pringle JR
(1998) Additional modules for versatile and economical
PCR-based gene deletion and modification in Saccharo-
myces cerevisiae. Yeast 14, 953–961.
30 Hsu YP & Kohlhaw GB (1980) Leucine biosynthesis in
Saccharomyces cerevisiae. Purification and characteriza-
tion of beta-isopropylmalate dehydrogenase. J Biol
Chem 255, 7255–7260.
31 Ryan ED, Tracy JW & Kohlhaw GB (1973) Subcellular
localization of the leucine biosynthetic enzymes in yeast.
J Bacteriol 116, 222–225.
32 Bradford MM (1976) A rapid and sensitive method for
the quantitation of microgram quantities of protein util-
izing the principle of protein dye-binding. Anal Biochem
72, 248–254.
33 Laemmli UK (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4.

Nature 227, 680–685.
34 Wach A, Brachat A, Alberti-Segui C, Rebischung C &
Philippsen P (1997) Heterologous HIS3 marker and
GFP reporter modules for PCR-targeting in Saccharo-
myces cerevisiae. Yeast 13, 1065–1075.
35 Hayama Y, Fukuda Y, Kawai S, Hashimoto W &
Murata K (2002) Extremely simple, rapid, and highly
efficient transformation method for the yeast Saccharo-
myces cerevisiae using glutathione and early log phase
cells. J Biosci Bioeng 94, 166–171.
F. Shi et al. Saccharomyces cerevisiae NADH kinases
FEBS Journal 272 (2005) 3337–3349 ª 2005 FEBS 3349