Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Functional analysis of a small heat shock/a-crystallin protein
from
Artemia franciscana
Oligomerization and thermotolerance
Julie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRae
Department of Biology, Dalhousie University, Halifax, Nova Scotia, Canada
Oviparously developing embryos of the brine shrimp,
Artemia franciscana, synthesize abundant quantities of a
small heat shock/a-crystallin protein, termed p26. Wild-typ e
p26 functions as a molecular chaperone in vitro and is
thought to help encysted Artemia embryos survive severe
physiological stress encountered during diapause and
anoxia. Full-length and truncated p26 cDNA derivatives
were generated by PCR amplification of p26-3-6-3, then
cloned in either pET21(+) or pRSETC and expressed in
Escherichia c oli BL21 (DE3). A ll constr ucts gave a polypep-
tide detectable on Western blots with either p26 specific
antibody, o r w ith antibody to the H is
6
epitope tag encod ed
by pRSETC. Full-length p26 in cell-free extracts of E. coli
was a bout equal i n mass to t hat f ound in Artemia embryos,
but p26 lacking N- and C-terminal r esidues remained e ither
as monomers or small multimers. All p26 constructs
conferred thermotolerance on transformed E. coli, although
not all formed oligomers, and cells expressing N-terminal
truncated derivatives of p26 were more heat resistant than
bacteria expressing p26 with C-terminal d eletions. The
C-terminal extension o f p26 is seemingly more i mportant for
thermotolerance than is the N-terminus, and p26 protects
E. coli against heat shock when oligomer size and protein

concentration are low. The findings have important impli-
cations for understanding the functional mechanisms of
small h eat s hock/a-crystallin proteins.
Keywords: small heat shock/a-crystallin protein; oligomeri-
zation; thermotolerance; diapause; Artemia f ranciscana.
Cells respond to stress by the enhanced synthesis of heat
shock or stress p roteins, which are also developmentally
regulated under normal physiological conditions. Stress
proteins are divided into several families o n the basis of s ize
and a mino-acid s equence [ 1–5]. M oreover, they function as
molecular c haperones, facilitating proper folding, transport
and multimerization of nascent proteins, as well as
preventing the irreversible aggregation of denaturing
proteins. The small heat shock/a-crystallin proteins consti-
tute a structurally divergent, ubiquitous group within the
chaperone superfamily, ranging in mole cular m ass f rom 12
to 43 kDa [6]. A conserved region, termed the a-crystallin
domain, distinguishes a ll small heat shock/a-crystallin
proteins, and a two or three domain structure is proposed
for these proteins [7,8]. The a-crystallin domain, located
toward the C-terminus of the protein monomer, consists of
80–100 amino-acid residues and is important for oligomer
formation and chaperoning [9–13]. F lexible C-terminal
extensions of small heat shock/a-crystallin proteins,
enriched in polar and charged amino-acid residues, vary
in length and sequence [8,14,15]. Loss or modification of the
C-terminal extension has the potential to perturb function
and reduce solubility of these proteins and their complexes
with target proteins [15–19]. The N-terminus, which may be
partly buried within the mature protein, promotes oligomer

formation, subunit exchange, and capture of unfolding
proteins [12,18,20–26].
Small heat shock/a-crystallin proteins confer thermotol-
erance upon cells [27–33], protect against apoptotic death
[34,35] and have chaperone activity in vitro, wherein the
aggregation of client proteins is prevented [36–38]. Chap-
eroning is thought to depend upon formation of oligomers
that reach 800 kDa in mass and possess quaternary
structure modifiable by environmental parameters
[8,18,20,22,39,40]. Oligomers exhibit dynamic equilibrium
with constituent subunits, which can affect chaperoning but
is not in itself sufficient to ensure chaperone activity
[25,41,42]. A small h eat shock/a-crystallin protein from
Methanococcus jannaschii,termedMjhspl6.5,hasbeen
crystallized, revealing highly o rdered oligomers of 24
subunits with a hollow center [9]. Cryoelectron microscopy
of small heat shock/a-crystallin proteins from several
sources has shown, however, that oligomer structure ranges
from well d efined to variable, leading to the idea that
structural plasticity elicits low specificity and permits
binding of different target proteins [10,24,42]. Several
molecules of denaturing proteins, present in an unstable
molten globule state, i nteract with a single oligomer when
chaperoning occurs. The proteins are protected from
irreversible aggregation under stress, their activity may be
preserved, and they either refold s pontaneously o r with the
assistance of other chaperones upon release [38,43–46].
Embryos of the brine shrimp, Artemia franciscana,
develop ovoviviparously, leading to release o f swimming
Correspondence to T. H. MacRae, Department of Biology, Dalhousie

University, Halifax, Nova Scotia, B3H 4J1, Canada.
Fax: + 902 494 3736, Tel.: + 902 494 6525,
E-mail: tmacrae@i s.dal.ca
Abbreviations:Gp4G,guanosine5¢-tetraphospho-5¢-guanosine;
IPTG, isopropyl thio-b-
D
-galactoside; HRP, horseradish peroxidase.
(Received 12 October 2001, revised 3 December 2001, accepted 5
December 2001)
Eur. J. Biochem. 269, 933–942 (2002) Ó FEBS 2002
nauplii from females. Alternatively, oviparous development
occurs, embryos encyst as gastrulae composed of about
4000 cells and are discharged from females enclosed in a
shell permeable only to volatile molecules [47–49]. Subse-
quent to release, encysted embryos enter a dormant state
known as diapause [50], wherein metabolic activity is
difficult to detect [51,52]. Diapause continues, even under
favourable growth conditions, until the appropriate activa-
tion signal. The embryos are very tolerant of physical
and chemical insults such as exposure to organic solvents,
a-irradiation, temperature extremes and desiccation, the
latter probably a cue that terminates diapause [53]. As one
remarkable example of stress resistance, fully hydrated cysts
survive several years at physiological temperature in the
complete absence o f o xygen [48,51,52,54], an unusual degree
of tolerance for any animal. These observations contradict
the general belief that under ordinary hydration and
temperature, cell maintenance entails a constant and
substantial free energy flow [51,52]. Anoxic cysts m ay
acquire s ufficient energy to survive b y utilization of

guanosine 5¢-tetraphospho-5¢-guanosine (Gp4G), an abun-
dant nucleotide at this developmental stage [55].
Previous work has revealed p26, a small heat shock/
a-crystallin protein found o nly in Artemia undergoing
oviparous development [47–49,56–59]. p26 has chaperone
activity in vitro and i mparts thermotolerance to trans-
formed bacteria [49,57]. Although chaperoning and ther-
motolerance are not necessarily equivalent activities, the
results indicate that p26 prevents irreversible denaturation
of proteins in diapause/encysted Artemia embryos. This
permits spontaneous and/or assisted refolding of proteins,
the former a llowing rapid resumption of d evelopment
under limiting e nergy r eserves, perhaps t o e xploit the
transient occurrence of favourable environmental condi-
tions encountered by Artemia. In the current study,
functions of p26 N- and C-terminal regions were explored
through deletion mutagenesis. Specifically, protein solubil-
ity, oligomerization, and t he thermotolerance of t rans-
formed bacteria were examined. Such information may
illuminate the mechanism by which p26 protects Artemia
from physiological stress experien ced during diapause and
anoxia, thereby enhancing our appreciation of small heat
shock/ a-crystallin proteins.
EXPERIMENTAL PROCEDURES
Cloning of full-length and truncated p26 cDNAs
Full-length and truncated p26 cDNAs were generated by
PCR using p26-3-6-3 cDNA (GenBank accession no.
AF031367) [58] as template, and custom primers possessing
BamHI and XhoI restriction sites on the sense and antisense
oligoneucleotides, r espectively (CyberSyn, Inc., Lenni, PA,

USA) (Table 1). Fifty microliter PCR mixtures included
38 n g of template DNA, 0.01 lgÁmL
)1
each of sense and
antisense primers, 5 lL of PCR buffer (ID Laboratories,
London, Ontario, Canada), 1 m
M
dNTP, 5 0 m
M
Mg
2+
,
40 lLofH
2
O and 0.01 U of proof-reading Taq polymerase
(ID Laboratories). Reaction mixtures, covered with mineral
oil, were incubated for 2 min at 94 °C prior to five cycles of
30 s at 94 °C, 45 s at 40 °C, 30 s at 72 °C , then 30 cycles of
30 s at 94 °C, 30 s at 55 °Cand30sat72°C, followed by
10 min at 72 °C. PCR products were analyzed in 1.0%
agarose gels in TAE buffer (0.04
M
Tris HC1, 0.02
M
glacial
acetic acid, 0.001
M
EDTA) using 100-bp standards
(Amersham-Pharmacia Biotech or BioÁRad). DNA frag-
ments of appropriate length were ligated into the T /A

vector, pCRII (Invitrogen, San Diego, CA, USA), using T4
DNA ligase overnight at 14 °C, and E. coli DH5a made
competent by the calcium chloride procedure were trans-
formed with the recombinant DNA [60]. Putative p26
cDNA containing clones were s elected by blue/white
screening using the LacZ system, propagated in LB broth,
and examined by restriction analysis for plasmids incorpo-
rating inserts of t he appropriate size, which were subcloned
into the prokaryotic expression vector pET21(+) (Nov-
agen, Inc., Madison, WI, USA). Briefly, pCRII constructs
and pET21(+) were d igested with BamHI and XhoIbefore
electrophoresis in 1% agarose gels. Linearized pET21(+)
and p26 cDNAs were excised and purified with the GFX
TM
PCR DNA and Gel Band Purification Kit (Amersham-
Pharmacia Biotech). Each p26 cDNA was ligated into
pET21(+) using T4 DNA ligase, and competent E. coli
DH5a were transformed w ith the constructs [60]. Bacteria
containing p26 cDNA of the correct length were identified
by restriction digestion of constituent plasmids followed by
electrophoresis in 1% agarose gels. The p26 cDNAs were
Table 1. Full-length and truncated p26 cDNAs generated by PCR. The p rimers are listed in the 5 ¢fi3¢ direction and restriction sites are underlined.
ATG, start codon; TTA, termination codon; bp, base pair.
p26 cDNAs
Amino acid
residues deleted Designations Primer sequences
Length
(bp/amino acids)
p26-full None (p26-1Bam-s) GCGCGGATCCACCATGGCACTTAACCCATG 576/192
(p26-192Xho-as) CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT

p26-ND36 1–36 (p26-36Bam-s) GCGCGGATCCACCATGCCCTTCCGGAGAAGA 468/156
(p26-192Xho-as) CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT
p26-ND60 1–60 (p26-60Bam-s) GCGCGGATCCACCATGTCCTTGAGGGACACA 396/132
(p26-192Xho-as) CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT
p26-CD40 153–192 (p26-1Bam-s) GCGCGGATCCACCATGGCACTTAACCCATG 459/153
(p26-153Xho-as) CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT
p26-CD10 183–192 (p26-1Bam-s) GCGCGGATCCACCATGGCACTTAACCCATG 546/182
(P26-182 Xho-as) CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT
p26-alpha 1–60 and (p26-60Bam-s) GCGCGGATCCACCATGTCCTTGAGGGACACA 297/93
153–192 (p26-153Xho-as) CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT
934 J. A. Crack et al.(Eur. J. Biochem. 269) Ó FEBS 2002
sequenced in both directions, either at the Hospital for Sick
Children (Toronto, Ontario, Canada) or t he National
Research Council Laboratory (Halifax, Nova Scotia,
Canada). Sequence similarity amongst the p26 constructs
was analyzed by
CLUSTAL W
, with files viewed and edited
in Microsoft
WORD
. Selected p26 cDNA fragments
recovered from pET21(+) constructs were also cloned into
pRSETC (Invitrogen). Full-length p26 cDNA cloned in
pRSETC, termed pRSET-p26-3-6-3, was prepared
previously [49].
Expression of p26 in
E. coli
BL21(DE3)
Two ml of LB medium supplemented with 50 lgÁmL
)1

ampicillin was inoculated with a single colony consisting of
transformed bacteria possessing either full-length or trun-
cated p26 cDNA, and incubated with shaking at 37 °C until
the D
600
reached 0.6–1.0. Cultures w ere stored a t 4 °C
overnight before incubation with shaking in 50 mL of f resh
LB medium containing 50 lgÁmL
)1
ampicillin at either
30 °Cor37°C. Isopropyl t hio-b-
D
-galactoside (IPTG) wa s
added w hen the culture reached a D
600
of 0.6–1.0 a nd
incubation continued for 5 h, followed by 5 min on ice and
centrifugation at 5000 g for 5 min at 4 °C. Growth rates of
E. coli transformed with wild-typ e and mutated p26 were
not determined, but the D
600
increases for all cultures were
similar indicating that expressed p26 had no effect on cell
division. The pelleted cells were washed twice with cold
buffer (50 m
M
Tris/HC1, 2 m
M
EDTA, pH 8.0) and
resuspended in 5 mL of the same buffer, before adding

lysozyme and Triton X -100 to final concentrations of
100 lgÁmL
)1
and 0.01%, respectively. Triton X-100 was
omitted from s ome preparations to learn if detergent
influenced p26 oligomerization. Mixtures were incubated
at 30 °C for 15 min, sonicated twice for 10 s at the high
output setting with a Branson Sonifier cell d isruptor 200
fitted with a microtip, and centrifuged at 12 000 g for
15 min at 4 °C. Supernatants were either used immediately
or frozen at )70 °C until required. The p ellets, when
retained, were resuspended in 500 lLofSDS/PAGE
treatment buffer, placed in a boiling water bath for 3 min
and either electrophoresed immediately or stored at )70 °C.
Immunodetection and quantitation of p26
Protein samples electrophoresed in 12.5% SDS polyacryl-
amide gels were either stained with Coomassie blue or
transferred to nitrocellulose. Blots were rinsed briefly with
Tris/NaCl/P
i
(0.01
M
Tris/HC1, 0.14
M
NaC1, pH 7.4) and
stained with 0.2% Ponceau-S in water to confirm protein
transfer. For immunodetection, membranes were blocked
45 min in 5% milk powder dissolved in Tris/NaCl/P
i
/

Tween (Tris/NaCl/P
i
with 0.1% Tween 20) , followed by
incubation for 30 min at room temperature with either
anti-p26 Ig [57] or anti-(His
6
tag) Ig (Santa Cruz Biotech-
nology, Inc., S anta Cruz, CA, USA) diluted in HST buffer
(0.01
M
Tris/HC1, 1
M
NaC1,0.5%Tween20,pH7.4).
Blots were washed twice in HST buffer, then in Tris/NaCl/
P
i
/Tween, prior to incubation for 30 min with horseradish
peroxidase (HRP)-conjugated goat anti-(rabbit IgG) I g
(Jackson Immunochemicals, Inc.) diluted in HST buffer.
Membranes were washed twice in HST buffer, twice in
Tris/NaCl/P
i
/Tween and once in T ris/NaCl/P
i
,witheach
wash for 5 min. Immunoconjugates were detected by the
enhanced chemiluminescence (ECL) p rocedure (Amersham
Pharmacia Biotech) following manufacturer’s instructions.
The p 26 bands were scanned with a Bio ÁRad Model
GS-670 Imaging Densitometer and analyzed in

MOLECU-
LAR ANALYST
. Values so obtained w ere compared with
those comprising the linear portion of a standard curve
established for quantitation o f p26. The standard curve
was prepared by electrophoresing different amounts of cell
free extract from Artemia cysts containing p26 in 12.5%
SDS polyacrylamide gels, blotting t o nitrocellulose and
probing with antip26 antibody before scanning. Each
densitometer value (arbitrary units) was plotted against the
amount of cell free extract protein in the gel lane from
which the density measurement was made.
Centrifugation of p26 in sucrose gradients
Sucrose gradients were formed in 0.1
M
Tris/glycine
(pH 7.4) by layering 5 mL of 10% sucrose on 5 mL of
50% sucrose and centrifuging at 200 000 g for 3 h at 15 °C.
Four-hundred microliters of cell free extract from bacteria
grown at 30 °C was loaded per g radient and centrifuged at
200 000 g for 21 h at 4 °CinaBeckmanSW41Tirotor.
Additionally, 400 lL of p26 purified from Artemia cysts
[57], and molecular mass markers o f 29 kDa (carbonic
anhydrase), 66 k Da (bovine serum albumin), 150 kDa
(alcohol dehydrogenase), 200 kDa (a-amylase), 443 kDa
(apoferritin), and 669 kDa (thyroglobulin) (Sigma) were
centrifuged on gradients. T ube bottoms were punctured
with a 25-gauge needle, 1 mL samples were collected, and
75 lL from each fraction was mixed with 25 lLof4· SDS
polyacrylamide gel treatment buffer. Twenty microliters of

each sample was then electrophoresed in 12.5% SDS
polyacrylamide gels, blotted to nitrocellulose and probed
with antibody to p26. Each molecular mass marker, located
by reading the A
280
of gradient fractions, tended to occur
in seve ral samples, t hus each marker w as centrifuged
separately. The position of the peak tube for each marker
is indicated in the figures.
Thermotolerance of
E. coli
BL21(DE3) expressing p26
Two m illiliters of Luria–Bertani broth containing
50 lgÁmL
)1
ampicillin and 1 m
M
IPTG was inoculated
with a single colony of E. coli BL21(DE3) transformed
with either full-length or truncated p26 cDNA in
pET21(+), and incubated at 30 °C f or 8–9 h. Immediately
before heat shock, 0.5 mL of culture was diluted 1 : 10 in
fresh medium supplemented with 25 lgÁmL
)1
ampicillin.
Cultures were incubated at 5 4 °C in a water bath, 100 lL
samples were removed after 0, 15, 30, 45 and 60 min of
heat shock, diluted in cold LB broth and maintained on ice
prior to plating in duplicate o n LB agar. Colonies were
counted after 20–24 h at 37 °C and all p26 constructs were

tested a m inimum of three times for t hermotolerance
induction. To verify the presence of p26, 500 lLofeach
IPTG induced culture was removed prior to heating, cells
were collected by centrifugation for 20 s at top speed in a
microcentrifuge, re suspended in 50 lL of treatment buffer,
placed in a boiling w ater bath for 3 min, and frozen at
)20 °C before e lectrophoresis in SDS/polyacrylamide gels,
blotting to nitrocellulose and immunodetection.
Ó FEBS 2002 Small heat shock/a-crystallin protein from Artemia (Eur. J. Biochem. 269) 935
RESULTS
Cloning of full-length and truncated p26 cDNAs
Six cDNA products were generated by PCR using
selected primers and p26-3-6-3 as template (Table 1).
The cDNAs i nclude: p26-full, the full-length p26 cDNA;
p26-ND36, lacks N-terminal residues 1–36; p26-ND60 ,
lacks N-terminal residues 1–60; p26-CD40, lacks C-termi-
nal residues 153–192; p26-CD10, lacks C-terminal residues
183–192; p26-alpha, lacks residues 1–60 and 153–192,
thereby corresponding to t he a-crystallin domain. That
the cDNA fragments in pET21(+) were of the proper size
was confirmed by restriction digestion with BamHI and
XhoI. Additionally, primers p26-1Bam-s and p26-192Xho-
as (Table 1) amplified only the cDNA in p26-full, and
amplification of constructs with the primers employed for
production of their respective inserts yielded PCR prod-
ucts of the expected length. That is, the fragments were
the same s ize as those r eleased from pET21(+) by
restriction d igestion and to those obtained during t he
initial PCR. As final verification of identity, and to see if
errors were introduced during PCR amplification, each

p26 cDNA cloned in pET21(+) was sequenced and its
deduced amino-acid sequence determined (not shown).
With one exception, deduced amino-acid sequences of
cDNA products were identical, exclusive of engineered
deletions, to full-length p26. Construct p26-ND60 had a
modified nucleotide at position 407 (numbered as in full-
length p26-3-6-3) that caused a Val136Ala substitution.
Each p26 cDNA had cytosine at position 324, whereas
adenine was reported for p26-3-6-3, and cytosine at
position 354 was replaced by thymine. Neither of these
changes modified the deduced am ino-acid sequence o f
p26. The p26 cDNAs cloned in pET21(+) and utilized in
subsequent experiments are represented schematically in
Fig. 1.
Synthesis of full-length and truncated p26
in
E. coli
BL21(DE3)
Cell free extracts prepared from E. coli transformed with
p26 cDNAs in pET21(+) and induced at 30 °CwithIPTG
were electrophoresed in SDS/polyacrylamide gels and either
stained with Coomassie blue (Fig. 2A) or blotted to
nitrocellulose and probed with antibody to p26 (Fig. 2B).
Only p26-ND36 yielded an additional band visible in stained
gels (Fig. 2A, lane 2). In agreement with this observation,
immunostaining of blots with antibody to p26 gave a strong
reaction with p26-ND36, while bands of lesser intensity were
obtained for p26-full, p26-CD40 and p26-CD10 (Fig. 2B).
Extracts from bacteria transformed with p26-ND60 and
p26-alpha in pET21(+) usually failed to produce visible

bands when Western blots were stained with anti-p26 Ig
(Fig. 2B), although v ery weak bands appeared occasionally
(not shown). The relative amounts of p26 in lysates of
transformed E. coli were determined by incubating Western
blots with anti-p26 Ig, taking care to ensure that density
measurements were within the linear r ange of film e xposure
(Fig. 2C). The ratio of p 26-full: p26-ND36: p26-CD40: p26-
CD10 was 2 : 16 : 1 : 2.5. Similar quantities of each p26
variant were produced by transformed b acteria incubated at
30 an d 37 °C, but much of the p26 at the higher t emperature
pelleted upon centrifugation at 12 000 g for 15 min (Fig. 3).
In contrast, full-length and truncated p26 polypeptides
synthesized at 30 °C were almost completely soluble, thus
bacteria used for subsequent analysis were grown at this
temperature. Occasionally, expressed proteins appeared as
doublets (Fig. 3B, lane 2, 3D, lane 4) but the reason is
unknown.
Centrifugation of bacterially expressed p26
in sucrose gradients
The sedimentation patterns of p26 proteins e ncoded by
pET21(+) constructs, and detectable on Western blots with
anti-p26 Ig, varied upon centrifugation of cell free extracts
in sucrose gradients (Fig. 4). For example, p26-CD40
(Fig. 4C) existed mainly as monomers, whereas p26-CD10
(Fig. 4D) and p 26-ND36 (Fig. 4B) were in protein com-
plexes larger than monomers but smaller on average than
Fig. 1. Schematic representation of p26 cDNAs cloned in pET21(+).
Results obtained by cloning full-length and truncated derivatives o f
p26 in the prokaryotic expression vector, pET21(+), are summarized.
The p 26 cDNAs were cloned into t he BamHI and XhoIsitesof

pET21(+), and the constructs were use d to transform E. coli
BL21(DE3). MCS, multiple c loning site; Amp, ampicillin resistance;
ori, origin o f replic ation; lac 1, lac operator repressor gene; f1 origin,
filamentous phage origin of replication. Additional description of
clones is available i n Table 1.
936 J. A. Crack et al.(Eur. J. Biochem. 269) Ó FEBS 2002
those seen in E. coli transformed w ith p ET21(+) containing
full-length p26 cDNA (Fig. 4A). p26 purified from Artemia
cysts ocurred as oligomers (not shown) and in cell extracts
from cysts (Fig. 4E) the p26 complexes were slightly larger
in size than these produced by recombinant p 26. As revealed
by sedimentation patterns therefore truncated p26 variants
detectable by antip26 antibody exhibited limited ability t o
oligomerize and/or to interact with other proteins, whereas
full-length p26 in cell free extracts from E. coli and Artemia
formed much larger protein complexes, perhaps due to
oligomer assembly as demonstrated for purified p26.
Thermotolerance of
E. coli
expressing full-length
and truncated p26 cloned in pET21(+)
Bacteria transformed with p26 containing constructs dem-
onstrated greater thermotolerance than cells that had
incorporated only pET21(+) (Fig. 5 ). Maximum tolerance
occurred in bacteria expressing p26-full, but this was only
marginally better than protection conferred by p26-ND36
and p26-ND60, w hich in turn was g reater than t he resistance
afforded by p26-CD40, p26-CD10 and p26-alpha. The insert
(Fig. 5 ) indicates e ither t hat p26 occ urred in cell free extracts
from only four transformed cultures, although a ll exhibited

enhanced heat tolerance, or that p26 variants produced by
p26-ND60 and p26-alpha were pr esent but recognized
poorly by antip26 antibody. To determine if recognition of
p26-ND60 and p26-alpha encoded polypeptides by antibody
to p26 was problematic, corresponding cDNA fragments
were inserted into pRSETC and used to transform E. coli.
IPTG induced bacteria containing full-length p26, p26-
ND60 and p26-alpha in pRSETC produced polypeptides of
appropriate size that reacted with antibody to the (His)
6
epitope tag, while only the product of p26-full reacted with
anti-p26 Ig (Fig. 6). Thus, antibody to p26 reacted poorly
with polypeptides encoded by p26-ND60 and p26-alpha,
demonstrating that enhanced thermotolerance conferred by
these two constructs correlated with synthesis of p26
polypeptides. Additionally, when tested by centrifugation
on sucrose gradients, the size of full-length p26-His
6
(Fig. 7 A) was c lose to those produced by recombinant
full-length p26 lacking His
6
, while results with the truncated
p26 polypeptides (Fig. 7B,C) were similar to those for
p26-CD40, yielding mostly monomers. As with the other
truncated derivatives of p26, the induction of thermotoler-
ance by p26-ND60 and p26-alpha did not depend on
oligomer formation.
Fig. 2. Expression of pET21(+) containing p26 cDNA in transformed
bacteria. Cell free protein extracts were prepared from E. coli trans-
formed with pET21(+) containing full-length and truncated p26

cDNAs and grown in the presence of IPTG at 30 °C. Samples were
electrophorese d in 12.5% SDS polyacrylamide gels and either stained
with Coomassie blue ( A) or transferred to nitrocellulose and probed
with antibod y t o p26 using the ECL proc edure (B) . E ach lane received
15 lL of cell free extract in A and 10 lLinB.M,molecularmass
markers of 97, 66, 43, 31, 22 and 14 kDa; 1, p26-full; 2, p26-ND36; 3,
p26-ND60; 4, p26-CD40; 5, p26-CD10;6,p26-alpha;7,pET21(+).
Arrowhead, p26-N D36. Panel C, Western blots containing lysates of
transformed E. coli BL21(DE3) grown at 30 °C an d induced with
IPTG were probed with antibody to p26. Film s were scanned and
absorbance of the p26 band in each lane, in arbitrary units, dete r-
mined. The amounts of sample applied t o the gel were: p26-full, 5 lL;
p26-ND36, 1 lL; p26-CD40, 10 lL; p26-CD10, 5 lL. The lanes in
which p26 is not v isible each received 10 lL of l ysate.
Fig. 3. Solubility of p26 synthesized in transformed bacteria. E. coli
BL21(DE3) transformed with p26 cDNA in pET21(+) and ind uced
with IPTG were grown at either 30 °C(A,B)or37°C(C,D)for5h,
following which soluble (A,C) and insoluble (B,D) fractions were
prepared. Twenty microliters of each sample was electrophoresed in
12.5% polyacrylamide gels, blotted to n itrocellulose and probed with
antibody to p26 by the ECL p rocedure. Lane 1, 5 lg of cell free e xtract
protein from Artemia cysts; 2, p26-full; 3, p26-ND36; 4, p26-CD40; 5,
p26-CD10.
Ó FEBS 2002 Small heat shock/a-crystallin protein from Artemia (Eur. J. Biochem. 269) 937
DISCUSSION
Restriction digestion, PCR amplification and sequencing
confirmed the identity of p26 cDNA fragments cloned in
pET21(+) and pRSETC. The deduced amino-acid
sequence fo r each construct was identical to the corre-
sponding region encoded by p26-3-6-3 [58], except for p26-

ND60, which had a Val136Ala substitution. Alanine a nd
valine are similar amino acids, indicating this modification is
unlikely to affect p26. Two other nucleotides were altered in
all constructs, but neither rendered an amino-acid conver-
sion. Because each construct was amplified from the same
p26-3-6-3 preparation, these changes probably represent
errors in the original sequence.
SDS/PAGE of extracts from IPTG induced bacteria gave
a visible pro tein band o f the e xpected size for p26-ND36, but
not for other cDNA fragments cloned in pET21(+), upon
Fig. 4. Centrifugation of p26 in sucrose gradients. Four hundred llof
extract from E. coli BL21(DE3) transformed w ith p26 cDNA cloned
in pET21(+) and 400 lL of cell free extract from Artemia cysts were
centrifuged in sucrose gradients. Samples f rom gradient fractions were
electrophoresed in 12.5% SDS polyacrylamide ge ls, transferred to
nitrocellulose, and reacted with antibody to p26 using th e ECL pro-
cedure. Th e top of each gradient is to the left of the figure, and
numbers across the top indicate successive samples t aken from gradi-
ents. (A) p26-full; (B) p26-ND36; (C) p26-CD40; (D) p26-CD10; (E)
p26 i n cell fre e extract from Artemia. The p ositions from l eft t o right of
molecular mass markers re presenting 29, 66, 150 , 200, 443 and
669 kDa are indicated by arrows.
Fig. 5. Thermotolerance of transformed bacteria. Transformed E. coli
BL21(DE3), grown as described in Materials and methods, were
incubated at 54 °C for the times indicated, plated in duplicate on LB
agar and incubated at 37 °C for 20 h. Colonies were counted and the
log
10
values of colony forming units (cfu) per mL were plotted against
the length of heat shock in min. The results shown are the average of

three independent experiments. Bacteria containing only pET21(+)
did not survive 60 min of heat shock and the curve was terminated at
45 m in I nsert , 10 lL of cell lysate from e ach heat shoc ked culture was
electrophoresed in 12.5% SDS polyacrylamide gels, blotted to nitro-
cellulose and probed with anti-p26 Ig, a procedure re peated for each
heat shock experiment. 1, p26-full; 2, p26-ND36; 3, p26-ND60; 4, p26-
CD40;5,p26-CD10; p26-alpha.
Fig. 6. Expression of p26 cDNA cloned in pRSETC. Cell free protein
extracts were prepared from E. coli transformedwitheitherpRSETC
(A,C) or pET21(+) (B,D) containing p26 cDNA. Dup licate samples
were electrophoresed in 12.5% SDS polyacrylamide gels, transferred
to nitrocellulose and p robed with antibody to either p26 (A,B) or the
(His)
6
epitope tag encoded by pRSETC (C,D). Each lane received
7.5 lL of e xtract. 1, p 26-full; 2, p26-N D60; 3, p26-alpha; 4, vector only.
938 J. A. Crack et al.(Eur. J. Biochem. 269) Ó FEBS 2002
Coomassie blue staining. Probing of Western blots with p26
specific antibodies demonstrated the products of four
constructs in extracts of IPTG induced bacteria, but
polypeptides corresponding to p26-ND60 and p26-alpha
were either absent or recognized poorly by anti-p26 Ig.
Western blots of extracts from E. coli transformed w ith p 26-
full, p26-ND36 and p26-alpha cloned in pRSETC and
probed with antip26 antibody gave results identical to those
just described. However, antibody to His
6
revealed the
epitope tag, and thus p26-ND36 and p26-alpha, in duplicate
samples from pRSETC transformed E. co li. Interestingly,

mammalian Cos1 cells transiently transfected with p26-
ND60 and p26-alpha were immunofluorescently labeled
with antip26 antibody, even though the p26 variants were
not detectable on Western blots of extracts from these cells
(data not shown). The combined results support the
conclusion that bacteria transformed with p ET21(+)
containing p26-ND60 and p26-alpha produced p26, but it
was poorly recognized by anti-p26 Ig after electrophoresis
and transfer to nitrocellulose. Equally important, full-length
and truncated derivatives of p26 from transformed E. coli
were almost completely soluble at 30 °C, but less so at
37 °C, indicating that bacteria grown at the lower tempe-
rature are more likely to give an accurate portrayal of p26
function than are cells incubated at 37 °C.
Small heat shock/a-crystallin proteins generally exist as
large oligomers when purified [4,8,39,40,57], but there are
exceptions [19,20,22]. In this study, p26, either purified from
Artemia embryos (not shown) or in cell free extracts, was
shown by sucrose gradient centrifugation to exist in protein
complexes as large as 670 kDa. Liang et al. [57] demon-
strated that purified p26 assembled into oligomers o f
670 kDa, and full-length p26 in c ell free e xtracts from
transfected Cos1 cells is also in a complex of similar mass
(unpublished data). Full-length p26 synthesized in E. coli
yielded protein complexes somewhat smaller on average
than those in extracts f rom Arte mia, and by way of
comparison, small h eat shock/a-crystallin proteins pro-
duced in transformed bacteria usually reside as oligomers
similar in size to those in cells from which the expressed
cDNA was obtained [17,24,37,61]. The reluctance of full-

length p26 to form complexes as large as those in Artemia
may reflect improper post-translational processing of the
protein in E. coli. On the other hand, trivial explanations for
the slightly reduced mass are either that Triton X-100 used
during protein preparation affects quaternary structure or
that oligomerization of p26 and/or its interaction with other
proteins is concentration dependent. The former possibility
was not investigated systematically, but preliminary data
suggest detergent does not affect the ability of p26 to form
large complexes in bacterial extracts. Published results vary
in terms of how the concentration of small heat shock/
a-crystallin proteins influe nces oligomer assembly. F or
example, a-crystallin tends to oligomerize readily, even at
low concentrations [40,42], while Hsp20 oligomerization is
concentration dependent [19]. Expression of full-length p26
cDNA in pRSETC was more than for pET21(+), and the
average size of p26 complexes resolved in sucrose gradients
increased, perhaps as a consequence of greater oligomer-
ization due to higher p26 concentration.
The a bsence in cell free extracts of high molecular mass
complexes when p26 lacks either part or all of the
N-terminus favours a role for this region in oligomer
assembly. R einforcing th is proposal, t etramers are the
maximum size attained by Hspl2.2 and 12.3 from Caenor-
habditis elegans [22], and like p26-ND36, the N-terminal
domains of these proteins are short. High molecular mass
oligomers a re not detected afte r N -terminal deletion of
C. elegans Hsp16.2, although dimers and possibly tetramers
are present [18]. Additionally, H spl2.6 from C. elegans,
with 16 fewer N-terminal residues than Hspl6.2, is mono-

meric [20]. Eliminating the 56 N-terminal residues from
aA-c rystallin, but not the first 19, reduced oligomer mass, as
did removal of 87 N-terminal residues from H sp27 [25] and
33 residues from Hsp25 [33], although the latter modifica-
tion was small. In contrast, loss of 42 residues from the
N-terminus of a rice small heat shock/a-crystallin protein
increased oligomer size [23]. Deleting the last 16 C-terminal
residues o f C. elegans Hspl6.2 had limite d effect on
quaternary structure [18], as is true for dispensing with 10
C-terminal residues from aA-crystallin [25] and 18
C-terminal residues from Hsp25 [15]. In contrast, oligomer
formation by p26 lacking C-terminal residues was compro-
mised, signifying this region is important for oligomeriza-
tion. Although caution is required because the function of
p26, a eukaryotic protein, was examined in E. coli,the
Fig. 7. Centrifugation o f p26 in sucrose gradients. Fou r hundred
microliters of extract from E. coli BL21(DE3) transformed with p26
cDNA cloned in pET21(+) was centrifuged in sucrose gradients.
Samples from gradient factions were electrophoresed in 12.5% SDS
polyacrylamide gels, transferred to nitrocellulose, and reacted with
antibody to the H is
6
epitope tag. Th e t op o f eac h gradie nt is t o th e l eft
of th e figure, and numbers across the top indicate successive samples
from gradients. A, p26-full, B, p26-ND60; C, p26-alpha. The positions
from left to right of molecular mass markers representing 29, 66, 150,
200, 443 and 669 kDa are indicated by arrows.
Ó FEBS 2002 Small heat shock/a-crystallin protein from Artemia (Eur. J. Biochem. 269) 939
results corroborate the idea that N-terminal domains of
small heat shock/a-crystallin proteins aid construction o f

oligomers from smaller building blocks arising by interac -
tions between residues within a-crystallin domains
[7,8,21,62]. Contrary to other reports, the C-term inal
extension is a lso implicated in oligomerization, but the
exact nature of its role is uncertain.
Small heat shock/a-crystallin proteins confer thermotol-
erance on prokaryotic and eukaryotic organisms
[23,27–33]. The construct used p reviously to examine
induction of thermotolerance by full-length Artemia p26
encoded N -terminal, nonp26 residues, missi ng from the
construct employed h erein [ 49], but the outcome was
similar in each case. Moreover, loss of N-terminal residues
did not drastically change the ability of p 26 to con fer
thermotolerance o n E. coli, suggesting this domain and the
assembly of large oligomers are not required for protection.
In agreement, bacteria transformed w ith Hsp25, and
Hsp25 lacking 33 N-terminal amino-acid residues, are
equally heat tolerant [33]. Removal of C-terminal exten-
sions from C. elegans Hspl6.2, murine Hsp25 and human
aA-crystallin reduced, but did not extinguish small heat
shock/ a-crystallin protein chaperone activity in vitro
[15,16,18], as is true when hydrophobic residues are placed
in the region [17]. Loss of t he C-terminal extension lowered
protein s olubility, con sistent with the notion that this
region is a solubilizing agent [14–17]. E liminating t he
C-terminal extension had little effect on p26 solubility
when bacteria were grown at 30 °Cand37°C, although
testing at higher temperatures may be informative.
Additionally, the C-terminal extension of p26 is required
for full induction of thermotolerance in E. coli and thus

may be necessary for chaperoning in vitro.
Oligomerization in the context of thermotolerance, as
described in this s tudy, is not as thoroughly investigated as
the association between quaternary structure and chaper-
oning in vitro, where an increase in oligomer mass gene-
rally enhances protection of client proteins [18–20,22,63].
However, oligomer mass is not the only determinant of
small heat shock/a-crystallin protein function. As a case in
point, o ligomers l acking chaperone activity arise from
chimeric a-crystallins [63]. Also, insertion of a peptide
[41,64] and change of a single residue [10,11,13,65] lead to
enlarged oligomers with curtailed chap erone action in vitro.
In other work, dissociation of oligomers was a prerequisite
for chaperoning in vitro [66], and disassembly of active units
from an oligomeric (storage) state of a-crystallin was
proposed, upon structural analysis of aA-crystallin by site-
directed spin labelling, as a model for chaperone function
[67]. Such r esults downplay oligomerization as a prerequisite
for protection again st stress. In t his vein, monomeric
a-crystallin at low chaperone to target ratios protects lens
sorbitol dehydrogenase enzyme activity upon heating [46],
while the N-terminal portion of a small heat shock/
a-crystallin protein confers thermotolerance on cells [29]
and prevents aggregation of stressed proteins in vitro [12].
These polypeptides are unlikely to oligomerize, either in vivo
or in vitro. Clearly, our data st rengthen the notion that small
heat shock/a-crystallin proteins function in vivo when not in
large oligomers. Whether this signals nonspecific effects on
proteins, an interplay with membranes as reported recently
[68], or mechanistic differences between thermotolerance

and molecular chaperoning in vitro awaits purification of
truncated p26 derivatives and testing in a defined system,
experiments now in progress.
ACKNOWLEDGEMENTS
The work was supported by a Natural Sciences and E ngineering
Research Co uncil of Canada Re search Grant and a Nova Sc otia
Health Research Foundation New O pportunity Grant to T. H. M.
REFERENCES
1. Bukau, B. & Horwich, A.L. ( 1998 ) The Hsp70 and H sp 60 chap-
erone machines. Cell 92 , 351–366.
2. Wickner, S., Maurizi, M.R. & Gottesman, S. (1999) Posttransla-
tional quality control: fold ing, refolding, and de grading proteins.
Science 286, 1888–1893.
3. Kimmins, S. & MacRae, T.H. (2000) Maturation of steroid
receptors: an example of functional cooperation amo ng m olecular
chaperones and their assoc iat ed proteins. Cell Stress Chaperones 5,
76–86.
4. MacRae, T.H. (2000) Structure and function of small heat shock/
a-crysta llin proteins: es tablish ed concepts and emerging ideas.
Cell. Mol. Life Sci. 57 , 899–913.
5. Easton, D.P., Kaneko, Y . & Subjeck, J.R. ( 2000) The Hsp110 and
Grp170 stress proteins: newly recognized relatives of t he Hsp70s.
Cell Stress Chaperones 5, 276–290.
6. de Jong, W.W., Caspers, G J. & Leunissen, J.A.M. (1998)
Genealogy of the a-crystallinCsmall heat-shock protein super-
family. Int. J. Biol. Macromol. 22, 151–162.
7. Merck, K.B., De Haar d-Hoekman, W.A., Essink, B.B.O.,
Bloemendal, H . & De Jong, W.W. (1992) Expression and aggre-
gation of recombinant aA-crystallin and its two domains. Bi ochim.
Biophys. Acta 1130, 267–276.

8. Augusteyn, R.C. (1998) a-Crystallin polymers and polymerization:
the view from down under. Int. J. Biol. Macromol. 22, 253–262.
9. Kim, K.K., Kim, R. & Kim. S H. (1998) Crystal structure of a
small heat-shock protein. Nature 394, 595–599.
10. Bova, M.P., Yaron, O., Huang, Q., Ding, L., Haley, D.A.,
Stewart, P .L. & Horwitz, J. (1999) Mutation R120G in aA-crys-
tallin, which is linked to a desmin-related myopathy, results in an
irregular structure and defective chape rone-like function. Proc.
Natl Acad. Sci. USA 96, 6137–6142.
11. Kumar, L.V.S., Ramakrishna, T. & Rao, ChM. (1999) Structural
and functional conse quences o f the mu tation o f a co nserved
arginine residue in aAandaB crystallins. J. Biol. Chem. 274,
24137–24141.
12. Sharma, K.K., Kumr, R.S., Kumar, G.S. & Quinn, P.T. (2000)
Synthesis and characterization of a pep tide identified as a fu nc-
tional element in aA-crystallin. J. Biol. Chem. 275, 3767–3771.
13. Shroff,N.P.,Cherian-Shaw,M.,Bera,S.&Abraham,E.C.(2000)
Mutation of R116C results in h ighly oligomerized aA-crystallin
with modified structure and defective chaperone-like function.
Biochemistry 39, 420–1426.
14. Carver, J .A., Esposito, G., Schwedersky, G. & Gaestel, M .
(1995)
1
H NM R spectroscopy reveals that mouse H sp25 has a
flexible C-terminal extension of 18 amino acids. FEBS Lett. 369,
305–310.
15. Lindner, R.A., Carver, J.A., Ehrnsperger, M., Buchner, J.,
Esposito,G.,Behlke,J.,Lutsch,G.,Kotlyarov,A.&Gaestel,M.
(2000) Mouse Hsp25, a small heat shock protein. The role of its
C-terminal extension in oligomerization and chaperone action.

Eur. J. Biochem. 267, 1923–1932.
16. Andley, U.P., Mathur, S., Griest, T.A. & Petrash, J.M. (1996)
Cloning, expression, and chaperone-like activity of human
aA-crystallin. J. Biol. Chem. 271, 31973–31980.
17. Smulders, R.H.P.H., Carver, J.A., Lindner, R.A., van Boekel,
M.A.M., B loemendal, H. & de Jong, W.W. (1996) Immobilization
940 J. A. Crack et al.(Eur. J. Biochem. 269) Ó FEBS 2002
of the C-terminal extension of bovine aA-crystallin r educes
chaperone-like activity. J. Biol. Chem. 271, 2 9060–29066.
18. Leroux, M.R., Melki, R., Gordon , B., Bate lier, G. & Candido,
E.P.M. (1997) Structure-function studies on small heat shock
protein oligomeric assembly and interaction with unfolded poly-
peptides. J. Biol. Chem. 272, 24646–24656.
19. van de Klundert, F.A.J.M., Smu lders, R.H.P.H., Gijsen, M.L.J .,
Lindner, R.A., Jaenicke, R., Carver, J.A. & de Jong, W.W.
(1998) The mammalian small heat-shock protein Hsp20 forms
dimers and is a poor chaperone. Eur. J. Biochem. 258, 1014–
1021.
20.Leroux,M.R.,Ma,B.J.,Batelier,G.,Melki,R.&Candido,
E.P.M. (1997) Unique structural features of a novel class of small
heat shock proteins. J. Biol. Chem. 272, 12847–12853.
21. Boelens, W.C., Croes, Y., de Ruwe, M., de Reu, L. & de Jon g,
W.W. (1998) Negative charges in the C-terminal domain
stabilize the aB-crystallin complex. J. Biol. Chem. 273, 28085–
28090.
22. Kokke,B.P.A.,Leroux,M.R.,Candido,E.P.M.,Boelens,W.C.&
de Jong, W.W. (1998) Caenorhabditis elegans small heat-shock
proteins Hsp12.2 and Hsp12.3 f orm tetramers and have no
chaperone-like activity. FEBS Lett. 433, 228–232.
23. Young, L S., Yeh, C H., Chen, Y M. & Lin, C Y. (1999)

Molecular ch aracterization of Oryza sativa 16.9 k Da h eat s hock
protein. Bi oche m. J. 344, 31–38.
24. Haley, D.A., Bova, M .P., Huang, Q L., Mchaourab, H.S. &
Stewart, P.L . (2000) Small heat-shock p rotein structures reveal a
continuum from symmetric to variable assemblies. J. Mol. Biol.
298, 261–272.
25. Bova, M.P., Mchaourab, H.S., Han, Y. & Fung, B.K K. (2000)
Subunit e xchange of small h eat sho ck proteins. Analysis of olig-
omer formation of aA-crystallin and Hsp27 by fluorescence res-
onance energy transfer and site-directed truncations. J. Biol.
Chem. 275, 1035–1042.
26. Ha
¨
rndahl, U., Kokke, B .P.A., Gustavsson, N., Linse, S., Berg-
gren, K., Tjerneld, F., Boelens, W.C. & Sundby, C. (2001) The
chaperone-like activity of a small heat shock protein is lost after
sulfoxidation of conserved methionines in a surface-exposed
amphipathic a-helix. Biochim. Biophys. Acta 1545, 227–237.
27. van den I Jssel, P.R.L.A., Overkamp, P., K nuaf, U., Ga estel, M. &
de Jong, W.W. (1994) aA-crystallin confers cellular t hermoresis-
tance. FEBS Lett. 355, 54–56.
28. Linder, B., Zhijun, J., Freedman, J.H. & Rubin, C .S. (1996)
Molecular characterization of a novel, developmentally regulated
small e mbry onic chaperone f rom Caenorhabditis elegans. J. Bio l.
Chem. 271, 30158–30166.
29. Yeh,C H.,Chang,P F.L.,Yeh,K W.,Lin,W C.,Chen,Y M.
& Lin, C Y. (1997) Expression of a gene encoding a 16.9-kDa
heat-shock protein, Oshsp16.9. Escherichia coli enhances the r-
motolerance. Proc. Natl Acad. Sci. USA 94 , 10967–10972.
30. Wiesmann, K.E.H., C oop, A., Goode, D., Hepburne -Scott, H .W .

& Crabbe, M.J.C. (1998) Effect of mutations of murine lens aB
crystallin on transfected neural cell viability and cellular translo-
cation in response to stress. FEBS Lett. 438, 25–31.
31. Muchowski, P.J. & Clark, J.I. (1998) ATP-enhanced molecular
chaperone functions of t he small heat s hock protein human aB
crystallin. Proc. Natl Acad. Sci. USA 95, 1004–1009.
32. Muchowski, P .J., Wu, G.J.S., Liang, J.J.N., Adman, E.T.
& Clark, J.I. (1999) Site-directed mu tations within the core Ôa-
crystallinÕ domain of the small heat shock protein, human aB-
crystallin, decrease molecular chaperone functions. J. Mol. Biol.
289, 397–411.
33. Guo, Z. & Cooper, L.F. (2000) An N-terminal 33-amino-acid-
deletion variant of hsp25 retains oligomerization a nd functional
properties. Biochem. Biophys. Res. Comm. 270, 183–189.
34. Andley, U.P., Song, Z., Wawrousek, E.F., Fleming, T.P. &
Bassnett, S. (2000) Differential protective activity of aA- and
aB-crystallin in lens epithelial cells. J. Biol. Chem. 275, 36823–
36831.
35. Samali, A., Robertson, J.D., Peterson, E., Manero, F., van Zeijl,
L., Paul, C., Cotgreave, I.A., Arrigo, A P. & Orrenius, S. (2001)
Hsp27 protects m itochondria of thermotolerant cells aga inst
apoptotic stimuli. Cell Stress Chaperones 6, 49–58.
36. Rajaraman, K., Raman, B. & Rao, ChM. (1996) Molten-globule
state of carbonic anhydrase binds to the chaperone-like a-crys-
tallin. J. Biol. Chem. 271, 27595–27600.
37. Sun, T X., Das, B.K. & Liang, J.J N. (1997) Conformational and
functional differences b etween recombinant human len s aA- and
aB-crystallin. J. Biol. Chem. 272, 6220–6225.
38. Wang, K. & S pector, A. (2000) a-Crystallin prevents irreversible
protein d en aturat ion and acts co op eratively with other heat-shock

proteins to renature t he stabilized p artially de natured protein in an
ATP-dependent manner. Eur. J. Biochem. 267, 4705–4712.
39. Vanhoudt, J., Aerts, T., Abgar, S. & Clauwaert, J. (1998) Quar-
ternary structure of bovine a-crystallin: influence o f temperature.
Int. J. Biol. Macromol. 22, 229–237.
40. Vanhoudt, J., Abgar, S., Aerts, T. & Clauwaert, J. (2000) Native
quaternary structure of bovine a-crystallin. Biochemistry 39, 4483–
4492.
41. van Rijk, A.F., van den Hurk, M.J.J., Renkema, W., Boelens,
W.C., de Jong, W.W. & Bloemendal, H. (2000) Characteristics of
super aA-crystallin, a product of in vitro exon shuffling. F EBS
Lett. 480, 79–83.
42. Datta, S .A. & Rao, ChM. (2000) Packing-induced conformational
and functio nal changes in the subunits of a-crystallin. J. Biol.
Chem. 275, 41004–41010.
43. Ehrnsperger, M., Gra
¨
ber, S., Gaestel, M . & Buchner, J. (1997)
Binding of non-native protein to Hsp25 during heat shock creates
a reservoir of folding intermediates for reactivation. EMBO J. 16,
221–229.
44. Lindner, R .A., Ka pur, A. & C arver, J.A . (1997) The interaction of
the molecular chaperone, a-crystallin, with molten globule states
of bovine a-lactalbumin. J. Biol. Chem. 27 2, 27722–27729.
45. Lindner, R.A., Treweek, T.M. & Carver, J.A. (2001) The molec-
ular chaperone a-crystallin is in kinetic c ompetition with aggre-
gation to s tabilize a monomeric molten-globule form o f
a-lactalbumin. Biochem. J. 354, 7 9–87.
46. Marini,I.,Moschini,R.,Corso,A.D.&Mura,U.(2000)Com-
plete protection by a-crystallin of lens sorbitol dehydrogenase

undergoing thermal stress. J. Bio l. Chem. 275, 32559–32565.
47. Jackson, S.A. & Clegg, J.S. (1996) Ontogeny of low molecular
weight stress protein p26 during early development of the brine
shrimp, Artemia franciscana . Dev. Growth Differ. 38, 153–160.
48. Clegg, J.S., Willsie, J.K. & Jackson, S.A. ( 1999) Adaptive signifi-
canceofasmallheatshock/a-crystallin protein (p26) in encysted
embryos of the brine s hrimp, Artemia franciscana. Am. Zool. 39,
836–847.
49. Liang, P. & MacRae, T.H. (1999) The synthesis of a small heat
shock/a-crystallin protein in Artemia and its relationship to stress
tolerance during development. Dev. Biol. 207, 445–456.
50. MacRae, T.H. (2001) Do stress proteins protect embryos during
metabolic arrest and diapause? I n Molecular Mechanisms o f
Metabolic Arre st. Life in Limbo (Storey, K.B., ed.), pp. 169–186.
BIOS Scientific Publishers Ltd., Oxford, UK
51. Clegg, J.S. (1997) Embryos of Artem ia franciscana su rvi ve four
years o f continuous a noxia: the c ase for comple te metabolic rate
depression. J. Exp. Biol. 200 , 467–475.
52. Clegg, J .S. & Jackson, S.A. ( 1998) The metabolic status of qui-
escent and diapause embryos of Artemia franciscana (Kellogg).
Arch. Hydrobiol. 52, 425–439.
53. Drinkwater, L.E. & Clegg, J.S. (1991) Experimental biology of
cyst diapause. In Artemia Biology (Browne,R.A.,Sorgeloos,P.&
Trotman, C.N.A., eds), pp. 93–117. CRC P ress, I nc., Boca Raton,
FL.
Ó FEBS 2002 Small heat shock/a-crystallin protein from Artemia (Eur. J. Biochem. 269) 941
54. Clegg, J.S., Jackson, S .A. & Po pov, V.I. (2000) Long-term anoxia
in encysted embryos o f the c rusta cean, Artemia franciscana: v iabil-
ity, ultrastructure and stress proteins. Cell Tiss . R es. 301, 4 33–446.
55. Warner, A.H. & Clegg, J.S. (2001) Diguanosine nucleotide me-

tabolism and the survival of Artemia embryos during years of
continuous anoxia. Eur. J. Biochem. 268, 1568–1576.
56. Clegg, J.S., Jackson, S.A., Liang, P. & MacRae, T.H. (1995)
Nuclear-cytoplasmic translocations of p rote in p26 during ae robic-
anoxic transitions in embryos o f Artemia franciscana. Exp. Cell
Res. 219, 1–7.
57. Liang, P., Amons, R., MacRae, T.H. & Clegg, J.S. (1997) Puri-
fication, structure and in vitro molecular-chaperone activity of
Artemia p26, a small heat shock/a-crystallin protein. Eur. J. Bio-
chem. 243, 225–232.
58. Liang, P., Amons, R., Clegg, J.S. & MacRae, T.H. (1997) Mole-
cular characterizat ion o f a sm all he at sho ck/a-crystallin protein in
encysted Artemia embryos. J. Biol. Chem. 272, 19051–19058.
59. MacRae, T.H. & Liang, P. (1998) Molecular characterization of
p26, a cyst-specific, small heat shock/a-crystallin protein from
Artemia franciscana. Arch. Hydrobiol. 52, 3 93–409.
60. Sambrook, J., Fritsch, E.F. & Maniatis, T. (1989) Molecular
Cloning – A Laboratory Manual Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York.
61. Muchowski, P.J., Bassuk, J.A., Lubsen, N.H. & Clark, J.I. (1997)
Human aB-crystallin. Small heat shoc k protein and molecular
chaperone. J. Biol. Chem. 272, 2578–2582.
62. Lambert, H., Cha rette, S.J., Bernier, A .F., Guimond, A. & Lan-
dry, J. (1999) H SP27 multimerization m ediated by phosphoryl-
ation–sensitive intermolecular interactions at the amino terminus.
J. Biol. C hem. 274, 9378–9385.
63. Kumar, L.V.S. & Rao, ChM. (2000) Domain swapping in human
aAandaB crystallins affects oligomerization and enhances
chaperone-like activity. J. Biol. Chem. 275, 22009–22013.
64. Smulders, R .H.P.H., van Geel, I.G., Gerards, W.L.H., Bloemen-

dal, H. & de Jong, W.W. (1995) Reduced chaperone-like activity
of aA
ins
-crystallin, an alternative splicing product containing a
large insert peptide. J. Biol. Chem. 270, 13916–13924.
65. Cobb, B.A. & Petrash, J.M. (2000) Struct ural and functional
changes in the aA-crystallin R116C mutant in hereditary cata-
racts. Biochemistry 39, 15791–15798.
66. Haslbeck,M.,Walke,S.,Stromer,T.,Ehrnsperger,M.,White,
H.E., Chen, S., Saibil, H.R. & Buchner, J. ( 1999) Hsp26: a tem-
perature-regulated chaperone. EMBO J. 18 , 6744–6751.
67. Koteiche, H.A. & Mchaourab, H.S. (1999) Folding pattern of the
a-crystallin domain in aA-crystallin determined by site-directed
spin labelling. J. Mol. B iol. 294, 561–577.
68. To
¨
ro
¨
k, Z., Goloubinoff, P., Horva
´
th, I., Tsvetkova, N.M., Glatz,
A.,Balogh,G.,Varvasovszki,V.,Los,D.A.,Vierling,E.,Crowe,
J.H. & Vigh, L. (2001) Synechocystis HSP17 is an a mphitropic
protein that stabilizes heat-stressed membranes and binds dena-
tured proteins for su bsequent chaperone-mediated refolding. Proc.
Natl Acad. Sci. USA 98, 3098–3103.
942 J. A. Crack et al.(Eur. J. Biochem. 269) Ó FEBS 2002