Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx

Nup358, a nucleoporin, functions as a key determinant of
the nuclear pore complex structure remodeling during
skeletal myogenesis
Munehiro Asally
1
, Yoshinari Yasuda
2
, Masahiro Oka
1,2
, Shotaro Otsuka
3
, Shige H. Yoshimura
3
,
Kunio Takeyasu
3
and Yoshihiro Yoneda
1,2,4
1 Japan Science and Technology Agency, Core Research for Evolutional Science and Technology, Department of Frontier Biosciences,
Graduate School of Frontier Biosciences, Osaka University, Japan
2 Department of Frontier Biosciences, Graduate School of Frontier Biosciences, Osaka University, Japan
3 Department of Responses to Environmental Signals and Stresses, Graduate School of Biostudies, Kyoto University, Japan
4 Department of Biochemistry and Molecular Biology, Graduate School of Medicine, Osaka University, Japan
Introduction
Nuclear-cytoplasmic trafficking regulates the move-
ment of molecules into and out of the nucleus and is
necessary for the survival of eukaryotic cells. The pas-
sage of molecules such as RNA, proteins and ions
across the nuclear envelope occurs through the nuclear
pore complex (NPC), a huge protein complex embed-
ded in the nuclear envelope. Small molecules (< 9 nm

in diameter) pass through the NPC by passive diffu-
sion, whereas larger molecules are transported in a
facilitated manner [1]. The selective nuclear transport
of proteins is directed by specific signal sequences:
nuclear localization signals (NLS) for import and
nuclear export signals (NES) for export. To achieve
selective transport, soluble transport factors are
Keywords
NPC remodeling; nuclear pore complex;
nuclear transport; Nup358 ⁄ RanBP2;
skeletal myogenesis
Correspondence
Y. Yoneda, Department of Frontier
Biosciences, Graduate School of Frontier
Biosciences, Osaka University, 1–3
Yamada-oka Suita Osaka 565-0871, Japan
Fax: +81 6 6879 4609
Tel: +81 6 6879 4606
E-mail:
(Received 23 August 2010, revised 26
November 2010, accepted 3 December
2010)
doi:10.1111/j.1742-4658.2010.07982.x
The nuclear pore complex (NPC) is the only gateway for molecular traf-
ficking across the nuclear envelope. The NPC is not merely a static
nuclear-cytoplasmic transport gate; the functional analysis of nucleoporins
has revealed dynamic features of the NPC in various cellular functions,
such as mitotic spindle formation and protein modification. However, it is
not known whether the NPC undergoes dynamic changes during biological
processes such as cell differentiation. In the present study, we evaluate

changes in the expression levels of several nucleoporins and show that the
amount of Nup358 ⁄ RanBP2 within individual NPCs increases during mus-
cle differentiation in C2C12 cells. Using atomic force microscopy, we dem-
onstrate structural differences between the cytoplasmic surfaces of
myoblast and myotube NPCs and a correlation between the copy number
of Nup358 and the NPC structure. Furthermore, small interfering RNA-
mediated depletion of Nup358 in myoblasts suppresses myotube formation
without affecting cell viability, suggesting that NUP358 plays a role in
myogenesis. These findings indicate that the NPC undergoes dynamic
remodeling during muscle cell differentiation and that Nup358 is promi-
nently involved in the remodeling process.
Abbreviations
AFM, atomic force microscopy; DM, differentiation medium; EDMD, Emery–Dreifuss muscular dystrophy; EGFP, enhanced green
fluorescent protein; GM, growth medium; MyHC, myosin heavy chain; NES, nuclear export signal; NLS, nuclear localization signal;
NPC, nuclear pore complex.
610 FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS
required to interact with both cargo substances and
the NPC. One of the best characterized nuclear protein
import pathways is mediated by the importin-a ⁄ b hete-
rodimer, which imports basic NLS-containing proteins.
Conversely, the nuclear export of leucine-rich NES-
containing proteins is mediated by CRM1 (also known
as exportin-1) [1–3].
A gradient of the small GTPase, RanGTP ⁄ GDP,
across the nuclear envelope regulates the binding and
release of cargo by transport factors. RanGTP is abun-
dant in the nucleus as a result of the activity of RCC1,
a guanine nucleotide exchange factor for Ran. Con-
versely, the concentration of RanGDP is high in the
cytoplasm as a result of the action of RanGAP, which

promotes cytoplasmic GTP hydrolysis by Ran in con-
junction with RanBP1 and ⁄ or Nup358 (also known as
RanBP2). RanGTP interacts with transport factors
and regulates the formation of transport complexes.
GTP hydrolysis by Ran in the cytoplasm drives disso-
ciation of the export cargo from the export complex,
whereas RanGTP promotes disassembly of the import
complex in the nucleus [1,2].
The NPC is composed of approximately 30 distinct
proteins, known as nucleoporins [4], whose functional
analyses have recently attracted much attention. The
general architecture of the NPC is evolutionarily con-
served in all eukaryotes and consists of filaments on
the cytoplasmic surface and spoke rings and a basket-
like structure on the nuclear side of the envelope [5].
In recent years, nucleoporins have been found to play
dynamic roles in a variety of cellular functions, in
addition to their well known function as structural
components of the nuclear pore. For example, nucleo-
porins have been shown to be involved in protein
modification and the regulation of mitotic spindle for-
mation [6]. Nup358 and the Nup107–160 subcomplex
are localized to kinetochores during mitosis and play a
role in spindle assembly [7]. It has long been suggested
that nucleoporins are ubiquitously expressed in all cell
types and at all developmental stages, although recent
studies indicate that some nucleoporins, such as gp210,
are expressed in a cell type- and tissue-specific manner
[8,9]. In addition, the structural composition of the
NPC changes during cell differentiation [10], although

it is still unknown whether alterations in NPC archi-
tecture play an important role in cellular differentia-
tion.
C2C12 cells are a well established model system for
skeletal muscle differentiation. In high-serum growth
medium (GM), these cells grow as mononuclear myo-
blasts, although they fuse to form multinuclear myotu-
bes when cultured in low-serum differentiation
medium (DM). Dynamic remodeling of the nuclear
envelope was reported during C2C12 skeletal muscle
differentiation [11], including changes in the distribu-
tion of lamins, which are components of the nuclear
envelope lamina. Mutations within A-type lamin are
known to cause several muscle diseases, including
Emery–Dreifuss muscular dystrophy (EDMD), and the
over-expression of a lamin A ⁄ C mutant in C2C12 cells
has been shown to reliably mimic the features of
EDMD [12]. Inner nuclear envelope proteins are also
known to regulate NPC dynamics [13]. Understanding
NPC dynamics during muscle differentiation will not
only provide novel information regarding NPC func-
tion, but also will contribute to a better understanding
of the pathogenesis of muscular disorders such as
EDMD.
In the present study, we examine NPC remodeling
and its associated functional changes during skeletal
muscle differentiation in a C2C12 murine myoblast cell
line. We compare the composition, architecture and
nuclear-cytoplasmic transport activity of NPCs in
myoblasts and myotubes. We find that dynamic

remodeling of the NPC occurs during muscle cell
differentiatin.
Results
Expression patterns of nucleoporins are altered
from myoblasts to myotubes
To determine the expression levels of NPC compo-
nents (nucleoporins) during skeletal muscle cell differ-
entiation, we used real-time PCR to quantify the
mRNA levels of each nucleoporin in C2C12 cells
before and after the induction of differentiation
(Fig. 1). Approximately half of the nucleoporin
mRNAs (i.e. Nup107, Nup85, Nup160, Nup43, Nup37,
Nup35, Nup205, Nup188, Pom121, Ndc1, Nup155,
Nup54, Nup62, NupL1, Nup153 and Nup50) were
down-regulated after the induction of myogenesis. By
contrast, the expression levels of some nucleoporin
mRNAs (i.e. Nup214, Nup88, NupL2 (CG1), Nup133,
Seh1, Nup93, Gp210, Nup98, Rae1 and Tpr) remained
largely unchanged, and the remaining nucleoporin
mRNAs (i.e. Nup358 and Sec13) were slightly up-regu-
lated. These results indicate that the relative expression
levels of individual nucleoporins change during muscle
cell differentiation.
To examine the protein levels of specific nucleopo-
rins, we prepared C2C12 cell lysates at different stages
of muscle cell differentiation and immunoblotted with
available antibodies against several nucleoporins.
Lysates from C2C12 cells grown in GM and from cells
differentiated for either 2 or 5 days in DM were
M. Asally et al. Roles of Nup358 in skeletal myogenesis

FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS 611
analyzed. As shown in Fig. 2A, the protein level of
Nup358, a component of the cytoplasmic filaments of
the NPC, gradually increased as muscle cell differentia-
tion proceeded. All other nucleoporins tested (Nup160,
Nup98, Nup93 and Nup62) showed no obvious
changes in protein expression levels during differentia-
tion. Furthermore, immunofluorescence analysis of
Nup358 revealed a stronger signal in myotubes com-
pared to myoblasts, whereas the Nup98 signal
appeared to be unaltered (Figs 2B and S1). By con-
trast, although anti-Nup358 staining also showed an
intracellular signal (Fig. 2B), we considered the intra-
nuclear signal to be nonspecific (Doc. S1A). We next
focused on the nuclear envelope signal of anti-Nup358
staining. To definitely verify the increased expression
of Nup358 at the NPCs of myotubes, we examined the
Nup358 binding partners, RanGAP and CRM1, which
localize to the nuclear rim in a Nup358-dependent
manner [2]. RanGAP staining at the nuclear envelope
was much stronger in myotubes than in myoblasts
(Fig. 2C). Although CRM1 staining in myoblasts and
myotubes was comparable when the cells were permea-
bilized after formaldehyde fixation, the differences
became more evident when the cells were fixed with
formaldehyde containing Triton X-100, with stronger
CRM1 signals being observed for myotubes than for
myoblasts (Fig. 2D). These immunostaining patterns
of Nup358, CRM1 and RanGAP clearly reveal that
Nup358 expression is up-regulated during skeletal

myogenesis in C2C12 cells.
To determine whether this increase in Nup358 on
the nuclear envelope corresponded to an increase in
the number of Nup358 proteins in each NPC, we mea-
sured NPC density. Consistent with a recent study
[14], nuclear pore density was similar in myoblasts and
myotubes (Fig. 2E), indicating that the composition of
the myoblast NPC must differ from that of the myo-
tube NPC. Specifically, the number of Nup358 pro-
teins within individual NPCs increase during skeletal
muscle differentiation.
An architectural change in the NPC occurs during
differentiation from myoblasts to myotubes
Because the composition of the NPC changes during
differentiation (Figs 1 and 2), we attempted to visual-
ize the structure of NPCs at the nanoscale level using
atomic force microscopy (AFM). As shown in
Fig. 3A, AFM images of the NPCs in myoblasts and
myotubes were successfully captured. It was previ-
ously observed that the centers of some NPCs are
plugged by complexes passing through the NPC
[15–17]. Consistent with these studies, we observed
that 29.3% of the NPCs in myoblasts were plugged,
whereas 54.4% of NPCs in myotubes were plugged
(Fig. 3B).
Fig. 1. The relative mRNA expression levels of nucleoporins differ during muscle differentiation. C2C12 cells were grown in GM (blue bars)
or for 2 days in DM (red bars). Nucleoporin mRNA levels were analyzed by real-time PCR (n = 3, PCR reaction; n = 2, RNA extraction) and
normalized to tubulin. Error bars represent the SEM.
Roles of Nup358 in skeletal myogenesis M. Asally et al.
612 FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS

The NPC characteristics measured in the AFM
profiles were: outer diameter (O), height (H) and upper
rim diameter (Fig. 3C). The values were statistically
analyzed (U) using the Mann–Whitney U-test
(P < 0.05 was considered statistically significant). The
outer diameter of NPCs did not differ significantly
between myoblasts and myotubes (Figs 3D and S2A).
Myotubes contain greater amounts of Nup358 than do
myoblasts (Figs 1 and 2) and, because Nup358 is local-
ized in the cytoplasmic filaments of NPCs, we sus-
pected that the heights of myotube NPCs might be
greater than those of myoblasts. NPC height appeared
to not be significantly different in myotubes and myo-
blasts (P > 0.05) when unplugged and plugged NPCs
were analyzed separately (Fig. 3F).
By contrast, the mean ± SEM upper rim diameter
increased significantly, from 72.5 ± 1.3 nm (n = 99)
in myoblasts to 81.6 ± 1.3 nm (n = 68) in myotubes
(Fig. 3E). This trend was observed even when
unplugged and plugged NPCs were analyzed separately
(Fig. 3D, E) and the different distributions of NPC
upper rim diameters in myoblasts and myotubes are
clearly demonstrated in a histogram (Fig. S2C). The
upper rim diameter of the NPC increased by approxi-
mately 9 nm during myotube formation, whereas the
outer diameter and the height of the NPC were not
significantly changed. Thus, the shape of the NPCs in
myoblasts differs from that in myotubes.
Nup358 is a cytoplasmically exposed component of
the NPC [18] and was increased within individual

NPCs during muscle differentiation. Thus, we hypothe-
sized that increased Nup358 in individual NPCs was
responsible for the change in NPC upper rim diameter.
To test this, we used AFM to visualize Nup358-
depleted NPCs. AFM analysis of NPCs revealed that
the upper rim diameter of Nup358-depleted NPCs was
smaller than for NPCs in control small interfering
RNA (siRNA)-treated cells (Fig. 4B). By contrast, the
height and outer diameter of Nup358-depleted NPCs
did not differ significantly from those of the control
NPCs (Fig. 4A, C). These results indicate that the
Nup358 copy number within individual NPCs is
Fig. 2. The level of Nup358 protein increases during skeletal myogenesis. (A) C2C12 cells were grown in GM (0 days) or in DM for 2 or
5 days. Immunoblotting analysis was performed with antibodies against a-tubulin, MyHC (muscle marker protein), Nup160, Nup98, Nup93,
Nup62 and mAb414. (B–D) C2C12 myoblast cells (MB) and myotube cells (MT) were cultured on coverslips. The Nup358 cells were fixed
and stained with antibodies against Nup358, Nup98 or RanGAP1 (C). The cells were fixed with (D, lower panels) or without (D, upper panels)
Triton X-100 and then permeabilized and stained with an antibody against CRM1. Cells were observed with confocal microscopy (LSM510).
Scale bars = 5 lm. (E) Myoblasts and myotubes were stained for RL1. NPC density was determined by counting the dots on the nuclear
envelope (mean ± SD).
M. Asally et al. Roles of Nup358 in skeletal myogenesis
FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS 613
closely correlated with the upper rim diameter. We
conclude that the architecture of the NPC changes
during muscle differentiation and that Nup358 is a
critical determinant of the NPC architecture.
Passive diffusion rate is the same in myoblasts
and myotubes
We next compared molecular trafficking through the
NPCs in myoblasts and myotubes because the NPC is
the only gateway for nuclear-cytoplasmic traffic. We

observed both compositional and architectural differ-
ences between NPCs in these two cell types. First, we
used fluorescence recovery after photobleaching analy-
sis to examine the passive diffusion rate in C2C12 cells
stably expressing enhanced green fluorescent protein
(EGFP), a protein small enough to passively diffuse
through the NPC. The nuclear EGFP was photo-
bleached, fluorescence recovery was monitored
(Fig. 5A) and the relative intensity of fluorescence in
the nucleus was plotted over time (Fig. 5B). In the
early phase, the fluorescence recovery curves for myo-
blasts and myotubes overlapped with each other, indi-
cating that the passive diffusion rate through the NPC
is the same in myoblasts and myotubes. We observed
apparent differences in the fluorescence intensity at
Fig. 3. Structural differences between myoblast and myotube NPCs. (A) Denuded nuclei from myoblasts and myotubes visualized by AFM.
The area shown is 3 · 3 lm. Scale bar = 0.5 lm. (B) The percentage of unplugged and plugged NPCs. (C) The NPC profile was taken from
each NPC image and three measurements were obtained for each NPC profile. O, I, and H represent the outer diameter, upper rim diameter
and height, respectively. Outer and upper rim diameters indicate the distance between two points on the NPC ring base and on the cyto-
plasmic ring, respectively. Height indicates the vertical distance between the NPC cytoplasmic surface and the base. Scale bar = 50 nm. (D)
The outer diameter was measured and plotted [mean ± SEM; 145.4 ± 2.4 nm, n = 58 (MB); 144.8 ± 3.7 nm, n = 23 (MT) for unplugged and
143.9 ± 2.2 nm, n = 29 (MB); 145.7 ± 2.5 nm, n = 37 (MT) for plugged]. (E) The upper rim diameter was measured and plotted [mean ±
SEM; 70.2 ± 1.9 nm, n = 58 (MB); 78.1 ± 2.3 nm, n = 23 (MT) for unplugged, and 76.1 ± 1.5 nm, n = 29 (MB); 83.2 ± 1.7 nm, n = 37 (MT)
for plugged]. (F) The height was measured and plotted [mean ± SEM; 5.5 ± 0.16 nm, n = 116 (MB); 5.43 ± 0.31 nm, n = 46 (MT) for
unplugged, and 5.2 ± 0.22 nm, n = 58 (MB); 4.8 ± 0.17 nm, n = 74 (MT) for plugged]. Data were statistically compared by Mann–Whitney
U-tests.
Roles of Nup358 in skeletal myogenesis M. Asally et al.
614 FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS
steady state, although this is likely a result of a
difference in the ratio of the bleached nuclear area to

the total cell volume (Doc. S1B).
Nuclear export appears to be more active in
myotubes than in myoblasts
We next compared the nuclear transport activities
before and after muscle differentiation, using microin-
jection to examine the rate of active nuclear-cytoplas-
mic protein transport. Either GST-SV40NLS-GFP
(NLS-GFP) or GST-GFP-RevNES-SV40NLS (GFP-
NES-NLS) recombinant protein was microinjected into
the cytoplasm of C2C12 cells, and the rate of nuclear
transport was observed using time-lapse fluorescence
microscopy. The nuclear import efficiency of NLS-
GFP did not differ significantly in myoblasts and myo-
tubes (Fig. 6A and Videos S1 and S2), suggesting that
nuclear import activity is almost identical in myoblasts
and myotubes.
By contrast, the subcellular localization of microin-
jected GFP-NES-NLS was clearly different in the two
cell types. In myoblasts, GFP-NES-NLS was primarily
localized to the nucleus, whereas, in myotubes, it was
evenly distributed between the nucleus and the cyto-
plasm (Fig. 6B and Videos S3 and S4). It is important
to note that myotubes are polykaryons, whereas myo-
blasts have one nucleus. To address the possible effect
of this difference on the subcellular distribution of
GFP-NES-NLS, myoblasts were fused using polyethyl-
ene glycol and GFP-NES-NLS was microinjected into
the cytoplasm of the fused cells (Fig. 6D). The locali-
zation in the fused cells was very similar to that in nor-
mal myoblasts, indicating that the differential

distribution of GFP-NES-NLS observed in myoblasts
and myotubes is not simply a result of the difference
in nuclear number. Additionally, treatment of myotu-
bes with leptomycin B, a specific inhibitor of CRM1-
mediated nuclear export, caused the accumulation of
GFP-NES-NLS proteins in the nucleus (Fig. 6C),
showing that GFP-NES-NLS protein is actively shut-
tled across the nuclear envelope in myotubes. Taken
together with the data from the NLS injections, these
results strongly suggest that nuclear export efficiency is
increased in myotubes relative to myoblasts.
siRNA-mediated Nup358 depletion suppresses
myotube formation
To determine whether Nup358 is necessary for C2C12
differentiation, we performed siRNA experiments
using two different sets of siRNA duplexes against
Nup358. As indicated, both Nup358 siRNAs effec-
tively reduce Nup358 expression (Fig. 7A). Immunoflu-
orescence staining demonstrated a marked reduction in
the nuclear rim signal for Nup358 in siNup358-treated
cells (Fig. 7B). Furthermore, the nuclear rim signal of
RanGAP, which localizes to the nuclear envelope in a
Nup358-dependent manner, was clearly diminished
(Fig. 7B). Other nucleoporins (Nup214, Nup98 and
Nup62) remained unaltered at the nuclear rim in
Nup358-depleted cells (Fig. 7B), indicating that the
depletion of Nup358 did not affect all NPC compo-
nents.
Microinjection analysis of the GFP-NES-NLS trans-
port substrates suggested that nuclear import and

export of proteins was globally unaffected in Nup358-
depleted cells (Figs 7C and S3). Under these condi-
tions, the siRNA-treated C2C12 myoblasts were
cultured in DM and then stained for myosin heavy
chain (MyHC; green) and DNA (blue). As shown in
Fig. 7D, the efficiency of multinuclear myotube forma-
tion was clearly decreased in Nup358-depleted cells,
whereas the control cells (left two panels) efficiently
underwent myotube formation. These results indicate
that Nup358 is specifically involved in muscle cell
differentiation.
Discussion
In the present study, we have demonstrated that both
the composition and the architecture of NPCs are
altered during the differentiation of C2C12 cells. Our
real-time PCR data indicate that the mRNA expres-
sion levels of several nucleoporins differ between myo-
blasts and myotubes (Fig. 1). The mRNA levels of a
large proportion of nucleoporins decreased during dif-
ferentiation (i.e. Nup107, Nup85, Nup160, Nup43,
Nup37, Nup35, Nup205, Nup188, Pom121, Ndc1,
Fig. 4. Nup358 depletion decreases the upper rim diameter of the
NPC. C2C12 cells were transfected with nontargeting siRNA or
Nup358 siRNA oligonucleotides (siNup358-2) and incubated for
48 h. The outer diameter (A), upper rim diameter (B) and height (C)
of the NPC were measured and shown in a graph as in Fig. 3.
M. Asally et al. Roles of Nup358 in skeletal myogenesis
FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS 615
Nup155, Nup54, Nup62, NupL1, Nup153 and Nup50).
Notably, most of the nucleoporins for which mRNA

expression was maintained during differentiation (e.g.,
Nup358, Nup214, Nup88 and NupL2 (CG1), Nup98,
Rae1 and Tpr) are involved in the nuclear export of
proteins or mRNA, indicating that the relative expres-
sion of the nucleoporins involved in nuclear export
increased during myogenesis. Consistent with this, we
found that nuclear export in myotubes was more active
than that in myoblasts (Fig. 6), whereas the rates of
nuclear import (Fig. 6) and passive diffusion (Fig. 5)
remained constant.
We also showed protein expression levels of some
nucleoporins by immunoblotting (Fig. 2). Although
real-time PCR showed decreased expression of Nup107
and Nup62, their protein expression appeared to be
equivalent, as indicated by immunoblotting. An expla-
nation for such discrepancies of nucleoporin expression
levels between qPCR and immunoblot results was
offered by a recent study [14] demonstrating that some
scaffold nucleoporins, such as members of the
Nup107-160 subcomplex, have extremely long protein
half-lives compared to other nucleoporins. Thus, pro-
teins levels remain stable, even if mRNA expression
levels are decreased. We specifically demonstrated that
the copy number of Nup358 within individual NPCs
increases during C2C12 muscle differentiation, at both
mRNA (Fig. 1) and protein (Fig. 2) levels. Nup358
plays a supportive role in CRM1-mediated nuclear
export by stimulating CRM1 recycling [2]. Nup358
provides a platform for the disassembly of CRM1
export complexes and the re-import of free CRM1 to

the nucleus [19]. As shown in Fig. 2D, CRM1 signals
on the NPC were increased in myotubes compared to
myoblasts, coinciding with the increase of Nup358
in myotube NPCs. Although we were unable to
demonstrate the direct effects of Nup358 on protein
export in myotubes (Fig. 7C), it is possible that the
Fig. 5. The efficiency of passive diffusion though the NPC is the same in myoblasts and myotubes. (A) C2C12 cells stably expressing EGFP
were photobleached for 4 s and fluorescence recovery was monitored immediately after bleaching. (B) Data were normalized to the
pre-bleaching value of 100% and plotted against time [mean ± SEM; n = 5 (myoblasts), n = 12 (myotubes)].
Roles of Nup358 in skeletal myogenesis M. Asally et al.
616 FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS
relative increase in several nucleoporins, which are
known to function in protein export, rather than the
increase of Nup358 alone, may cause the activation of
CRM1 in myotubes. It is therefore likely that an
increase in Nup358 during myogenesis supports the
CRM1 activity and is involved in the activation of
nuclear protein export in myotubes.
It is highly possible that a selective increase in the
efficiency of nuclear protein export triggers the redistri-
bution of a number of key molecules important for cell
differentiation and that the difference in nuclear export
activity between myotubes and myoblasts affects cell
differentiation from myoblasts to myotubes. For exam-
ple, HDAC5 (histone deacetylase 5) is known to move
from the nucleus to the cytoplasm during myotube for-
mation in a differentiation-dependent manner and is
involved in the control of cellular differentiation in
C2C12 [20,21]. Similarly, the regulation of nuclear-
cytoplasmic transport by importin-a subtype switching

was shown to trigger cell differentiation [22]. Further
studies will be required to elucidate this possibility.
The structure of the NPC changes to allow adapta-
tion to different cellular environments during differen-
tiation [8–10]. In the present study, using AFM, we
found that the architecture of the NPC changes during
muscle differentiation and that Nup358 is a key deter-
minant of NPC architecture. In addition, we showed
that the depletion of Nup358 prevented myotube for-
mation (Fig. 7). These results indicate that Nup358
affects the structure of the NPC and plays a role in
muscle cell differentiation. Recent evidence suggests
that the NPCs are closely related to the transcriptional
machinery [6] and thus it is also possible that the
structural changes induced by Nup358 modulate the
transcription of genes required for cell differentiation.
Furthermore, Nup358 is known to be a multifunction-
al protein that acts as both an allosteric activator for
kinesin [23] and a SUMO E3 ligase [24]. Nup358 may
therefore contribute to muscle differentiation in C2C12
cells in various ways.
In conclusion, in the present study, we demonstrate
that the NPC is functionally and structurally regulated
during muscle cell differentiation and that Nup358 is
required for muscle cell differentiation and also is
likely involved in the remodeling of the NPC.
Materials and methods
Cells and antibodies
C2C12 myoblast cells were cultured in GM consisting of
DMEM (D5796; Sigma, St Louis, MO, USA) supplemented

with 10% fetal bovine serum. The cells were maintained in an
incubator at 5% CO
2
and 37 °C. To induce differentiation,
Fig. 6. Active nuclear export through NPCs
is facilitated in myotubes. GST-SV40NLS-
GFP (A) or GST-GFP-RevNES-SV40NLS (B)
recombinant protein was microinjected with
an injection marker into the cytoplasm of
C2C12 cells and then incubated for 10 min
at 37 °C (for NLS substrate, see Videos S1
and 2; for NES-NLS substrate, see Videos
S3 and 4). Scale bars = 50 lm. (C) GST-
GFP-RevNES-SV40NLS protein was microin-
jected with an injection marker into the
cytoplasm and then incubated in LMB-con-
taining medium for 10 min at 37 °C. Scale
bar = 20 lm. (D) C2C12 myoblast cells
were fused using polyethylene glycol (PEG).
Recombinant GST-GFP-RevNES-SV40NLS
protein was microinjected with an injection
marker into the cytoplasm of PEG-fused
myoblasts. The cells were incubated in
DMEM for 10 min at 37 °C. Scale
bar = 20 lm.
M. Asally et al. Roles of Nup358 in skeletal myogenesis
FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS 617
GM was replaced with DM consisting of DMEM with 3%
horse serum for 2–5 days. For poly(ethylene glycol) fusion,
cells were incubated in 50% PEG-8000 in DMEM (D5796;

Sigma) for 1 min and washed with NaCl ⁄ P
i
. Cells were
then cultured for 2 h in an incubator at 5% CO
2
and
37 °C.
Anti-Nup98 sera were kindly provided by Tachibana
et al. [25]. Antibodies purchased from commercial sources
were: mAb414 (MMS-120p; Covance, Princeton, NJ,
USA), anti-Nup214 (sc-26055; Santa Cruz Biotechnology,
Santa Cruz, CA, USA), anti-Nup160 (sc-27401; Santa Cruz
Biotechnology), anti-Nup107 (A301-787A; Bethyl, Mont-
Fig. 7. Depletion of Nup358 from C2C12 cells by siRNA. C2C12 cells were mock-transfected (no siRNA) or transfected with nontargeting
siRNA or Nup358 siRNA oligonucleotides (siNup358-1, -2) and incubated for 48 h. (A) Immunoblotting analysis with mAb414 was performed
48 h after transfection. Nup62 was used as a loading control. (B) Immunofluorescence was performed with antibodies against Nup358, Ran-
GAP1, Nup214, Nup98 and Nup62. Scale bars = 10 lm. (C) C2C12 cells were transfected with nontargeting siRNA or Nup358 siRNA oligo-
nucleotide and incubated for 48 h. Recombinant GST-GFP-RevNES-SV40NLS protein was microinjected with an injection marker into the
cytoplasm of C2C12 cells transfected with siRNA oligonucleotides. (D) C2C12 cells were mock-transfected (no siRNA) or transfected with
nontargeting siRNA or Nup358 siRNA oligonucleotides (siNup358-1, -2). The cells were induced to differentiate 2 days after transfection and
cultured in DM without transfection reagents for 2.5 days. The cells were fixed and stained with anti-MyHC (green) and Hoechst 33342
(blue). Scale bar = 100 lm.
Roles of Nup358 in skeletal myogenesis M. Asally et al.
618 FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS
gomery, TX, USA), anti-Nup358 (PA1-082; Affinity BioRe-
agents, Golden, CO, USA), anti-Nup93 (551976; BD
Pharmingen, San Diego, CA, USA), anti-Nup62 (N43620;
Transduction Lab, Lexington, KY, USA), anti-skeletal
myosin heavy chain (M4276; Sigma) and anti-a-tubulin
(T9026; Sigma).

Plasmids and recombinant proteins
For recombinant GST-GFP-NES-NLS, synthesized oligo-
nucleotides for RevNES (5¢-GATCTCCTCTTCAGCTA
CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA
GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA
GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG
A-3¢) were annealed and inserted into the BglII and HindIII
sites of pEGFP-NLS. The oligonucleotide fragment for
NES-NLS was flanked with BglII and BamHI, and then
inserted into the BamHI site of pGEX-hGFP. Recombinant
GST-GFP-NES-NLS and GST-NLS-GFP proteins were
expressed and purified as described previously [3].
Real-time PCR
Total RNA from C2C12 cells was purified using the RNeasy
kit (Qiagen, Valencia, CA, USA) and cDNA was synthesized
using SuperScript III reverse transcriptase (Invitrogen,
Carlsbad, CA, USA). Quantitative real-time PCR was per-
formed using FastStart SYBR Green Master (Roche, Basel,
Switzerland) with an ABI PRISM 7900HT (Applied Biosys-
tems, Foster City, CA, USA). Primer sets were designed by
Primer Bank [26] and are listed in Table S1.
RNA interference
Cells were either mock-transfected or transfected with syn-
thesized siRNAs [nontargeting, 5¢-GCAGCAUCUUUAAU-
GAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG
dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd
TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢
(siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢
and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ (siNup-
358-2)]. Transfection with a specific siRNA was performed

using RNAi Max (Invitrogen) in accordance with the manu-
facturer’s instructions. The transfected cells were harvested
48 h (for Nup358) or 72 h (for Nup107) after transfection
and fixed for immunofluorescence, lysed for immunoblotting
or used for induced myotube formation in DM without siR-
NA reagents.
Immunoblotting and immunofluorescence
For immunoblotting, C2C12 cells were lysed in NP-40 buf-
fer (150 mm sodium chloride, 1% NP-40 and 50 mm Tris,
pH 8.0), analyzed by SDS ⁄ PAGE and immunoblotted
using Immobilon-P (Millipore, Billerica, MA, USA) with
standard semidry methods. The ECLÔ detection reagent
(GE Healthcare, Milwaukee, WI, USA) was used for pro-
tein visualization.
For immunofluorescence, C2C12 cells were grown on
glass coverslips (Matsunami, Osaka, Japan). The cells were
washed twice in NaCl ⁄ P
i
, fixed with 3.7% formaldehyde in
NaCl ⁄ P
i
for 10 min, and permeabilized with 0.5% Triton
X-100 in NaCl ⁄ P
i
for 5 min. For Nup358 staining, the cells
were permeabilized simultaneously with fixation. After incu-
bation with 5% skim milk in NaCl ⁄ P
i
, antibodies were
incubated with the cells for 1 h. The cells were washed with

NaCl ⁄ P
i
and incubated with Alexa 488- or 546-conjugated
antibodies for 1 h. Samples were then thoroughly washed
with NaCl ⁄ P
i
and mounted in NaCl ⁄ P
i
-glycerol plus 1,4-
diazabicyclo[2.2.2]octane. DNA was counterstained with
Hoechst 33342. All procedures for immunofluorescence
were performed at room temperature. The stained cells
were observed with a laser-scanning LSM510 microscope
(Carl Zeiss, Oberkochen, Germany).
Calculation of NPC density
For the measurement of NPC density, methanol ⁄ acetone-
fixed cells were stained with mAb414. NPC number in a
2 · 2 lm area was counted for both myoblast and myotube
nuclei. The fluorescence intensity of a spot was used to deter-
mine how many pores existed in a diffraction-limited area.
AFM
AFM was performed in contact mode with a Molecular
Force Probe 3D (MFP-3D; Asylum Research, Santa Bar-
bara, CA, USA) using a microcantilever OMCL TR-400
PSA (Olympus, Tokyo, Japan). To prepare the AFM sam-
ple, myoblast and myotube cells were cultured on an eight-
well slide glass (MP Biomedicals, LLC, Santa Ana, CA,
USA). The cells were treated with hypotonic buffer (40 m m
NaCl, 5.4 mm KCl, 0.8 mm MgCl, 1 m m NaH
2

PO
4
and
10 mm Hepes, pH 7.4) for 3 min and then treated with buf-
fer X (1% Triton X-100, 75 mm KCL, 15 mm NaCl and
20 mm Mops, pH 7.4) for 6 min. Denuded nuclei were fur-
ther washed with buffer W (15.5 mm NaCl, 70 mm KCl,
6.5 mm K
2
HPO
4
and 1.5 mm NaH
2
PO
4
) and fixed with 1%
glutaraldehyde and 3.7% formaldehyde in NaCl ⁄ P
i
for
15 min. Finally, the nuclei were rinsed with Milli-Q water
(Millipore) and air-dried. Data were analyzed with Igor-Pro
(Wavemetrix Inc., Portland, OR, USA) and statistical anal-
yses were performed with GraphPad Prism 4 (GraphPad
Software Inc., San Diego, CA, USA).
Fluorescence recovery after photobleaching
To establish stable cell lines, transfection was carried out
with Effectene Transfection Reagent (Qiagen). Ssp1-
digested pIRES-puro3-EGFP was transfected into C2C12
M. Asally et al. Roles of Nup358 in skeletal myogenesis
FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS 619

cells. One day after transfection, the cells were cultured in
1.2 mgÆmL
)1
puromycin-containing DMEM supplemented
with 10% fetal bovine serum. After confirming their ability
to differentiate, cells were maintained in 1.0 mgÆmL
)1
puro-
mycin-containing medium. For live imaging, the cells were
cultured in l-dishes (ibidi, Martinsried, Germany). Confo-
cal imaging of EGFP was performed with a laser-scanning
LSM510 microscope (Carl Zeiss; · 63 ⁄ 1.4) at 128 · 128
pixels. For fluorescence recovery after photobleaching anal-
ysis, a 14 · 14 pixel area within the nucleus was photo-
bleached for 4 s. After photobleaching, images were
recorded every 2 s for 5 min at 37 °C.
Microinjection and live cell observation
C2C12 myoblast and myotube cells were cultured on cover-
slips and microinjection experiments were performed as
described previously [3]. After microinjection of reporter
proteins into the cytoplasm, the cells were observed with a
laser-scanning LSM510 microscope (Carl Zeiss; · 40 ⁄ 0.6) at
37 °C. Images were recorded every 10 s.
Acknowledgements
We thank Dr Yasuyuki Okawa for kindly providing
the C2C12 cell line; Dr Taro Tachibana for kindly
providing anti-Nup98 sera; Dr Jomon Joseph for the
pEGFP-Nup358 construct; and Dr Miki Hieda, Dr
Yoichi Miyamoto and members of the Yoneda labora-
tory for their helpful suggestions and comments. This

work was supported in part by grants from the Minis-
try of Education, Culture, Sports, Science and Tech-
nology (MEXT) of Japan, as well as from the Takeda
Science Foundation.
References
1 Terry LJ, Shows EB & Wente SR (2007) Crossing the
nuclear envelope: hierarchical regulation of nucleocyto-
plasmic transport. Science 318, 1412–1416.
2 Hutten S & Kehlenbach RH (2007) CRM1-mediated
nuclear export: to the pore and beyond. Trends Cell
Biol 17, 193–201.
3 Imamoto N, Shimamoto T, Takao T, Tachibana T,
Kose S, Matsubae M, Sekimoto T, Shimonishi Y &
Yoneda Y (1995) In vivo evidence for involvement of a
58 kDa component of nuclear pore-targeting complex
in nuclear protein import. EMBO J 14, 3617–3626.
4 Cronshaw JM, Krutchinsky AN, Zhang W, Chait BT &
Matunis MJ (2002) Proteomic analysis of the mamma-
lian nuclear pore complex. J Cell Biol 158, 915–927.
5 D’Angelo MA & Hetzer MW (2008) Structure, dynam-
ics and function of nuclear pore complexes. Trends Cell
Biol 18, 456–466.
6 Tran EJ & Wente SR (2006) Dynamic nuclear pore
complexes: life on the edge. Cell 125, 1041–1053.
7 Chan GK, Liu ST & Yen TJ (2005) Kinetochore
structure and function. Trends Cell Biol 15, 589–598.
8 Lupu F, Alves A, Anderson K, Doye V & Lacy E
(2008) Nuclear pore composition regulates neural
stem ⁄ progenitor cell differentiation in the mouse
embryo. Dev Cell 14, 831–842.

9 Olsson M, Scheele S & Ekblom P (2004) Limited
expression of nuclear pore membrane glycoprotein 210
in cell lines and tissues suggests cell-type specific nuclear
pores in metazoans. Exp Cell Res 292, 359–370.
10 Perez-Terzic C, Faustino RS, Boorsma BJ, Arrell DK,
Niederlander NJ, Behfar A & Terzic A (2007) Stem
cells transform into a cardiac phenotype with remodel-
ing of the nuclear transport machinery. Nat Clin Pract
Cardiovasc Med 4(Suppl 1), S68–S76.
11 Markiewicz E, Ledran M & Hutchison CJ (2005)
Remodelling of the nuclear lamina and nucleoskeleton
is required for skeletal muscle differentiation in vitro.
J Cell Sci 118, 409–420.
12 Ostlund C, Bonne G, Schwartz K & Worman HJ
(2001) Properties of lamin A mutants found in Emery-
Dreifuss muscular dystrophy, cardiomyopathy and
Dunnigan-type partial lipodystrophy. J Cell Sci 114,
4435–4445.
13 Maeshima K, Yahata K, Sasaki Y, Nakatomi R,
Tachibana T, Hashikawa T, Imamoto F & Imamoto
N (2006) Cell-cycle-dependent dynamics of nuclear
pores: pore-free islands and lamins. J Cell Sci 119,
4442–4451.
14 D’Angelo MA, Raices M, Panowski SH & Hetzer MW
(2009) Age-dependent deterioration of nuclear pore
complexes causes a loss of nuclear integrity in postmi-
totic cells. Cell 136, 84–295.
15 Beck M, Lucic V, Forster F, Baumeister W & Medalia
O (2007) Snapshots of nuclear pore complexes in action
captured by cryo-electron tomography. Nature 449,

611–615.
16 Kramer A, Ludwig Y, Shahin V & Oberleithner H
(2007) A pathway separate from the central channel
through the nuclear pore complex for inorganic ions
and small macromolecules. J Biol Chem 282, 31437–
31443.
17 Schlune A, Shahin V, Enss K, Schillers H & Oberleith-
ner H (2006) Plugs in nuclear pores: transcripts in early
oocyte development identified with nanotechniques.
J Cell Biochem 98, 567–576.
18 Wu J, Matunis MJ, Kraemer D, Blobel G & Couta-
vas E (1995) Nup358, a cytoplasmically exposed
nucleoporin with peptide repeats, Ran-GTP binding
sites, zinc fingers, a cyclophilin A homologous
domain, and a leucine-rich region. J Biol Chem 270,
14209–14213.
Roles of Nup358 in skeletal myogenesis M. Asally et al.
620 FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS
19 Bernad R, Van der Velde H, Fornerod M & Pickersgill
H (2004) Nup358 ⁄ RanBP2 attaches to the nuclear pore
complex via association with Nup88 and Nup214 ⁄ CAN
and plays a supporting role in CRM1-mediated nuclear
protein export. Mol Cell Biol 24, 2373–2384.
20 McKinsey TA, Zhang CL, Lu J & Olson EN (2000)
Signal-dependent nuclear export of a histone deacety-
lase regulates muscle differentiation. Nature 408, 106–
111.
21 Miska EA, Langley E, Wolf D, Karlsso C, Pines J &
Kouzarides T (2001) Differential localization of
HDAC4 orchestrates muscle differentiation. Nucleic

Acids Res 29, 3439–3447.
22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamik-
awa Y, Oe S, Asally M, Kamachi Y, Kondoh H &
Yoneda Y (2007) Triggering neural differentiation of
ES cells by subtype switching of importin-alpha. Nat
Cell Biol 9, 72–79.
23 Cho KI, Yi H, Desai R, Hand AR, Haas AL & Ferre-
ira PA (2009) RANBP2 is an allosteric activator of the
conventional kinesin-1 motor protein, KIF5B, in a
minimal cell-free system. EMBO Rep 10, 480–486.
24 Pichler A, Gast A, Seeler JS, Dejean A & Melchior F
(2002) The nucleoporin RanBP2 has SUMO1 E3 ligase
activity. Cell 108, 109–120.
25 Fukuhara T, Ozaki T, Shikata K, Katahira J, Yoneda
Y, Ogino K & Tachibana T (2005) Specific monoclonal
antibody against the nuclear pore complex protein,
nup98. Hybridoma (Larchmt) 24, 244–247.
26 Wang X & Seed B (2003) A PCR primer bank for
quantitative gene expression analysis. Nucleic Acids Res
31, e154.
Supporting information
The following supplementary material is available:
Doc. S1. (A) Nuclear envelope localization of Nup358.
(B) Nuclear FRAP assay for nuclear-cytoplasmic
transport dynamics.
Fig. S1. (A) Myoblasts (MB) and myotubes (MT) were
stained with anti-Nup358 serum as shown in Fig. 2.
(B) C2C12 cells were transfected with pEGFP-Nup358
and then fixed and stained with anti-CRM1 and anti-
GFP.

Fig. S2. Histogram of AFM data from Fig. 4E–G.
Outer diameter (A), upper rim diameter (B) and height
(C) data obtained using AFM (Fig. 3D–G) are shown
in a histogram. Blue bars represent the data obtained
from myoblasts and red bars represent those from
myotubes.
Fig. S3. C2C12 cells were transfected with nontarget-
ing siRNA or Nup358 siRNA oligonucleotide and
incubated for 48 h. Recombinant GST-GFP-RevNES-
SV40NLS protein was microinjected with an injection
marker into the cytoplasm of C2C12 cells transfected
with siRNA oligonucleotides.
Table S1. Primer sets used for real-time PCR assay.
Video S1. Microinjection of NLS-containing substrates
in a myoblast. The movie represents the NLS microin-
jection experiment shown in Fig. 6A.
Video S2. Microinjection of NLS-containing substrates
in a myotube. The movie represents the NLS microin-
jection experiment shown in Fig. 6A.
Video S3. Microinjection of NES-NLS-containing sub-
strates in myoblasts. The movie represents the NLS
microinjection experiment shown in Fig. 6B.
Video S4. Microinjection of NES-NLS-containing sub-
strates in a myotube. The movie represents the NLS
microinjection experiment shown in Fig. 6B.
This supplementary material can be found in the
online version of this article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and

may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
M. Asally et al. Roles of Nup358 in skeletal myogenesis
FEBS Journal 278 (2011) 610–621 ª 2011 The Authors Journal compilation ª 2011 FEBS 621