Báo cáo khoa học: Noninvasive imaging of microRNA124a-mediated repression of the chromosome 14 ORF 24 gene during neurogenesis potx

Noninvasive imaging of microRNA124a-mediated
repression of the chromosome 14 ORF 24 gene during
neurogenesis
Hae Young Ko
1,2,3
, Dong Soo Lee
1,4
and Soonhag Kim
5
1 Department of Nuclear Medicine, Seoul National University College of Medicine, Korea
2 Interdisciplinary Course of Radiation Applied Life Science, Seoul National University College of Medicine, Korea
3 Institute of Radiation Medicine, Medical Research Center, Seoul, Korea
4 Department of Molecular Medicine and Biopharmaceutical Science, Seoul National University College of Medicine, Korea
5 Laboratory of Molecular Imaging, CHA Stem Cell Institute, CHA University, Seoul, Korea
Introduction
MicroRNAs (miRNAs), a class of small noncoding
RNAs, are  22-nucleotide single-strand RNA mole-
cules that are expressed in both plants and animals
[1,2]. In general, miRNAs are incorporated into the
RNA-induced silencing complex, and perfectly or
imperfectly bind to the 3¢-UTR of its target mRNA to
Keywords
c14orf24; imaging; microRNA124a;
neurogenesis; target gene
Correspondence
S. Kim, Laboratory of Molecular Imaging,
CHA Stem Cell Institute, CHA University,
605-21 Yoeksam 1-dong, Gangnam-gu,
Seoul, 135-081, Korea
Fax: +82 2 3468 3373
Tel: +82 2 3468 2830

E-mail:
D. S. Lee, Department of Nuclear Medicine,
Seoul National University, College of
Medicine, 28 Yongon-dong, Chongno-gu,
Seoul, 110-744, Korea
Fax: +82 2 3668 7090
Tel: +82 2 2072 2501
E-mail:
(Received 16 April 2009, revised 15 June
2009, accepted 29 June 2009)
doi:10.1111/j.1742-4658.2009.07185.x
The function of microRNAs (miRNAs) is translational repression or
mRNA cleavage of target genes by binding to 3¢-UTRs of target mRNA.
In this study, we investigated the functions and the target genes of micro-
RNA124a (miR124a), and imaged the miR124a-mediated repression of
chromosome 14 open reading frame24 (c14orf24, unknown function) during
neurogenesis, using noninvasive luciferase systems. The expression and
functions of miR124a were investigated in neuronal differentiation of P19
cells (P19 is a mouse embryonic carcinoma cell line) by qRT-PCR and RT-
PCR. The predicted target genes of miR124a were found by searching a
bioinformatics database and confirmed by RT-PCR analysis. Remarkable
repression of c14orf24 by miR124a was detected during neurogenesis, and
was imaged using in vitro and in vivo luciferase systems. The expression of
miR124a was highly upregulated during neuronal differentiation. Overex-
pression of miR124a in P19 cells resulted in a preneuronal gene expression
pattern. MicroRNA124a-mediated repression of c14orf24 was successfully
monitored during neuronal differentiation. Also, c14orf24 showed molecu-
lar biological characteristics as follows: dominant expression in the cyto-
plasm; a high level of expression in proliferating cells; and gradually
decreased expression during neurogenesis. Our noninvasive luciferease

system was used for monitoring the functions of miRNAs, to provide
imaging information on miRNA-related neurogenesis and the miRNA-
regulated molecular network in cellular metabolism and diseases.
Abbreviations
AA, antibiotic ⁄ antimycotic solution; c14orf24, chromosome 14 ORF 24; CMV, cytomegalovirus; DAPI, 4¢,6-diamidino-2-phenylindole; EdU,
5-ethynyl-2¢-deoxyuridine; Fluc, firefly luciferase; Gluc, Gaussia luciferase; LAMC1, laminin c1; LMNB1, lamin B1; MAP2, microtubule-
associated protein 2; miRNA, microRNA; MSC, mesenchymal stem cell; Oct4, octamer4; PTBP1, polypyrimidine tract-binding protein 1;
PTPN12, protein tyrosine phosphatase non-receptor type 12; qRT-PCR, quantitative RT-PCR; RA, retinoic acid; RBMS1, RNA-binding motif
single-stranded interacting protein 1; ROI, region of interest; SD, standard deviation; USP48, ubiquitin-specific protease 48.
4854 FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS
induce either mRNA degradation or translational inhi-
bition [3–5]. Recently, in animals, miRNAs have been
reported to destabilize the mRNA of their targets by
base paring with a continuous six or seven nucleotide
sequence in the 3¢-UTR of the target genes known as a
seed sequence, seed region, or seed match, in spite of
the partial base pairing between miRNAs and targets
[6].
The first reported miRNA, encoded by the Caenor-
habditis elegans gene lin-4, was found to be crucial for
the developmental timing and patterning of postembry-
onic stages [7]. Since their identification, miRNAs have
been shown to play important roles in diverse biolo-
gical functions, such as cell differentiation, fat meta-
bolism, cell proliferation, and cell death [8–10]. A
recent study found that many miRNAs, such as miR9,
miR9*, miR124a, miR134, miR23a, miR132, and
miR128, are expressed in neurons and regulate neuro-
nal development [11,12]. Among them, miR124a is
present at undetectable or very low levels in neural

progenitors, but is expressed at a high level in differen-
tiating and mature neurons [13]. A microarray study
of miR124a-treated HeLa cells (human carcinoma
cells) revealed 174 downregulated non-neuronal tran-
scripts [14]. The endogenous targets directly bound
and repressed by miR124a include the genes encoding
small C-terminal domain phosphatase 1 [15], poly-
pyrimidine tract-binding protein 1 (PTBP1) (PTB ⁄
hnRNP 1) [16], laminin c1, and integrin b1 [17].
Moreover, neurite outgrowth was promoted by over-
expression of miR124a during neuronal differentiation
[18].
It is a great challenge to study the expression and
function of endogenous miRNAs without killing the
animals. The current methods, including northern
blot analysis and RT-PCR, used to investigate the
molecular regulation of endogenous miRNAs are
time-consuming, labor-intensive, nonrepeatable, and
not clinically relevant. Recently, there have been
significant advances in optical imaging techniques
using multimodal reporter systems; this technology
has been used for noninvasive repeated quantitative
imaging of tumor and stem cells in living animals
[19–22]. Previous articles from our laboratory have
reported the expression of miRNA and its target
genes in vitro and in vivo, using these luciferase
systems [21,23,24].
In our study, the function of miR124a in neurogene-
sis was analyzed using biomarker genes of stem cells
and neurons, and the expression level of miR124a

investigated by qRT-PCR during the neuronal differ-
entiation of P19 cells. A bioinformatics analysis was
then performed to predict the targets of miR124a, and
showed, by RT-PCR, several genes that were directly
regulated by miR124a. One of these genes, chromosome
14 ORF 24 (c14orf24), which is of unknown function,
was evaluated in our successfully developed luciferase
reporter system, both in vitro and in vivo, to determine
whether the 3¢-UTR of c14orf24 was directly regulated
by miR124a. Also, for the first time, the biological
functions of c14orf24 were investigated during cell
proliferation.
Results
MicroRNA124a is expressed at a high level during
neurogenesis
MicroRNA124a is a small RNA composed of 22
nucleotides, and is well conserved from humans to
aquatic species. To determine and quantify the endoge-
nous levels of miR124a during neuronal differentiation
of P19 cells, we performed quantitative RT-PCR
(qRT-PCR) (Fig. 1). cDNA was synthesized from
small RNA of neuronal differentiated P19 cells, at 0,
1, 2, 3, 4, 5 and 6 days after retinoic acid (RA) treat-
ment. A pair of specific primers for miR124a was used,
and the quantities of miR124a for each differentiation
day were normalized with U6 small RNA. The expres-
sion of miR124a gradually increased during neuronal
differentiation, and had increased more than three-fold
by the fifth day after RA treatment.
4

3
2
Relative quantity (ΔΔCt)
1
0
Before 1 day 2 days 3 days
Day after RA treatment
4 days 5 days 6 days
Fig. 1. The expression of miR124a during neuronal differentiation
of P19 cells. (A) Quantitative RT-PCR analysis of the expression of
mature miR124a. Endogenous mature miR124a levels were
increased during neuronal differentiation. Data were normalized to
U6 snRNA (DDC
T
= DC
T-before
– DC
T-day
, DC
T-before
=C
T-miRNA ⁄ before
–C
T-U6RNA ⁄ before
, DC
T-day
=C
T-miRNA ⁄ day
–C
T-U6RNA ⁄ day

). Data are
expressed as means ± SD in triplicate samples.
H. Y. Ko et al. Bio-imaging of miR124a-targeted c14orf24
FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS 4855
Preneuronal characteristics of P19 cells were
induced by overexpression of miR124a
To investigate the role of miR124a during neurogene-
sis, overexpression of miR124a was examined in P19
cells. We transfected exogenously derived miR124a, at
a concentration of 5 nm, into P19 cells, which are
believed not to be induced into neuronal differentiation
in the absence of RA. The programming process of
neuronal differentiation was induced by overexpression
of miR124a (Fig. 2A). We followed the gradual acqui-
sition of neuronal traits over time after transfection
with exogenous miR124a. Interestingly, 2 days after
transfection, none of the P19 cells treated with
miR124a showed neuronal morphology, whereas
RA-treated P19 cells had the neuronal phenotype.
2 days 3 days 4 days
Oct4
NeuroD
MAP2
Before
Before
×400 ×400 ×400
×400 ×400 ×400
×400 ×400 ×400
×400 ×400
×400 ×400

×400 ×400
2 days 4 days 2 days 4 days
1 day 2 days 3 days 4 days Before 1 day 2 days 3 days 4 days 1 day 2 days 3 days 4 days
Day after transfection with
miR124a
Day after anti-miR124a and RA
treatment
Day after RA treatment
β-actin
Oct4
NeuroD
MAP2
Day after transfection with miR124a
Day after transfection with miR124a
2 days 3 days 4 days
Day after RA treatment
Day after RA treatment
A
C
B
Fig. 2. MicroRNA124a-induced preneurogenesis in P19 cells. (A) Neuronal differentiation analysis in miR124a-transfected P19 cells. Upper
panel: P19 cells were changed to preneurons by overexpression of miR124a. Lower panel: neuronal differentiation induced by RA treatment,
as a control. (B) RT-PCR analysis of P19 cells transfected with miR124a and subjected to RA treatment. Oct4, stem cell marker; NeuroD,
preneuronal marker; MAP2, neuronal marker. b-Actin was used as a control. (C) Laser scanning confocal microscopy of immunofluorescence
staining using Oct4, NeuroD and MAP2 for P19 cells transfected with miR124a, treated with RA, and treated with both anti-miR124a and
RA for 4 days. Red fluorescence represents the cytoplasmic expression of Oct4 (top panel), NeuroD (middle panel), and MAP2 (bottom
panel), and the blue fluorescence represents DAPI, which stained the nucleus.
Bio-imaging of miR124a-targeted c14orf24 H. Y. Ko et al.
4856 FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS
However, thereafter, miR124a-treated P19 cells exhib-

ited a marked change in cell morphology: there was a
gradual expansion of dendrites from the cells, even
though the rate of dendrite development from
miR124a-treated P19 cells was slower than in the
positive controls. By RT-PCR analysis, it was shown
that, in undifferentiated P19 cells, expression of the
stem cell marker octamer 4 (Oct4) was upregulated, but
the differentiation markers NeuroD and microtubule-
associated protein 2 (MAP2) were not detected, as
previously reported [15] (Fig. 2B). When P19 cells was
treated only with miR124a, the level of Oct4 transcript
was gradually decreased until 4 days, whereas RA
treatment of P19 cells resulted in the disappearance of
Oct4 expression 2 days after the treatment. Both
miR124a-treated and RA-treated P19 cells showed a
significant increase in the expression of the preneuronal
marker NeuroD; however, this was less than in P19
cells with RA treatment. Interestingly, the neuron mar-
ker MAP2 was present at high levels only in RA-trea-
ted P19 cells, and was not present at high levels in P19
cells treated with exogenous miR124a. Additionally, to
inhibit the function of miR124a, we treated P19 cells
with both RA and miR124a antagomir (synthetic
oligonucleotides that fully complement the miR124a).
Oct4 was continuously expressed until 4 days after
anti-miR124a and RA treatment, but gradually
decreased in level, whereas MAP2 was undetectable.
Moreover, NeuroD was detected only 3 days after
treatment with RA and miR124a antagomir. These
results showed that miR124a antagomir retarded

RA-induced neuronal differentiation of P19 cells by
blocking miR124a function.
To investigate how the protein levels of these mark-
ers were affected by miR124a or RA in P19 cells,
immunofluorescence staining was performed with each
antibody (Fig. 2C). The confocal microscope image
showed that the fluorescent signals obtained with Oct4
was found in the cytoplasm of undifferentiated P19
cells, gradually decreased with the treatment with
miR124a, and was undetectable after RA treatment,
owing to the neuronal differentiation of P19 cells.
Conversely, the cytoplasmic fluorescent activity of P19
cells with NeuroD gradually increased with treatment
with miR124a or RA by 4 days, with stronger signals
being seen in RA-treated P19 cells, whereas no signal
was found before the treatments. The result of immu-
nofluorescence staining using MAP2 showed a gradual
increase of cytoplasmic fluorescence in RA-treated P19
cells for 4 days, but no significant signal either before
or after the miR124a treatment in P19 cells. This sug-
gests that the sole function of miR124a could be to
trigger the initial neurogenesis program and that it is
not additionally involved in fully differentiating P19
cells into mature neurons.
MicroRNA124a repressed multiple target genes
during the neuronal differentiation of P19 cells
To find the genes that are directly regulated by
miR124a during miR124a-directed neurogenesis and
that contain miR124a seed sequences, microarray data
from miR124a-treated HeLa cells [14] and bioinfor-

matics data from miR124a-predicted targets from the
PicTar database (), an algo-
rithm for the identification of miRNA targets using
3¢-UTR alignments, were compared. Comparison of
174 microarray-analyzed genes that are significantly
regulated by miR124a in HeLa cells and the PicTar
database-predicted 787 genes showed 35 genes with
overlapping coding sequences that might be directly
regulated by miR124a (Fig. 3A, Table S1).
For further analysis of miR124a-targeted gene expres-
sion by RT-PCR, we randomly selected eight candidates
after a review of the literature and determination of the
neuronal correlation. These included the following:
c14orf24, laminin gamma 1 (LAMC1), PTBP1, RNA-
binding motif single-stranded interacting protein 1
(RBMS1), hypothetical protein MGC5508 (transmem-
brane protein 109), lamin B1 (LMNB1), protein tyrosine
phosphatase non-receptor type 12 (PTPN12), and ubiqu-
itin-specific protease 48 (USP48). Unlike the gradual
increase of miR124a expression during the neuronal dif-
ferentiation of P19 cells treated with RA, the endogenous
gene expression of five of the candidates was gradually
decreased over the period of neuronal differentiation
(Fig. 3B). Unfortunately, three of the eight targets,
transmembrane protein 109, Usp48, and RBMS1, could
hardly be distinguished, owing to weak expression or
technical problems with amplification of their amplicons
(data not shown). To determine the direct correlation
between the five candidates and miR124a, overexpres-
sion analysis of exogenous miR124a was conducted in

P19 cells in the absence of RA treatment. We could more
clearly predict that mRNA transcript levels of the
c14orf24, LAMC1, PTBP1, PTPN12 and LMNB1 genes
were significantly and directly repressed by miR124a,
indicating that mRNA of the five target genes was
destabilized by miR124a (Fig. 3C).
C14orf24 was directly downregulated by miR124a
Most of the miRNA target genes predicted in the Pic-
Tar database have one to tens of different miRNA
seed sequences at the 3¢-UTR of each mRNA. This
means that multiple miRNAs can regulate a single
H. Y. Ko et al. Bio-imaging of miR124a-targeted c14orf24
FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS 4857
target in a cell or a tissue at the same time. Fortu-
nately, the PicTar database showed that the 3¢-UTR of
c14orf24 has only two predicted miRNA seed
sequences, miR124a and miR128, both of which are
known to be expressed during neurogenesis [12]. The
miRNA-related functions of these are unknown; we
sought to determine whether c14orf24 is directly regu-
lated by miR124a or not. About 100 bp of the 3¢-UTR
of c14orf24 near the miR124a seed sequence was
cloned into our established luciferase reporter gene sys-
tem, CMV ⁄ Gluc ⁄ c14ofr24-3¢UTR, to monitor whether
it is directly downregulated by miR124a (Fig. 4A,B).
CMV ⁄ Gluc ⁄ c14orf24-3¢UTR was first transfected into
HeLa cells, where miR124a expression is undetectable.
The cotransfection with various doses of exogenous
miR124a showed a significant repression of Gaussia
luciferase (Gluc) activity as compared with the control,

CMV ⁄ Gluc ⁄ c14orf24-3¢UTRmt construct, which con-
tained a completely mutated miR124 seed sequence of
c14orf24 (Fig. 4C).
To quantify the in vitro luciferase activity, represent-
ing the miR124a-directed endogenous expression level
of the c14orf24 gene during neurogenesis, CMV ⁄
Gluc ⁄ c14ofr24-3¢UTR was transfected into RA-treated
P19 cells. The Gluc activity of CMV ⁄ Gluc ⁄ c14ofr24-
3¢UTR slightly decreased to the third day of neuronal
differentiation of P19 cells (Fig. 4D). The significant
decrease in Gluc activity from CMV ⁄ Gluc ⁄ c14ofr24-
3¢UTR was detected 4 days after the neuronal differen-
tiation of P19 cells, as compared with CMV ⁄ Gluc ⁄
c14orf24-3¢UTRmt.
The in vivo imaging of 2.5 · 10
6
implanted P19 cells
bearing CMV ⁄ Gluc ⁄ c14ofr24-3¢UTR or CMV ⁄ Gluc ⁄
c14orf24-3¢UTRmt was monitored for 2 days of neuro-
nal differentiation, and then analyzed by a region of
interest (ROI) analysis. As compared with the control
from the left thigh without RA treatment, the Gluc
expression of CMV ⁄ Gluc ⁄ c14ofr24-3¢UTR from the
RA-treated P19 cells was significantly decreased, and
almost disappeared by the second day of neuronal dif-
ferentiation, due to the increased expression of
miR124a (Fig. 4E). Similar to what was found in the
in vitro luciferase assay of CMV ⁄ Gluc ⁄ c14orf24-3¢UT-
Rmt, the Gluc activity was slightly, but not signifi-
cantly, decreased (Fig. 4F). The fold ratio from the

ROI analysis of CMV ⁄ Gluc ⁄ c14ofr24-3¢UTR showed
more dramatically decreased expression of c14orf24 in
the RA-treated P19 cells than in the undifferentiated
P19 cells (Fig. 4G).
The c14orf24 gene was expressed in the
cytoplasm as a cellular component and
functioned biologically in the positive
regulation of cell proliferation
Unfortunately, any potentially valuable biological
functions of c14orf24 have not yet been studied, and
even its antibody was not available. Therefore, identifi-
cation of the functions of c14orf24 is a considerable
challenge. To predict how the protein encoded by the
c14orf24 mRNA regulated by miR124a functions in
the intact cells, we introduced the coding sequence and
the full 3¢-UTR containing miR124a seed sequences of
c14orf24 into an expression vector, pcDNA3.1 ⁄ His
vector (designated as Xp-c14orf24), that could express
c14orf24 at abnormally high levels and represent the
miR124a-mediated repression that takes place in cells
in the presence of miR124a. First, to investigate the
752 genes
a
ABC
cb
139 genes
C14orf24
LAMC1
PTBP1
PTPN12

Before 1 day 2 days 3 days 4 days 5 days 6 days
Untreated +miR124a
Day after RA treatment
β-actin
LMNB1
C14orf24
LAMC1
PTBP1
PTPN12
β-actin
LMNB1
35
genes
Fig. 3. The predicted target genes of miR124a in P19 cells. (A) Prediction of miR124a target genes using bioinformatics. By comparison with
787 genes obtained from the PicTar database (a) and 174 genes significantly downregulated in miR124a-treated HeLa cells (b), 35 genes
with overlapping coding sequences (c) were discovered. (B) RT-PCR analysis showing the expression of five predicted target genes. The lev-
els of c14orf24, LAMC1, PTBP1, PTPN12 and LMNB1 were repressed by increasing amounts of miR124a during the neuronal differentiation
of P19 cells. (C) The target genes downregulated by overexpression of miR124a. The five predicted genes (c14orf24, LAMC1, PTBP1,
PTPN12, and LMNB1) were downregulated by miR124a transfection into P19 cells.
Bio-imaging of miR124a-targeted c14orf24 H. Y. Ko et al.
4858 FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS
AB
CD
E
F
G
c14orf24 mRNA
3′UTR
Human
Mouse

ORF
2360
1.6
**
*
*
1.4
1.2
1.0
0.8
0.6
0.4
0.2
0
0 n
M
5 nM
b
a
b
a
0 h
16 h
1 day
2 days
0 h
0.5
1.0
2.0
1.5

0
16 h
1 day
Time
2 days
10
8
4
6
2
0
x10
6
10
500
400
300
200
100
8
4
6
2
x10
6
x10
3
0 h
16 h
1 day

2 da
y
s
10 nM
Concentration of miR124a
Fold decrease
1.4
*
*
1.2
1.0
0.8
0.6
0.4
0.2
0
Fold decrease
Fold increase
20 nM
Before
1 day
2 days
3 days
Day after RA treatment
4 days 5 days
Seed sequence
AGTT
TA
TGTTTATCAATATAGTTATTCACTGTGCCTTAAGTTTATA
ATGGGTACTGTT

TACAGTTATTCACTGTGCCTTACATTTTTA
ATTG AGC
CMV/Gluc/c14orf24-3′ UTR
CMV/Gluc/c14orf24-3′ UTRmt
CMV/Gluc/C14orf24-3′ UTR
CMV/Gluc/C14orf24-3′ UTRmt
3′ UTR
3′ UTRmt
Gluc
CMV
Gluc
CMV
Mutation of
seed sequence
Fig. 4. C14orf24 regulation by miR124a targeting. (A) The genomic locus of the c14orf24 3¢-UTR containing the seed sequence that needs to
be recognized by miR124a. The mutation of the seed sequence was designed to interrupt the binding of miR124a into the 3¢-UTR. (B) Sche-
matic diagram of CMV ⁄ Gluc ⁄ c14orf24-3¢UTR constructs. The Gluc activity of CMV ⁄ Gluc ⁄ c14orf24-3¢UTR was downregulated when miR124a
bound to the c14orf24 3¢-UTR. However, the Gluc activity of the CMV ⁄ Gluc ⁄ c14orf24-3¢UTR mutant was not regulated by miR124a, because
miR124a did not bind to the c14orf24 3¢-UTR mutant. (C) Luciferase analysis to confirm whether the c14orf24 3¢-UTR was bound by exogenous
miR124a in HeLa cells. The Gluc activity of CMV ⁄ Gluc ⁄ c14orf24-3¢UTR (black bar) was significantly decreased as the concentration of miR124a
increased. CMV ⁄ Gluc ⁄ c14orf24-3¢UTRmt (gray bar) was used as a negative control. Luciferase activity was normalized to the CMV ⁄ Gluc vector.
Data are expressed as means ± SD in triplicate samples. *P < 0.05; **P < 0.005. (D) Luciferase analysis showing that endogenous miR124a
binds to the c14orf24 3¢-UTR in P19 cells after RA treatment. The Gluc activity of CMV ⁄ Gluc ⁄ c14orf24-3¢UTR (black bar) was decreased during
neuronal differentiation. The Gluc activity of CMV ⁄ Gluc ⁄ c14orf24-3¢UTRmt (gray bar), as a negative control, was not regulated. Data are
expressed as means ± SD in triplicate samples. *P < 0.05. (E) Bioluminescence image showing that c14orf24 is the target gene of miR124a.
P19 cells (2.5 · 10
6
) transfected with CMV ⁄ Gluc ⁄ c14orf24-3¢UTR were subcutaneously grafted onto the left side (a) and right side (b) of the
nude mice. On the right side, neuronal differentiation was induced by RA treatment. Bioluminescence of grafted P19 cells on the right side was
decreased in comparison with those on the left side (three mice). (F) Bioluminescence image showing that CMV ⁄ Gluc ⁄ c14orf24-3¢UTRmt, as a

negative control, was not regulated by RT-induced neuronal differentiation. We used the same method as that used to obtain the previous biolu-
minescence image (three mice). (G) ROI analysis of the bioluminescence image. The ratio differentiated ⁄ undifferentiated ratio reduced as time
passed. However, in the case of injected P19 cells transfected with CMV ⁄ Gluc ⁄ c14orf24-3¢UTR, the ratio remained unchanged.
H. Y. Ko et al. Bio-imaging of miR124a-targeted c14orf24
FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS 4859
localization of expression of c14orf24 protein, Xp-
c14orf24 was transfected into P19 cells, and double
analysis was performed with the Anti-Xpress antibody
and 4¢,6-diamidino-2-phenylindole (DAPI), which
stains the nucleus. As shown in Fig. 5A, c14orf24 pro-
tein was well expressed in the undifferentiated P19 cells
for 4 days, and showed even localization in the cyto-
plasm. However, it was observed that the expression of
c14orf24 protein in the cytoplasm was almost com-
pletely lost 4 days after treatment with either RA or
miR124a of P19 cells. These results implied that the
expression of c14orf24 protein is dominantly localized
in the cytoplasm and repressed directly by miR124a
during neuronal differentiation.
Next, we investigated how the overexpression of
c14orf24 affects the proliferation and neuronal differ-
entiation of P19 cells. Following Xp-c14orf24 transfec-
tion, P19 cells displayed more rapidly achieved and
higher cell densities than the cells grown under normal
control conditions (Fig. 5B). Additionally, the cellular
morphology demonstrated that treatment with both
RA and Xp-c14orf24 of P19 cells simultaneously
repressed the morphological changes of neuronal dif-
ferentiation, leading to less retraction of cytoplasm
towards the nucleus and a less spherical appearance of

cell bodies, whereas after a single treatment with RA
of P19 cells, the cells increasingly showed the neuronal
traits of a pyramidal and perikaryal appearance. To
determine the effect of c14orf24 on P19 cells at the
molecular level, RT-PCR analysis was conducted with
total RNA from P19 cells 4 days after no treatment,
treatment with either RA or Xp-c14orf24, or both
treatments. Transfection of Xp-c14orf24 into P19 cells
led to overexpression c14orf24 transcript (Fig. 5C).
Similar to the results shown in Fig. 4B, RA treatment
of P19 cells resulted in neuronal characteristics of P19
cells, which showed increased gene expression of the
neuron markers MAP2 and NeuroD, and a significant
decrease in that of the stem cell marker Oct4.
However, additional treatment of RA-treated P19 cells
with Xp-c14orf24 inhibited neuronal differentiation,
resulting in lower levels of MAP2 and NeuroD tran-
script, and higher levels of Oct4 transcript, than in P19
cells treated only with RA.
To further verify the effect of c14orf24 on cell prolif-
eration and neuronal differentiation of P19 cells, flow
cytometry assay was performed with the mitotic
marker, 5-ethynyl-2¢-deoxyuridine (EdU). EdU is incor-
porated into replicating DNA similarly to 5-bromo-2¢-
deoxyuridine (BrdU), and its terminal alkyne group
reacts with fluorescent azide [25]. The incorporation of
the nucleoside analog EdU into cellular DNA of P19
cells was quantified, and demonstrated that the number
of EdU-labeled P19 cells with the overexpression of
c14orf24 revealed about 2.5-times higher than that with-

out treatment (Fig. 5D). The number of EdU-labeled
P19 cells treated with both Xp-c14orf24 and RA
showed 1.7-times higher than that of only RA-treated
P19 cells. These results indicated a higher rate of DNA
synthesis in P19 cells with c14orf24 overexpression.
To extend our understanding of the involvement of
c14orf24 in cellular proliferation and neuronal differen-
tiation, the expression of the c14orf24 gene was investi-
gated in various cells, including normal, cancer and
neuronal precursor cell lines. RT-PCR was conducted
using total RNA from HT-ori3 cells (normal thyroid
cells), L132 cells (lung normal cells), C6 cells (glioma
cells), CT-26 cells (colon carcinoma cells), mesenchy-
mal stem cells (MSCs), and G2 cells (neural stem
cells). In normal cells, HT-ori3 cells, and L132 cells,
the c14orf24 gene was expressed at a relatively low
level, whereas a higher amount of the c14orf24 ampli-
con was expressed in highly proliferating cells, C6 cells,
and CT-26 cells (Fig. 5E). Also, the c14orf24 gene was
highly expressed in both MSCs and G2. Interestingly,
when G2 cells were induced to undergo neuronal dif-
ferentiation by the deletion of doxycycline from the
growth medium, the transcript level of the c14orf24
Fig. 5. The biological and cellular functions of the c14orf24 gene in cells. (A) Immunocytostaining analysis of c14orf24 by laser scanning con-
focal microscopy (red, c14orf24; blue, DAPI). The pcDNA3.1 ⁄ His_c14orf24 containing Xpress epitope was transfected into P19 cells and
treated with RA, miR124a or nothing for 4 days. The fluorescence image detected by Xpress antibody showed that c14orf24 proteins were
predominantly present in the cytoplasm of P19 cells before the treatments, and that they disappeared during the neuronal differentiation of
P19 cells induced by RA or after miR124a treatment. Magnification: upper panel, · 400; lower panel, · 1000. (B) Cellular morphology charac-
teristics of P19 cells affected by the c14orf24 gene. Cell morphology was acquired 4 days after no treatment and treatment with either or
both of RA or pcDNA3.1 ⁄ His_c14orf24 of P19 cells. (C) RT-PCR analysis of P19 cells transfected with the c14orf24 gene. Total RNA was

extracted from P19 cells 4 days after no treatment and and treatment with either or both of RA or pcDNA3.1 ⁄ His_c14orf24 of P19 cells.
RT-PCR was conducted for MAP2, NeuroD, Oct4 and c14orf24 using a pair of primers listed in Tables S2 and S4. b-Actin was used as a con-
trol. (D) EdU-incorporated flow cytometry analysis of P19 cells affected by the c14orf24 gene. EdU-labeled cells were measured 4 days after
no treatment and after treatment with either or both of RA or pcDNA3.1 ⁄ His_c14orf24 of P19 cells. The y-axis indicates the percentage of
EdU-labeled P19 cells. Data are expressed as means ± SD in triplicate samples. *P < 0.05; **P < 0.005. (E) RT-PCR analysis of c14orf24
expression in various cell lines: HT-ori3 cells (normal thyroid cell line), L132 cells (lung normal cell line), C6 cells (glioma cell line), CT-26 cells
(colon carcinoma cell line), MSCs, and G2 cells (neural stem cell line). b-Actin was used as a control.
Bio-imaging of miR124a-targeted c14orf24 H. Y. Ko et al.
4860 FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS
gene was dramatically decreased, and the transcript
had almost disappeared on the fourth day of neuronal
differentiation. This result showed that the c14orf24
gene must be positive regulator of cellular proliferation
and be downregulated during neurogenesis.
Discussion
Hundreds of well-conserved miRNAs have been
reported to be evolutionarily well conserved over spe-
cies and related to cellular metabolism and various
diseases, including cancer, cardiovascular disease, and
neurological disease [26]. In particular, neuronal-
specific miRNAs such as miR124a, miR9, miR128,
miR131, miR178 and miR125b have been directly and
indirectly shown to have relatively high expression
levels during brain development, and are expected to
regulate the various genes related to neuronal differen-
tiation.
Complicated intracellular and extracellular communi-
cation could possibly be involved in the differentiation
of stem cells into mature neurons of the eukaryotic sys-
A

B
E
C
D
x400
x400 x400 x400 x400 x400
x1000x1000x1000x1000x1000x1000
2 days
RA
c14orf24
RA
c14orf24
RA
EdU-labeled cell (%)
c14orf24
c14orf24
HT-ori3
L132
C6
CT26
MSC
G2-un G2-4d
G2-6d
+
++
+
–
––
–
MAP2

NeuroD
Oct4
β-actin
c14orf24
β-actin
4 days
2 days
4 days
2 days
4 days
Day after non treatment
Day after RA treatment
++
+
––
–
––
––++
70
60
50
40
30
20
10
0
++
–
+
Day after transfection with miR124a

H. Y. Ko et al. Bio-imaging of miR124a-targeted c14orf24
FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS 4861
tem. In general, a single miRNA is believed to directly
target hundreds of genes, which may indirectly regulate
thousands of coding genes [14]. Overexpression of miR1,
which is specifically expressed in cardiac and skeletal
muscle, induced the differentiation of C2C12 myoblasts
into myotubes [27]. Transfection of exogenously derived
miR124a into P19 cells in the absence of RA resulted in
guidance of the neuronal program, partly explaining
why miR124a is specifically neuronally expressed.
Unlike miR1, the solo miR124a could not sufficiently
induce P19 cells to fully differentiate into neurons, but
could induce only the preneuronal characteristics. It is
possible that other, more complex, mechanisms are
required to complete the neuronal differentiation pro-
gram. Surprisingly, some experiments in our laboratory
showed that transfection of single, dual or multiple neu-
ronal-specific miRNAs into P19 cells induced a more
neuronally differentiated status than single transfection
with miR124a, and that a cancer-related miRNA
delayed the neuronal differentiation of RA-treated P19
cells (data not shown). These results mean that miRNAs
play an important role in maintaining the stem cells
and inducing neuronal differentiation.
As miRNAs have been shown to be correlated with
various diseases, many efforts in both experimental
and in silico studies have been focused on their gene
targets, in order to develop our understanding from
the simple concept of miRNA expression to the more

complicated regulatory interactions between miRNA
and target genes, which can decide cellular fate or dis-
ease progression [28,29]. RT-PCR of genes selected by
the analysis from the comparison of microarray data
of miR124a-treated HeLa cells with miR124a-predicted
targets through the PicTar database showed that the
c14orf24, LAMC1, LMNB1, PTBP1 and PTPN12
genes had gradually decreased endogenous gene
expression during the neuronal differentiation of P19
cells when endogenous levels of miR124a were gradu-
ally increased. Additionally, excessive amounts of
exogenous miR124a in P19 cells resulted in signifi-
cantly direct regulation of these candidates. PTPB1,
which is expressed at a high level in non-neuronal cells,
binds to pyrimidine-rich sequences in pre-mRNA and
inhibits the splicing of nearby neuron-specific alterna-
tive exons, but is known to be repressed in the nervous
system by miR124a, to allow the inclusion of neuron-
specific exons in mature mRNA [16]. LAMC1, which
is one of the components of a heterodimeric molecule,
laminin-1, comprising laminin a1, laminin b1, and lam-
inin c1 subunits, has also been reported to be an
endogenous target of miR124a [17].
Our experiment using the established luciferase sys-
tem containing the putative 6 bp seed sequence matched
between the 5¢-end of miR124a and the 3¢-UTR of the
c14orf24 gene showed a strong evidence of miR124a-
mediated repression of c14orf24 during neurogenesis.
The coding region of c14orf24 (NM_173607), the func-
tion of which is not known, possesses 213 amino acids

and has a molecular mass of 23 kDa. Our findings from
PCR and in vitro ⁄ in vivo luciferase assays show that
c14orf24 is expressed before and after neuronal differen-
tiation of P19 cells, but its expression is significantly
decreased on the day when the endogenous level of
miR124a is at its peak. Also, the strong suppression of
c14orf24 transcript was caused by the exogenous
miR124a, through direct binding of miR124a to the
miR124a seed sequence of c14orf24. Unfortunately, the
in vivo Gluc expression of transiently transfected lucifer-
ase systems was almost gone after 3 days of neuronal
differentiation. For long-term noninvasive imaging, sta-
ble cell lines or viral vectors such as lentiviral or adeno-
viral vector will be helpful to image the dynamic
changes of miR124a-regulated neurogenesis.
Additional biological and cellular studies of the
c14orf24 gene by immunocytostaining, flow cytometry
and RT-PCR analysis showed that c14orf24 was domi-
nantly expressed in the cytoplasm and highly expressed
in proliferating cells, but was repressed during neuro-
nal differentiation. In this study, for the first time, we
showed that c14orf24 might function in maintaining
cell proliferation, at least in P19 cells, and be involved
in the initial program of neurogenesis via the negative
interaction with miR124a.
Our noninvasive luciferase imaging systems for moni-
toring the repression of the novel targets of miR124a will
be a useful tool for the study of the molecular regulation
of miRNAs related to cellular proliferation, differentia-
tion, apoptosis, and various diseases. In particular, our

ongoing development of a dual luciferase reporter gene
system to simultaneously monitor ectopically expressed
miRNAs and their targets will provide bidirectional
information for cellular therapy and disease diagnosis.
Experimental procedures
Quantitative RT-PCR of miR124a
With the mirVana miRNA isolation kit (Ambion, Austin,
TX, USA), small RNA was isolated during the neuronal
differentiation of P19 cells. qRT-PCR was performed using
the mirVana qRT-PCR primer Set (Ambion) and mirVana
qRT-PCR miRNA detection kits (Ambion), according to
the manufacturer’s instructions. The PCRs were performed
in triplicate using iCycer (Bio-Rad, Hercules, CA, USA)
with SYBR Premix Ex Taq (2 ·) (Takara, Shiga, Japan) as
follows: 95 °C for 3 min; and 40 cycles of 95 ° C for 15 s
Bio-imaging of miR124a-targeted c14orf24 H. Y. Ko et al.
4862 FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS
and 60 °C for 30 s). To normalize the experimental samples
for RNA content, the U6 snRNA primer set (Ambion) was
used as a control.
Culture of HeLa cells and P19 cells
HeLa cells (cervical carcinoma cell line) were cultured
routinely in RPMI (Jeil Biotechservices Inc., Daegu, Korea)
containing 10% fetal bovine serum (Cellgro, Herndon, VA,
USA) and 1% antibiotics ⁄ antimycotic solution (AA) (Cell-
gro) at 37 °C. P19 cells were obtained from the ATCC. In
brief, undifferentiated P19 cells were grown at 37 °Cin
a-MEM (Gibco, Grand Island, NY, USA) supplemented
with 2.5% fetal bovine serum (Cellgro), 7.5% bovine calf
serum (Gibco) and 1% AA (Cellgro) in a 5% CO

2
humidified
chamber. For induction of neuronal differentiation using the
monoculture differentiation method [21], P19 cells were pla-
ted on gelatin-coated culture plates at a density of
5 · 10
3
cellsÆcm
)2
in growth medium prior to growth factor
removal. After 24 h, P19 cells were cultured under serum-free
conditions in DMEM ⁄ 12 (1 : 1) medium (Gibco) supple-
mented with 1% insulin–transferrin–selenium (Gibco) and
1% antibiotics, and treated with 5 · 10
)7
m all-trans-RA
(Sigma, St Louis, MO, USA). After 2 days, the RA was
removed from the medium, and the cells were cultured
further under serum-free conditions.
RT-PCR
Using Trisol reagent (Invitrogen, Grand Island, NY, USA),
total RNA was isolated from P19 cells as during the day after
RA treatment. Reverse transcription, for synthesis of the
first-strand cDNA, was carried out using random-hexamer
and SuperScript II reverse transcriptase (Invitrogen), accord-
ing to the manufacturer’s instructions, and this cDNA was
then used as a template for PCR amplification: 94 °C for
5 min, with 30 amplification cycles [94 °C for 30 s each T
m
for 30 s (Tables S2 and S4), 72 °C for 30 s], and 72 °C for

4 min. The sequences of the primers used for PCR amplifica-
tion are listed in Table S2 and Table S4.
Development of vectors monitoring the
miR124a-directed repression of c14orf24
We constructed a Gluc reporter vector bearing a cytomega-
lovirus (CMV) promoter, and 99 nucleotides from the
3¢-UTR of the c14orf24 gene, containing an miR124a seed
sequence, identified through the PicTar database, were used
for imaging of miR124a-regulated repression. They were
constructed by incubation with a pair of primers, sense and
antisense primers of the c14orf24 3¢-UTR, in annealing buf-
fer (· 1 TE buffer + 50mm NaCl) for 10 min at 60 °C,
cloned into CMV ⁄ Gluc at the site between XhoI and XbaI,
and cloned into the CMV ⁄ Gluc vector labeled
CMV ⁄ Gluc ⁄ c14orf24-3¢UTR (Table S3). As a negative
control, CMV ⁄ Gluc ⁄ c14orf24-3¢UTRmt was constructed by
complete mutation of the miR124a seed sequences in the
3¢-UTR of c14orf24, and annealing the oligonucleotides
and sense and antisense primers of c14orf24-3¢UTRmt
(Fig. 4A,B).
Transfection and luciferase assay
Transient transfection of various vectors of interest into
undifferentiated ⁄ differentiated P19 cells was performed by
using 0.6 lg of DNA, 3 lL of Plus reagent (Invitrogen),
and 1.5 lL of Lipofectamine (Invitrogen) per well. After
3 h, the transfection medium was replaced with undifferen-
tiated medium (a-MEM; 2.5% fetal bovine serum, 7.5%
bovine calf serum, and 1% AA) from undifferentiated P19
cells and differentiated media (DMEM ⁄ 12; 1% insulin–
transferrin–selenium and 1% AA) from RA-treated P19

cells. Gluc expression was analyzed 2 days after transfec-
tion. All transfections were carried out in triplicate. The
cells were washed with NaCl ⁄ P
i
and lysed with 200 lL per
well of passive lysis buffer (Promega, Madison, WI, USA).
Next, 100 lL of cell lysate from each well was used to mea-
sure luciferase activity with the Gaussia luciferase assay kit
(Targetingsystems, San Diego, CA, USA), according to the
manufacturer’s instructions, and measured on a Wallac1420
VICTOR3V (PerkinElmer Life and Analytical Sciences,
Waltham, MA, USA). The data are presented as
means ± standard deviation (SD) calculated from triplicate
wells.
Grafting of the cells with reporter gene
constructs and in vivo visualization of
miR124a and c14orf24 in nude mice
All experimental animals were housed under specific patho-
gen-free conditions and handled in accordance with the
guidelines issued by the Institutional Animal Care and Use
Committee of Seoul National University Hospital. We
performed transient transfection of P19 cells with
CMV ⁄ Gluc ⁄ c14orf24-3¢UTR and CMV⁄ Gluc ⁄ c14orf24-
3¢UTRmt. After 48 h of transfection, the cells were counted
and resuspended in 100 lL of NaCl ⁄ P
i
(2.5 · 10
6
cells per
100 lL of NaCl ⁄ P

i
). These cells were implanted subcutane-
ously into male Balb ⁄ c nude mice (6 weeks old, weighing
25–27 g). The cells containing CMV ⁄ Gluc ⁄ c14orf24-3¢UTR
or CMV ⁄ Gluc ⁄ c14orf24-3¢UTRmt were implanted in both
thighs; the left thigh, without the RA treatment, was used
as a control, and the right thigh was treated with RA coin-
cidently with cell injection. Three mice in each group were
subsequently anesthetized with 2.5% isofluorane, and trans-
ferred into the chamber of an IVIS 100 imager (Xenogen,
Alameda, CA, USA). To acquire images of Gluc, the mice
were directly injected with 5 lg of coelenterazine. The Gluc
H. Y. Ko et al. Bio-imaging of miR124a-targeted c14orf24
FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS 4863
images were acquired with 1 min of exposure time. Then,
to acquire images of firefly luciferase (Fluc), 10 min after
Gluc imaging, 4 mg (150 mgÆkg
)1
body weight) of d-lucifer-
ine was injected intraperitoneally, and Fluc images were
acquired 10 min later. The whole body images for Fluc
activity were acquired for 5 min. Imaging signals from all
the mice were quantitatively analyzed by ROI.
Development of vectors monitoring the
expression of c14orf24 protein
Because the antibody for detecting c14orf24 protein was
not available, we designed Xp-c14orf24 for adding the
Xpress epitope tag to c14orf24 protein. A c14orf24 cDNA
clone was purchased at Gene Bank (KRIBB, Daejeon,
Korea), and we subcloned it into pcDNA3.1 ⁄ His vector

(Invitrogen), with cutting by KpnI and BamHI. Xpress-
tagged c14orf14 proteins were confirmed by western blot
(data not shown).
Immunocytochemistry using Xpress antibody
P19 cells were fixed with 4% formaldehyde for 20 min, and
then washed with NaCl ⁄ P
i
three times for 10 min each;
gentle shaking was provided during incubation. The block-
ing and permeabilization procedures were performed simul-
taneously with a 20% normal goat serum reaction mixture,
and 0.2% Triton X-100 was added to the cells for 1 h. The
Xpress-tagged c14orf14 proteins was detected by 1 : 5000
dilution of anti-Xpress antibody (Invitrogen) and incubated
overnight at 4 °C. After three washes for 10 min each,
Alexa Fluor 594 (Invitrogen) secondary antibody conju-
gates were added and incubated for 90 min at room tem-
perature. The P19 cells were placed on a coverslip and
mounted with aqueous mounting solution containing DAPI
(Vector Laboratories, Inc., Burlingame, CA, USA). Fluo-
rescence signal was detected by confocal laser scanning
microscopy (Carl Zeiss LSM 510, Carl Zeiss, Jena,
Germany).
EdU assay
The cells were passaged using trypsin (Invitrogen), and
seeded in standard medium onto 10 cm dishes (Nunc) at a
concentration of 10 000 cellsÆcm
)2
. The cells were grown
overnight in medium in a humidified incubator at 37 °C

with 5% CO
2
. The cells were then grown for 24 h in med-
ium containing 10 lm EdU. Cells were fixed in 4% parafor-
maldehyde in NaCl ⁄ P
i
(pH 7.4). The EdU-positive cells
were labeled with the fluorescent azide probe, and this was
followed by immunofluorescence labeling. Samples were
blocked and permeabilized for 30 min at room temperature
with 2% BSA in saponin-based permeabilization reagent
(Invitrogen).
For each EdU experiment, three random fields were
imaged at · 100 magnification, and the numbers of EdU-
positive cells were counted. EdU-positive cells were
expressed as a percentage of the total number of cells in
each field, analyzed using FACSCalibur. Each experiment
was performed in triplicate, and the results are presented as
mean ± standard error of the mean.
Statistical analysis
Data are displayed as means ± standard error of the mean,
and were calculated using Student’s t-test. Statistical signifi-
cance was accepted at P-values of < 0.05.
Acknowledgements
This work was supported by the Nano Bio Rege-
nomics Project (2005-00113) and by the National
R&D Program for Cancer Control of the Ministry of
Health & Welfare (0820320).
References
1 Lee Y, Jeon K, Lee JT, Kim S & Kim VN (2002) Micr-

oRNA maturation: stepwise processing and subcellular
localization. EMBO J 21, 4663–4670.
2 Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J,
Provost P, Ra
˚
dmark O, Kim S et al. (2003) The nuclear
RNase III Drosha initiates microRNA processing.
Nature 425, 415–419.
3 Hutvagner G & Zamore PD (2002) A microRNA in a
multiple-turnover RNAi enzyme complex. Science 297,
2056–2060.
4 Bartel DP (2004) MicroRNAs: genomics, biogenesis,
mechanism, and function. Cell 116, 281–297.
5 Ambros V (2004) The functions of animal microRNAs.
Nature 431, 350–355.
6 Lewis BP, Burge CB & Bartel DP (2005) Conserved
seed pairing, often flanked by adenosines, indicates that
thousands of human genes are microRNA targets. Cell
120, 15–20.
7 Chalfie M, Horvitz HR & Sulston JE (1981) Mutations
that lead to reiteration in the cell lineages of C. elegans.
Cell 24, 59–69.
8 Dostie J, Mourelatos Z, Yang M, Sharma A & Drey-
fuss G (2003) Numerous microRNPs in neuronal cells
containing novel miRNAs. RNA 9, 180–186.
9 Xu P, Vernooy SY, Guo M & Hay BA (2003) The
Drosophila microRNA Mir-14 supresses cell death and
is required for normal fat metabolism. Curr Biol 13,
790–795.
10 Brennecke J, Hipfinder DR, Strark A, Russell RB &

Cohen SM (2003) Bantan encodes a developmentally
regulated microRNA that controls cell proliferation and
Bio-imaging of miR124a-targeted c14orf24 H. Y. Ko et al.
4864 FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS
regulates the proapototic gene hid in Drosophila. Cell
113, 25–36.
11 Smirnova L, Grafe A, Seiler A, Schumacher S, Nitsch
R & Wulczyn FG (2005) Regulation of miRNA expres-
sion during neural cell specification. Eur J Neurosci 21 ,
1469–1477.
12 Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS,
Church GM & Ruvkun G (2004) Identification of many
microRNAs that copurify with polyribosomes in mam-
malian neurons. Proc Natl Acad Sci USA 101, 360–365.
13 Deo M, Yu JY, Chung KH, Tippens M & Turner DL
(2006) Detection of mammalian microRNA expression
by in situ hybridization with RNA oligonucleotides. Dev
Dyn 235, 2538–2548.
14 Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schel-
ter JM, Castle J, Bartel DP, Linsley PS & Johnson JM
(2005) Microarray analysis shows that some microR-
NAs downregulate large numbers of target mRNAs.
Nature 433, 769–773.
15 Visvanathan J, Lee S, Lee B, Lee JW & Lee SK (2007)
The microRNA miR-124 antagonizes the anti-neural
REST ⁄ SCP1 pathway during embryonic CNS develop-
ment. Genes Dev 21, 744–749.
16 Makeyev EV, Zhang J, Carrasco MA & Maniatis T
(2007) The microRNA miR-124 promotes neuronal
differentiation by triggering brain-specific alternative

pre-mRNA splicing. Mol Cell 27, 435–448.
17 Cao X, Pfaff SL & Gage FH (2007) A functional study
of miR-124 in developing neural tube. Genes Dev 21,
531–536.
18 Yu JY, Chung KH, Deo M, Thompson RC & Turner
DL (2008) MicroRNA miR-124 regulates neurite out-
growth during neuronal differentiation. Exp Cell Res
14, 2618–2633.
19 Ottobrini L, Ciana P, Biserni A, Lucignani G & Maggi
A (2006) Molecular imaging: a new way to study molec-
ular processes in vivo. Mol Cell Endocrinol 246, 69–75.
20 Doubrovin M, Serganova I, Mayer-Kuckuk P, Ponoma-
rev V & Blasberg RG (2004) Multimodality in vivo molec-
ular-genetic imaging. Bioconjug Chem 15, 1376–1388.
21 Lee JY, Kim S, Hwang DW, Jeong JM, Chung JK, Lee
MC & Lee DS (2007) Development of dual-luciferase
reporter system for in vivo visualization of microRNA
biogenesis and post-transcriptional regulation. J Nucl
Med 49, 285–294.
22 Tannous BA, Kim DE, Fernandez JL, Weissleder R &
Breakefield XO (2005) Codon-optimized Gaussia lucif-
erase cDNA for mammalian gene expression in culture
and in vivo. Mol Ther 11, 435–443.
23 Ko MH, Kim S, Hwang DW, Ko HY, Kim YH & Lee
DS (2008) Bioimaging of the unbalanced expression of
microRNA9 and microRNA9* during the neuronal dif-
ferentiation of P19 cells. FEBS J 275, 2605–2616.
24 Kim HJ, Kim YH, Lee DS, Chung JK & Kim S (2008)
In vivo imaging of functional targeting of miR-221
in papillary thyroid carcinoma. J Nucl Med 49, 1686–

1693.
25 Salic A & Mitchison TJ. (2008) A chemical method for
fast sensitive detection of DNA synthesis in vivo. Proc
Natl Acad Sci USA 105, 2415–2420.
26 Soken T, Yasushi O & Gozoh T (2006) MicroRNA:
Biogenetic and functional mechanisms and involvements
in cell differentiation and cancer. J Pharmacol Sci 101 ,
267–270.
27 Norio N, Tomosaburo T, Ryoji K, Isodono K, Asada
S, Ueyama T, Matsubara H & Oh H (2006) MicroR-
NA-1 facilitates skeletal myogenic differentiation with-
out affecting osteoblastic and adipogenic differentiation.
Biochem Biophys Res Commun 350, 1006–1012.
28 Zhu S, Si ML, Wu H & Mo YY (2007) MicroRNA-21
targets the tumor suppressor gene tropomyosin 1
(TPM1). J Biol Chem 82 , 14328–14336.
29 Baroukh N, Ravier MA, Loder MK, Hill EV, Bounacer
A, Scharfmann R, Rutter GA & Van Obberghen E
(2007) MicroRNA-124a regulates Foxa2 expression and
intracellular signaling in pancreatic beta-cell lines. J Biol
Chem 282, 19575–19588.
Supporting information
The following supplementary material is available:
Table S1. The list of miR124a-predicted targets
obtained through bioinformatics analysis.
Table S2. A list of RT-PCR primers.
Table S3. A list of primer pairs for monitoring
miR124a and c14orf24.
Table S4. A list of RT-PCR primers for predicting
miR124a targets.

This supplementary material can be found in the
online article.
Please note: As a service to our authors and readers,
this journal provides supporting information supplied
by the authors. Such materials are peer-reviewed and
may be re-organized for online delivery, but are not
copy-edited or typeset. Technical support issues arising
from supporting information (other than missing files)
should be addressed to the authors.
H. Y. Ko et al. Bio-imaging of miR124a-targeted c14orf24
FEBS Journal 276 (2009) 4854–4865 ª 2009 The Authors Journal compilation ª 2009 FEBS 4865