Báo cáo khoa học: Inhibition of PI3K/Akt partially leads to the inhibition of PrPC-induced drug resistance in gastric cancer cells pdf

Inhibition of PI3K/Akt partially leads to the inhibition of
PrP
C
-induced drug resistance in gastric cancer cells
Jie Liang*, Fulin Ge*, Changcun Guo, Guanhong Luo, Xin Wang, Guohong Han, Dexin Zhang,
Jianhong Wang, Kai Li, Yanglin Pan, Liping Yao, Zhanxin Yin, Xuegang Guo, Kaichun Wu, Jie Ding
and Daiming Fan
State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Fourth Military Medical University, Xi’an, Shaanxi, China
Cellular prion protein (PrP
C
) is a ubiquitous glyco-
protein that is localized at the cell surface via a
glycosyl-phosphatidylinositol-anchored membrane pro-
tein, whose pathogenic isoform, PrP
Sc
, has attracted
worldwide attention due to its involvement in the path-
ogenesis of bovine spongiform encephalopathy and
Creutzfeldt–Jakob disease in human beings [1]. PrP
C
is
highly conserved in mammalian species, and has
been postulated to be involved in one or more of the
following activities: neurotransmitter metabolism, cell
adhesion, signal transduction, antioxidant activity and
programmed cell death [2]. However, the exact biologi-
cal function of normal PrP
C
is still unknown [3].
In our previous studies, PrP
C

was identified as an
upregulated gene in the adriamycin (ADR)-resistant
gastric carcinoma cell line SGC7901/ADR compared
to its parental cell line SGC7901 by subtractive hybrid-
ization and RT-PCR [4]. PrP
C
was further found to be
Keywords
drug resistance; gastric cancer; P-gp;
PI3K/Akt; prion protein
Correspondence
J. Ding, State Key Laboratory of Cancer
Biology and Xijing Hospital of Digestive
Diseases, Fourth Military Medical University,
Xi’an 710032, China
Fax: +86 29 82539041
Tel: +86 29 84771504
E-mail:
D. Fan, State Key Laboratory of Cancer
Biology and Xijing Hospital of Digestive
Diseases, Fourth Military Medical University,
Xi’an 710032, China
Fax: +86 29 82539041
Tel: +86 29 84775221
E-mail:
*These authors contributed equally to this
work
(Received 1 October 2008, revised 16
November 2008, accepted 24 November
2008)

doi:10.1111/j.1742-4658.2008.06816.x
Cellular prion protein (PrP
C
), a glycosyl-phosphatidylinositol-anchored
membrane protein with unclear physiological function, was previous found
to be upregulated in adriamycin (ADR)-resistant gastric carcinoma cell line
SGC7901/ADR compared to its parental cell line SGC7901. Overexpres-
sion of PrP
C
in gastric cancer has certain effects on drug accumulation
through upregulation of P-glycoprotein (P-gp), which is suggested to play
an important role in determining the sensitivity of tumor cells to chemo-
therapy and is linked to activation of the phosphatidylinositol-3-kinase/Akt
(PI3K/Akt) pathway. In the present study, we further investigate the role
of the PI3K/Akt pathway in PrP
C
-induced multidrug-resistance (MDR) in
gastric cancer. Immunohistochemistry and confocal microscope detection
suggest a positive correlation between PrP
C
and phosphorylated Akt
(p-Akt) expression in gastric cancer. Using established stable PrP
C
transfec-
tant cell lines, we demonstrated that the level of p-Akt was increased in
PrP
C
-transfected cells. Inhibition of PrP
C
expression by RNA interference

resulted in decreased p-Akt expression. Inhibition of the PI3K/Akt path-
way by one of its specific inhibitors, LY294002, or by Akt small interfering
RNA (siRNA) resulted in decreased multidrug resistance of SGC7901 cells,
partly through downregulation of P-gp induced by PrP
C
. Taken together,
our results suggest that PrP
C
-induced MDR in gastric cancer is associated
with activation of the PI3K/Akt pathway. Inhibition of PI3K/Akt by
LY2940002 or Akt siRNA leads to inhibition of PrP
C
-induced drug resis-
tance and P-gp upregulation in gastric cancer cells, indicating a possible
novel mechanism by which PrP
C
regulates gastric cancer cell survival.
Abbreviations
ADR, adriamycin; IR, immunoreactivity; MDR, multidrug-resistance; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide; P-gp,
P-glycoprotein; PI3K/Akt, phosphatidylinositol-3-kinase/Akt; PrP
C
, cellular prion protein; siRNA, small interfering RNA; VCR, vincristine.
FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS 685
highly expressed in the gastric cancer cell lines
SGC7901/ADR and SGC7901/VCR. Its overexpres-
sion played a certain role in drug accumulation in
gastric cancer cells, which could induce drug resistance
in SGC7901 cells by decreasing accumulation and
increasing release of these drugs (ADR and VCR) [5].
PrP

C
-mediated multidrug resistance (MDR) was
thought to be related to upregulation of P-glycoprotein
(P-gp) [6] and inhibition of apoptosis [6–9]; these stud-
ies were the first reports that PrP
C
can induce the
MDR phenotype in gastric cancer cells.
Activation of the phosphatidylinositol-3-kinase/Akt
(PI3K/Akt) pathway is a critical step in determining
the sensitivity of tumor cells to chemotherapy [10].
A previous study demonstrated that MDR in gastric
cancer could be reversed by downregulation of Akt1
by Akt1 small interfering RNA (siRNA) [11]. Other
studies strongly suggested that the PI3K/Akt path-
way is involved in certain functions of PrP [12,13].
Some differentially expressed genes involved in the
PI3K/Akt pathway were found to be overexpressed
in breast cancer cell line MCF7, together with
17-fold upregulation of PrP [14].
In present study, we hypothesized that the PI3K/Akt
pathway is involved in PrP
C
-mediated MDR in gastric
cancer. To test this hypothesis, the expression of Akt
and PrP
C
was examined by immunohistochemistry and
confocal microscope in human gastric cancer cases and
cell lines. Expression of total and p-Akt was detected in

cells transfected with PrP
C
. The effects of PI3K/Akt on
PrP
C
-induced MDR in gastric cancer were then exam-
ined by a drug sensitivity assay that involved adding the
PI3K/Akt-specific inhibitor LY294002 or co-transfec-
tion with Akt siRNA. The underlying mechanisms were
further explored by RT-PCR, Western blotting and the
luciferase reporter assay.
Results
Co-expression of PrP
C
and Akt in gastric cancer
Immunohistochemical staining showed that PrP
C
was
expressed in the cytoplasm of neoplastic cells in 70.6%
(60/85) of gastric cancer tissues. Although PrP
C
also
showed expression in adjacent nontumor gastric tissue,
this was significantly lower than in gastric cancer cells
(P < 0.05). Phosphorylated Akt (p-Akt) immuno-
reactivity was observed in 88.2% (75/85) of gastric
cancer tissues, with positive signals mainly in the cyto-
plasm of neoplastic cells. As PrP
C
and p-Akt expres-

sion coexisted in gastric cancer tissues, we analyzed
their correlation in 60 cases of PrP
C
-positive gastric
cancer tissues. Spearman analysis showed that there
was a significant correlation between PrP
C
and p-Akt
immunoreactivity, with rs = 0.514, P < 0.01 (Fig. 1A).
The correlation of p-Akt with PrP
C
in gastric cancer
tissues suggests possible co-expression.
To test this hypothesis, PrP
C
and p-Akt were
co-expressed in SGC7901/ADR cells. The yellow stain-
ing in dual-labeling experiments indicated overlapping
areas of red and green fluorescence, suggesting
co-expression of p-Akt with PrP
C
in the cytoplasm of
SGC7901/ADR cells (Fig. 1B). These results suggested
a positive correlation between PrP
C
and p-Akt expres-
sion in gastric cancer.
Induced activation of p-Akt in PrP
C
-transfected

cells
Our previous work has shown that PrP
C
expression
was detected in several different histological types of
human gastric cancer cell lines, and is relatively low in
SGC7901 cells and high in AGS. To upregulate or
downregulate PrP
C
expression, the PRNP gene was
stably transfected into human gastric cancer cells of
line SGC7901 or blocked by siRNA in AGS. After cell
transfection and antibiotic screening for more than
2 months, multiple resistance clones were selected, and
expression of PrP
C
in the cells was confirmed by Wes-
tern blotting (Fig. 2A). As close correlation of p-Akt
with PrP
C
was found in gastric cancer tissues, we won-
dered whether PrP
C
could regulate the expression of
Akt in transfected cells. As shown in Fig. 2B, there
was higher expression of the phosphorylated form of
Akt (Thr308) in SGC7901 transfected with PrP
C
(SGC7901/PrP
C

) than in SGC7901 transfected with
empty pcDNA3.1B (SGC7901/pcDNA3.1B) or non-
transfected SGC7901, which did not affect the expres-
sion of total Akt. As the siRNA affected translation
but not post-translational events, both the total and
phosphorylated Akt levels decreased in AGS/PrP
C
(RNAi). These results indicate that alteration of PrP
C
expression led to a corresponding change in the PI3K/
Akt pathway in gastric cancer cells lines, and con-
firmed that PrP
C
regulates the expression of p-Akt
in vitro, consistent with the above in vivo findings.
PI3K/Akt is involved in PrP
C
-mediated MDR in
gastric cancer
In order to study whether activation of the PI3K/Akt
signaling pathway played a role in PrP
C
-induced MDR
in gastric cancer cells, the PrP
C
-overexpressing cell line
and the corresponding controls were treated with
LY294002, a selective inhibitor of PI3K, or by
co-transfection with Akt siRNA [13]. The in vitro
PI3K/Akt in PrP

C
-induced MDR J. Liang et al.
686 FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS
effects of the anticancer drugs on the growth of
SGC7901/PrP
C
, SGC7901/pcDNA3.1B and SGC7901
were evaluated by the 3-(4,5-dimethylthiazol-2-yl)-
2,5-diphenyl-tetrazolium bromide (MTT) assay. As
shown in Table 1, in the absence of LY294002 or Akt
siRNA, the control and parental cells showed higher
sensitivity to ADR and VCR than adding LY294002
or Akt siRNA. However, the inhibitory rate in cells
transfected with PrP
C
was significantly different to that
in control cells (P < 0.05). When the cells were treated
with a high dose of the inhibitor LY294002 (40 lm)or
co-transfected with Akt siRNA (1 lg) for 24 h, the
relative inhibitory rate in SGC7901/PrP
C
was
decreased to levels similar to the controls because of
their toxicity in cell death (P > 0.05).
The effects of LY294002 on adriamycin accumula-
tion and retention in SGC7901/PrP
C
cells were further
determined by flow cytometric analysis. The adria-
mycin-releasing index in gastric cancer SGC7901 cells

was calculated as follows: releasing index = (accumu-
lation value ) retention value)/accumulation value.
The results showed less adriamycin accumulation and
retention in SGC7901/PrP
C
cells compared with that
in controls. When the cells were treated with
LY294002 or co-transfected with Akt siRNA for 24 h,
the accumulation and retention of adriamycin
increased in both cell lines, but was more significant in
SGC7901/PrP
C
(P < 0.05). The above results indi-
cated a partly dose-dependent effect, but the effect
more significant at concentrations of 10 lm LY294002
or 0.2 lg Akt siRNA. The releasing index also
decreased more sharply at 10 lm LY294002 or 0.2 lg
Akt siRNA in SGC7901/PrP
C
. The highest concentra-
tions of LY294002 (40 lm) or Akt siRNA (1 lg)
resulted in similar releasing rates to each other because
of their toxicity effect (P > 0.05) (Fig. 3). The results
indicated that inhibition of the PI3K/Akt signaling
pathway leads to inhibition of PrP
C
-induced cell drug
resistance in gastric cancer cells.
PI3K/Akt is involved in the activation of P-gp by
PrP

C
in gastric cancer
To further investigate the underlying mechanism of
PI3K/Akt-mediated PrP
C
-induced gastric cancer MDR,
the PrP
C
-overexpressing cell lines (SGC7901/PrP
C
) and
corresponding controls (SGC7901/pcDNA) were trea-
ted with LY294002 or Akt siRNA to screen the down-
stream molecules. PrP
C
-transfected gastric cancer cells
were treated with LY294002 (10 lm) or Akt siRNA
(0.2 lg), and exhibited downregulation of P-gp at both
the mRNA and protein levels (Fig. 4A). Inhibition of
the PI3K/Akt pathway decreased the expression of P-gp
induced by PrP
C
at both the mRNA and protein levels,
suggesting transcriptional regulation of P-gp by PI3K/
Akt in PrP
C
-transfected gastric cancer cells. Therefore,
the promoter sequence of MDR-1 ()136 to 10) was
amplified, and the luciferase reporter assay was
performed to investigate the transcriptional regulation

of P-gp by PI3K/Akt. The luciferase activity of P-gp
A
B
(a) (b)
(a) (b)
(c) (d)
(c)
Fig. 1. Co-expression of PrP
C
and Akt in
gastric cancer. (A) Serial sections of gastric
cancer tissue were stained with antibodies
against PrP
C
(3F4, Sigma) or p-Akt (Thr 308;
Cell Signaling Technology). (a) Gastric can-
cer tissue stained with anti-p-Akt (Thr 308).
(b) Gastric cancer tissue stained with anti-
PrP
C
. (c) Negative control (original magnifica-
tion, ·200). (B) Co-expression of PrP
C
with
p-Akt in SGC7901/ADR cells. (a) Confocal
microscopic imaging of p-Akt, stained with
monoclonal antibody against p-Akt and FITC-
conjugated goat anti-mouse IgG (green). (b)
Confocal microscopic imaging of PrP
C

,
stained with polyclonal antibody against PrP
(Santa Cruz Biotechnology) and tetraethyl
rhodamine isothiocyanate-labeled rabbit anti-
goat IgG (red). (c) Co-expression of p-Akt
with PrP
C
results in yellow staining. (d)
Co-expression of p-Akt with PrP
C
, with
nuclear staining by 4¢,6-diamidino-2-phenylin-
dole (DAPI) (blue) (original magnification,
·400).
J. Liang et al. PI3K/Akt in PrP
C
-induced MDR
FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS 687
promoter in gastric cancer cells decreased with or with-
out PrP
C
transfection by adding LY294002 or
co-transfection with Akt siRNA. However, SGC7901
transfected with PrP
C
showed significantly decreased
P-gp promoter activity compared with the control cells
(SGC7901/pcDNA and SGC7901 cells) after addition
of LY294002 or co-transfection with Akt siRNA
(Fig. 4B). PI3K/Akt might therefore be involved in

transcriptional activation of P-gp in gastric cancer cells
transfected with PrP
C
. Inhibition of the PI3K/Akt path-
way by its specific inhibitor or Akt siRNA could reverse
the PrP
C
-induced MDR effect, partly through decreas-
ing transcriptional activation of P-gp.
Discussion
In the present study, we present the first evidence that
PI3K/Akt may be involved in the transcriptional acti-
vation of P-gp in gastric cancer cells transfected with
PrP
C
. Inhibition of the PI3K/Akt pathway by its spe-
cific inhibitor or Akt siRNA reverses PrP
C
-induced
MDR in gastric cancer cells, partly by decreasing the
transcriptional activation of P-gp. Continuing from
our previous work, it further reveals the function of
PrP
C
in the MDR of cancers.
Over recent years, many investigations have focused
on the physiological and pathological processes of
PrP
C
[3]. Recently, PrP

C
has been reported to play a
positive role in MDR of many types of human cancers
[15]. Levenson et al. [16] analyzed cell lines in which
MDR had been induced by genetic suppressor ele-
ments of cDNA array hybridization, and found that
the transcription level of PrP
C
was increased. Our pre-
vious studies had shown that PrP
C
is ubiquitously
expressed in gastric carcinoma cell lines and tissues but
is weakly or not expressed in normal gastric mucosa
[6,7,9,13]. In vitro and in vivo drug sensitivity assays
indicated that PrP
C
could promote the drug resistance
of a gastric cancer cell line [5]. However, little is
known about the molecular mechanism involved in
this process.
A
B
Fig. 2. The inducible effect of PrP
C
on Akt. (A) Western blot analy-
sis of the cells transfected with the empty vector or with PrP
C
.
b-actin was used as a loading control. (B) Expression of p-Akt and

total Akt were determined in gastric cancer cells by Western blot.
b-actin was used as an internal control. Autoradiograms were
quantified by densitometry and p-Akt protein levels were calculated
relative to the amount of b-actin protein.
Table 1. IC
50
values (lgÆmL
)1
) for anticancer drugs for gastric cancer cells. Survival rates of gastric cancer cells treated with anticancer
drugs were evaluated by the MTT assay as described in Experimental procedures. Dose–effect curves for the anticancer drugs were plotted
on semi-logarithmic coordinate paper, and IC
50
values were determined. Data are means ± SD of three independent experiments.
Cell lines
LY294002 (l
M) Akt siRNA (lg)
0 10 20 40 0 0.2 0.4 1
Adriamycin
SGC7901/PrP
C
6.87 ± 0.79 4.12 ± 0.64 2.58 ± 0.34 0.84 ± 0.17 6.87 ± 0.79 4.92 ± 0.74 3.76 ± 0.49 1.39 ± 0.25
SGC7901/pcDNA3.1B 0.43 ± 0.03 0.37 ± 0.05 0.28 ± 0.02 0.20 ± 0.03 0.43 ± 0.03 0.38 ± 0.06 0.30 ± 0.03 0.24 ± 0.04
SGC7901 0.31 ± 0.03 0.29 ± 0.04 0.25 ± 0.03 0.19 ± 0.02 0.31 ± 0.03 0.32 ± 0.05 0.26 ± 0.02 0.22 ± 0.04
Vincristine
SGC7901/PrP
C
7.38 ± 0.78 5.21 ± 0.56 2.69 ± 0.38 0.34 ± 0.21 7.38 ± 0.78 5.83 ± 0.59 3.16 ± 0.43 0.83 ± 0.35
SGC7901/pcDNA3.1B 0.24 ± 0.02 0.20 ± 0.03 0.17 ± 0.02 0.09 ± 0.01 0.24 ± 0.02 0.22 ± 0.06 0.18 ± 0.04 0.12 ± 0.03
SGC7901 0.14 ± 0.02 0.12 ± 0.04 0.10 ± 0.03 0.08 ± 0.02 0.14 ± 0.02 0.13 ± 0.05 0.11 ± 0.04 0.09 ± 0.02
PI3K/Akt in PrP

C
-induced MDR J. Liang et al.
688 FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS
P > 0.05
P < 0.05
P < 0.05
P > 0.05
0.45
0.4
0.35
0.3
0.25
0.2
0.15
0.1
0.05
0
Releasing index
P > 0.05
P < 0.05
P < 0.05
P > 0.05
SGC7901/PrP
SGC7901/pcDNA
25
20
30
AB
15
10

5
Fluorescence intensity
0
0 µM 10 µM 20 µM
LY294002
40 µM
0 µg 0.2 µg 0.4 µg
siRNA of Akt
1 µg 0 µg 0.2 µg 0.4 µg
siRNA of Akt
1 µg
0 µM 10 µM 20 µM
LY294002
40 µM
25
20
15
10
5
Fluorescence intensity
0
P < 0.05
P < 0.05
P > 0.05
P > 0.05
0.45
0.4
0.35
0.3
0.25

0.2
0.15
0.1
0.05
0
Releasing index
P > 0.05
P > 0.05
P < 0.05
P < 0.05
SGC7901/PrP
SGC7901/pcDNA
SGC7901/PrP
SGC7901/pcDNA
SGC7901/PrP
SGC7901/pcDNA
Fig. 3. Fluorescence intensity and releasing index of adriamycin in gastric cancer cells. Gastric cancer cells were treated with or without
LY294002 (10, 20 or 40 l
M) or co-transfected with Akt siRNA (0.2, 0.4 or 1 lg) for 24 h. Adriamycin was added to cells in log phase to a
final concentration of 5 lgÆmL
)1
. After 1 h, cells were harvested (for detection of adriamycin accumulation) or cultured in drug-free RPMI-
1640 for another 30 min, followed by harvesting (for detection of adriamycin retention). The fluorescence intensity of intracellular adriamycin
was determined using flow cytometry with an excitation wavelength of 488 nm and an emission wavelength of 575 nm. (A) Fluorescence
intensity analysis of intracellular adriamycin in gastric cancer cells. (B) Adriamycin releasing index of gastric cancer cells. The releasing
index = (accumulation value ) retention value)/accumulation value.
AB
Fig. 4. PI3K/Akt is involved in the activation of P-gp by PrP
C
in gastric cancer. (A) Expression of P-gp at both the mRNA and protein levels

was investigated in PrP
C
-transfected gastric cancer cells treated with LY294002 (10 lM) or Akt siRNA (0.2 lg). b-actin was used as a loading
control. Autoradiograms were quantified by densitometry, and gene or protein levels were calculated relative to the amount of b-actin gene
or protein. (B) Luciferase reporter assay to determine the regulatory effect of PI3K/Akt on MDR-1 promoter activity in PrP
C
-transfected cells.
A dual luciferase system was used in this assay. The promoter activity was measured in terms of relative luminescence units (RLU),
calculated using the following formula: RLU = luminescence intensity of the Firefy luciferase/luminescence intensity of the Renilla luciferase.
Control, cells co-transfected with empty pcDNA3.1 vector or parental cells SGC7901, pGL-MDR vector and pRL-TK vector; PrP
C
, cells
co-transfected with empty pcDNA3.1B/PrP
C
vector treated with or without LY294002 (10 lM) or Akt siRNA (0.2 lg), pGL-MDR vector and
pRL-TK vector. The luciferase activities of each reporter plasmid were measured in triplicate and are expressed as fold inductions after
normalization.
J. Liang et al. PI3K/Akt in PrP
C
-induced MDR
FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS 689
Multidrug resistance (MDR) is one of the major
causes of failure of chemotherapy of human malignan-
cies. Studies have shown that cellular drug resistance is
mediated by various mechanisms operating at various
steps in the cytotoxic activity of the drug, from a
decrease of drug accumulation in the cell to abrogation
of apoptosis induced by the chemical substance. Often
several different mechanisms were switched on in the
cells, but usually one major mechanism was operating.

MDR-1 (ABCB1, P-glycoprotein) is known to signifi-
cantly alter the extent of drug absorption and excre-
tion, which play a key role in the MDR of cancers
[17]. Previous studies identified P-gp as an important
molecule in gastric cancer [4–6,18–20] and leukemia
MDR [20].
PI3K/Akt signal transduction pathway has been
reported to be involved in the neuroprotective effect of
humanin on cerebral ischemia/reperfusion injury [21].
Activation of the PI3K/Akt pathway is one of the
critical steps in cell survival and MDR [22]. The
present study focuses on whether the PI3K/Akt path-
way contributes to the PrP
C
-induced MDR phenotype
in gastric cancer cells. We show that PrP
C
and Akt
are co-expressed in gastric carcinoma, and whose
expression was related to MDR in gastric cancer.
PrP
C
-transfected cell lines showed increased expression
of phosphorylated Akt, indicating that PrP may serve
as a positive upstream regulator of PI3K/Akt in gastric
cancer cells. By inhibiting the PI3K/Akt pathway using
LY294002 or co-transfection with Akt siRNA, the
drug sensitivity and accumulation in SGC7901/PrP
C
cells were significantly increased. The results indicate

that inhibition of the PI3K/Akt signaling pathway
may lead to inhibition of the MDR induced by PrP
C
in gastric cancer cells.
The mechanism underlying PI3K/Akt-mediated
PrP
C
-induced MDR in gastric cancer was further inves-
tigated. PrP
C
-transfected gastric cancer cell lines and
corresponding controls were treated with LY294002 or
Akt siRNA as described previously [6]. PrP
C
-transfected
cells treated with an inhibitor of Akt exhibited downre-
gulation of P-gp at both the mRNA and protein levels;
this was proven to be due to transcriptional inhibition
of MDR-1 using a luciferase reporter assay. Thus the
PI3K/Akt pathway may be involved in transcriptional
activation of P-gp in PrP
C
-transfected gastric cancer
cells, inhibition of which would reverse gastric cancer
MDR, partly by decreasing the transcriptional activa-
tion of P-gp. This model of a PrP
C
/PI3K/P-gp signal
agrees with other reported findings on prion protein sig-
naling. It was found that the Fyn protein governed a

number of the PrP
C
-induced pathways that converged
to the PI3K module in neurons [23]. PI3K is known to
physically associate with Fyn to transducing differen-
tiation signals [24]. It has also been demonstrated that
constitutively activated PI3K enhances activation of
the MDR-1 promoter by 2-acetylaminofluorene [25].
In the present study, we report for the first time that
activation of PI3K/Akt signaling pathway plays an
essential role in PrP-induced MDR in gastric cancer
cells. Inhibition of the PI3K/Akt signaling pathway by
LY2940002 or Akt siRNA leads to inhibition of PrP
C
-
induced cell drug resistance and P-gp upregulation in
gastric cancer cells, which indicated a possible novel
mechanism by which PrP
C
regulates gastric cancer cell
survival.
Experimental procedures
Antibodies and reagents
SP-9000 Histostain-Plus kits were obtained from Zhong-
shan Goldbridge Biotechnology (Beijing, China). The drugs
vincristine (VCR) and adriamycin (ADR) were purchased
from Farmitalia Carlo Erba (Milan, Italy) and Minsheng
Pharmaceutical Company (Hangzhou, China), respectively.
The antibodies rabbit anti-human t-Akt, mouse anti-human
p-Akt and mouse anti-human P-gp, and the PI3K/Akt-

specific inhibitor LY294002 were obtained from Cell Signal-
ing Technology (Beverly, MA, USA). Mouse anti-human
monoclonal PrP
C
serum (3F4) was purchased from Sigma
(St Louis, MO, USA) and rabbit anti-human polyclonal
PrP was purchased from Santa Cruz Biotechnology (Santa
Cruz, CA, USA). The Sp1 immunohistochemistry kit and
fluorescein isothiocyanate (FITC)-labeled goat anti-rabbit
and goat anti-mouse IgG were purchased from Zhongshan
Goldbridge Biotechnology (Beijing, China).
Clinical samples
Eighty-five gastric carcinoma patients (34 females, 51
males; mean age 56.1 ± 11.5 years; range 29–78 years)
were included from a population-based case-controlled
study conducted in Xijing Hospital, Xi’an, China. Patients
whose surgical tissue was used for the study signed
informed consent. All cases of gastric cancer were clini-
cally and pathologically proved. The protocols used in the
study were approved by the hospital’s Protection of
Human Subjects Committee. Formalin-fixed paraffin-
embedded tissue sections were retrieved from archives at
the Department of Pathology. Demographic and clinico-
pathological information was obtained from our popula-
tion-based database, and tumor staging was carried out
for each case according to the classification at the time of
surgery. Thirty cases were classified as well-differentiated,
43 as moderately differentiated and 12 as poorly differen-
tiated gastric cancers.
PI3K/Akt in PrP

C
-induced MDR J. Liang et al.
690 FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS
Immunohistochemistry analysis
Tissue sections from gastric carcinoma were immunostained
using SP-9000 Histostain-Plus kits. The slides were depa-
raffinized, rehydrated, blocked and then primary antibody
was added as described previously [7]. Biotinylated goat
anti-mouse IgG was applied to the cell sections, which were
then incubated at room temperature for 30 min. After
washing with NaCl/P
i
for 10min, the tissues were incubated
with avidin dehydrogenase/biotinylated peroxidase for
30 min. Color was developed by immersion of the sections
in a peroxidase substrate diaminobezidin solution.
Evaluation of immunostaining
All sections were examined independently by two observers
with respect to the various histopathological characteristics
and specific immunoreactivity (IR). The staining was semi-
quantitatively evaluated by assigning a score for the inten-
sity of the IR and for the proportion of cells positively
stained. The intensity of IR (intensity score) was divided
into four categories: 0, no IR; 1, weak IR (+); 2, moderate
IR (++); 3, strong IR (+++). The proportion of posi-
tive cells was classified into five groups: 0, no tumor cells
exhibiting IR; 1, < 25% of the tumor cells exhibiting IR;
2, 25–50% of the tumor cells exhibiting IR; 3, 50–75% of
the tumor cells exhibiting IR; 4, > 75% of the tumor cells
exhibiting IR. The overall score was the multiplication of

the two. The scores were then classified as negative (score 0
or 1) or positive (score ‡ 2).
Cell culture
The human gastric adenocarcinoma cell line SGC7901 was
obtained from Academy of Military Medical Science (Beij-
ing, China). SGC7901/ADR was selected from SGC7901 by
increasing ADR stepwise from 0.01 to 0.8 lgÆmL
)1
, and
has been characterized previously [26]. The cells were
maintained in RPMI-1640 containing 10% heat-inactivated
newborn bovine serum (SiJiQing, Hangzhou. China) at
37° C in a humidified atmosphere of 5% CO
2
and 95% air.
Double immunofluorescence staining
Double immunostaining for antigen co-localization was per-
formed using FITC-conjugated goat anti-mouse IgG (Chem-
icon, Billerica, MA, USA; 1 : 80) and tetraethylrhodamine
isothiocyanate-labeled rabbit anti-goat IgG (Chemicon,
1 : 100). Cells were nuclear-stained using 4¢,6-diamidino-2-
phenylindole (DAPI). The primary antibody combinations
consisted of monoclonal antibody against p-Akt and mono-
clonal antibody against PrP. SGC7901/ADR cells were incu-
bated on glass coverslips for 24 h and fixed with 4%
paraformaldehyde in NaCl/P
i
. The fixed cells were stained
and examined using a FLUOVIEW FV1000 laser scanning
confocal microscope (Olympus, Tokyo, Japan).

Plasmid construction and transfection
The target sequences were aligned to the human genome
database by a blast search to ensure that the chosen
sequences were not highly homologous to those of other
genes. The primers were designed using primer.5 software
(Premier Co., Edmonton, Canada) or the siRNA target
finder at and
are listed in Table 2. siRNAs for PrP, Akt and control were
chemically synthesized (Invitrogen, Carlsbad, CA, USA) and
the target sequences were as previously reported [5–
7,9,13,15]. SGC7901 cells were transfected with the plasmids
and maintained in medium supplied with 400 lgÆmL
)1
of the
neomycin analogue G418 (Life Technologies Inc., Gaithers-
burg, MD, USA). The expression levels of PrP
C
in G418-
resistant clones were evaluated by Western blot analysis.
RNA extraction and semi-quantitative RT-PCR
Total RNA was extracted from SGC7901/PrP
C
and
SGC7901/pcDNA, and DNase was used to decrease the
Table 2. Primers for plasmid construction.
Gene Direction Sequence (5¢-to3¢)
PrP
C
Sense CCCAAGCTTGGGATGGCGAACCTTGGCTGCT
Antisense CGGGATCCTCCCACATCAGGAAGATGAGGA

PrP
C
RNAi1 Sense TTTGTTGCTGTACTCATCCATGACACATGGATGAGTACAGCAACTTTTT
Antisense CTAGAAAAAGTTGCTGTACTCATCCATGTGTCATGGATGAGTACAGCAA
PrP
C
RNAi2 Sense TTTGGTGATACACATCTGCTCAACATGAGCAGATGTGTATCACCTTTTT
Antisense CTAGAAAAAGGTGATACACATCTGCTCATGTTGAGCAGATGTGTATCAC
Akt RNAi Sense TTTGTAGTCATTGTCCTCCAGCACAGCTGGAGGACAATGACTACTTTTT
Antisense CTAGAAAAAGTAGTCATTGTCCTCCAGCTGTGCTGGAGGACAATGACTA
MDR-1 Sense CTCGAGGAATCAGCATTCAG
Antisense AGATCTCTTTGAGCTTGGAAGAGC
MDR-1 promoter Sense CTCGAGGAATCAGCATTCAG
Antisense AGATCTCTTTGAGCTTGGAAGAGC
J. Liang et al. PI3K/Akt in PrP
C
-induced MDR
FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS 691
contamination of genomic DNA. The PCR primers and
reaction parameters used for MDR-1 amplification are
listed in Table 1. The reaction conditions for PCR of
MDR-1 were as follows: initial denaturation at 94° C for
10 min, and 35 cycles of denaturation at 94° C for 30 s,
annealing at 55° C for 30 s and extension at 72° C for 30 s
on a Touchgene gradient thermal cycler (Techne, Cam-
bridge, UK). Appropriate numbers of cycles were chosen to
ensure completion of PCR amplification before reaching
the stable stage in each reaction. Gene expression was
quantified as the relative yield of the PCR product from
target sequences compared to that from the b-actin gene.

PCR products were loaded onto a 1.5% agarose gel and
separated electrophoretically. The gel was then visualized
under ultraviolet light following ethidium bromide staining.
Autoradiograms were quantified by densitometry. Relative
RNA levels were calculated relative to the levels for the
b-actin gene.
Western blot analysis
Cells in log phase were harvested and washed twice for
10 min with NaCl/P
i
, then lyzed in lysis buffer (150 mmolÆ
L
)1
Tris/HCl pH 8.0, 50 mmolÆL
)1
NaCl, 0.2 mmolÆL
)1
EDTA, 0.1 mmolÆL
)1
phenylmethanesulfonyl fluoride and
10 gÆL
)1
Nonidet P-40). Fifty micrograms of protein from
each cell lysate were separated by 12% SDS–PAGE under
denaturing conditions, and transferred to nitrocellulose
membrane (Amersham, Pittsburgh, PA, USA). The mem-
brane was blocked with 10% non-fat dry milk in NaCl/
Tris-T (20 mm Tris/HCl, 100 mm NaCl, 0.1% Tween-20)
for 2 h at room temperature, probed with the primary anti-
bodies against Akt (1 : 1000), p-Akt (Thr308; 1 : 1000),

P-gp (1 : 1000), and PrP
C
3F4 (1 : 1000) overnight at 4° C
and subsequently incubated with horseradish peroxidase-
linked secondary antibodies in NaCl/Tris-T (with 5%
non-fat dry milk). Bound antibodies were visualized by
chemiluminescent substrate as described by the manufac-
turer (Zhongshan Goldbridge Biotechnology). Autoradio-
grams were quantified by densitometry. Protein levels were
calculated relative to the amount of b-actin protein.
In vitro drug sensitivity assay
The P-gp-affecting drugs adriamycin (ADR) and vincristine
(VCR) were both freshly prepared before each experiment.
Drug sensitivity was evaluated using the 3-(4,5-dim-
ethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT)
assay. Cells in the log growth phase were diluted with
200 lL RPMI-1640 supplemented with 100 mLÆL
)1
new-
born bovine serum, and seeded into 96-well plates (Costar,
New York, NY, USA) at a density of 8 · 10
3
cells/well.
After 24 h, the medium was replaced with fresh growth
medium containing various concentrations of drugs and 10,
20 or 40 lm LY294002 or dimethylsulfoxide (solvent
control). After 48 h growth in the presence of drugs, 20 lL
MTT reagent (final concentration 5 gÆL
)1
) was added to

each well, the supernatant was discarded after 4 h, and
150 lL dimethylsulfoxide was added to melt the crystals.
The absorbance of the formazan product was measured
using an ELISA reader (Bio-Rad, Hercules, CA, USA) at a
wavelength of 492 nm. The drug concentration that pro-
duced 50% inhibition of growth (IC
50
) was estimated using
relative survival curves. The survival rate was calculated as
mean A
490
of treated wells/mean A
490
of untreated
wells · 100%, where A
490
indicates the absorbance of the
solution at 490 nm. Finally, dose–effect curves for the anti-
cancer drugs were plotted on semi-logarithmic coordinate
paper and IC
50
values were determined. Each study was
performed in triplicate and repeated three times.
Flow cytometric analysis
Cells were cultured in six-well culture plates at 37° C for
24 h, and ADR was added to a final concentration of
5mgÆL
)1
. After further culture for 1 h, various concentra-
tions of LY294002 (10, 20 or 40 lm) were added and the

mixtures were incubated for 1 h. Dimethylsulfoxide was
used for the negative control. Cells were harvested, or cul-
tured in drug-free medium for another 30 min and then
harvested. The harvested cells were suspended in cold
NaCl/P
i
, and the intracellular adriamycin fluorescence
intensity was determined by flow cytometric analysis with
excitation and emission wavelengths of 488 and 575 nm,
respectively.
Luciferase reporter assay
The promoter sequence of MDR-1 ()136 to 10) was ampli-
fied from the genomic DNA of peripheral blood mono-
nuclear cells by PCR [27]. The primers used are shown in
Table 1. The promoter sequences were then cloned into a
pGL3 enhancer vector (Promega, Madison, WI, USA) to
construct the reporter vector pGL-MDR. SGC7901 cells
were passaged into 24-well plates at a density of
5 · 10
5
cells/well, and incubated until they reached 90%
confluence. pcDNA3.1/PrP
C
or empty pcDNA3.1/V5-his B
plasmids were transfected into SGC7901 cells with
pGL-MDR using Lipofectamine 2000 reagent (Invitrogen).
pRL-TK was used as a control for transfection efficiency.
Luciferase reporter assays were performed using the dual-
luciferase reporter assay system (Promega) according to the
manufacturer’s instructions. Each experiment was per-

formed in triplicate and repeated three times.
Statistical analysis
Each experiment was repeated at least three times.
Numerical data are presented as the means ± SD. The
significance of the difference between means was deter-
PI3K/Akt in PrP
C
-induced MDR J. Liang et al.
692 FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS
mined using Student’s t test. The Wilcoxon signed-rank
test was used to evaluate the intensity of IR and the pro-
portion of cells staining positively in the immunohisto-
chemical assay. Correlation between two groups was
assessed by Spearman analysis. All statistical analyses
were performed using spss11.0 software (SPSS, Chicago,
IL, USA). A P value < 0.05 was considered statistically
significant.
Acknowledgements
This study was supported in part by grants from the
Chinese National Foundation of National Sciences
(30572134 and 30872965) and the National Basic
Rsearch Program of China (2009CB521703). We thank
Professor Jie Liu for the pSilencer vector plasmid used
for siRNA construction. We are also grateful to Bo
Huang (Department of Biochemistry, Fourth Military
Medical University, Xi’an, Shaanxi, China) for help
with the luciferase activity analyses, Dan Chen
(Department of Microscope, Fourth Military Medical
University, Xi’an, Shaanxi, China) for help with confo-
cal microscope detection, and technicians Taidong

Qiao, Zhen Chen, Baojun Chen and Baohua Song for
their excellent technical assistance.
References
1 Prusiner SB, Scott MR, Dearmond SJ & Cohen FE
(1998) Prion protein biology. Cell 93, 337–348.
2 Christensen HM & Harris DA (2008) Prion protein
lacks robust cytoprotective activity in cultured cells.
Mol Neurodegeneration 3, 11.
3 Aguzzi A & Polymenidow M (2004) Mammalian prion
biology. One century of evolving concepts. Cell 116,
313–327.
4 Zhao Y, You H, Liu F, An H, Shi Y & Fan D (2002)
Differentially expressed gene profiles between multidrug
resistant gastric adenocarcinoma cells and their parental
cells. Cancer Lett 185, 211–218.
5 Du JP, Jin XH, Shi YQ, Zhao YQ, Liu CJ, Cao YX,
Qiao TD, Chen BJ & Fan DM (2003) The overexpres-
sion of prion protein in drug resistant gastric cancer cell
line SGC7901/ADR and its significance. Zhonghua Yi
Xue Za Zhi 83, 328–332.
6 Du J, Pan Y, Shi Y, Guo C, Jin X, Sun L, Liu N, Qiao
T & Fan D (2005) Overexpression and significance of
prion protein in gastric cancer and multidrug-resistant
gastric carcinoma cell line SGC7901/ADR. Int J Cancer
113, 213–220.
7 Liang J, Pan YL, Ning XX, Sun LJ, Lan M, Hong L,
Du JP, Liu N, Liu CJ, Qiao TD et al. (2006) Over-
expression of PrPC and its antiapoptosis function in
gastric cancer. Tumour Biol 27, 84–91.
8 Liang J, Ge FL, Lu YY, Wang J, Zhai HH, Yao LP,

Li TT, Ji Q, Guo XY, Liu ZX et al. (2006) Role of
PrPc related to apoptosis. Experimental and Clinical
Sciences International Journal 5, 11–24.
9 Pan Y, Zhao L, Liang J, Liu J, Shi Y, Liu N, Zhang
G, Jin H, Gao J, Xie H et al. (2006) Cellular prion pro-
tein promotes invasion and metastasis of gastric cancer.
FASEB J 20, 1886–1888.
10 Akiyama H, Furukawa S, Wakisaka S & Maeda T
(2006) Cartducin stimulates mesenchymal chondropro-
genitor cell proliferation through both extracellular
signal-regulated kinase and phosphatidylinositol
3-kinase/Akt pathways. FEBS J 273, 2257–2263.
11 Han Z, Hong L, Wu K, Han S, Shen H, Liu C, Han Y
& Fan D (2006) Reversal of multidrug resistance of gas-
tric cancer cells by downregulation of Akt1 with Akt1
siRNA. J Exp Clin Cancer Res 25, 207–212.
12 Schmalzbauer R, Eigenbrod S, Winoto-Morbach S,
Xiang W, Schu
¨
tze S, Bertsch U & Kretzschmar HA
(2008) Evidence for an association of prion protein and
sphingolipid-mediated signaling. J Neurochem 106,
1459–1470.
13 Liang J, Zhang DX, Pan YL, Shi YQ, Guo CC, Wang
JB, Chen Y, Wang X, Liu J, Guo XG et al. (2007) Cel-
lular prion protein promotes cell proliferation and G1/S
transition of gastric cancer cells SGC7901 and AGS.
FASEB J 28, 173–180.
14 Diarra-Mehrpour M, Arrabal S, Jalil A, Pinson X,
Gaudin C, Pietu G, Pitaval A, Ripoche H, Eloit M,

Dormont D et al. (2004) Prion protein prevents human
breast carcinoma cell line from tumor necrosis factor
alpha-induced cell death. Cancer Res 64, 719–727.
15 Meslin F, Hamaı
¨
A, Gao P, Jalil A, Cahuzac N, Cho-
uaib S & Mehrpour M (2007) Silencing of prion protein
sensitizes breast adriamycin-resistant carcinoma cells to
TRAIL-mediated cell death. Cancer Res 67
, 10910–
10919.
16 Levenson VV, Davidovich IA & Roninson IB (2000)
Pleiotropic resistance to DNA-interactive drugs is asso-
ciated with increased expression of genes involved in
DNA replication, repair, and stress response. Cancer
Res 60, 5027–5030.
17 Regev R, Katzir H, Yeheskely-Hayon D & Eytan GD
(2007) Modulation of P-glycoprotein-mediated multidrug
resistance by acceleration of passive drug permeation
across the plasma membrane. FEBS J 274, 6204–6214.
18 Hao Z, Li X, Qiao T, Du R, Hong L & Fan D (2006)
CIAPIN1 confers multidrug resistance by upregulating
the expression of MDR-1 and MRP-1 in gastric cancer
cells. Cancer Biol Ther 5, 261–266.
19 Du J, Shi Y, Pan Y, Jin X, Liu C, Liu N, Han Q, Lu
Y, Qiao T & Fan D (2005) Regulation of multidrug
resistance by ribosomal protein l6 in gastric cancer cells.
Cancer Biol Ther 4, 242–247.
J. Liang et al. PI3K/Akt in PrP
C

-induced MDR
FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS 693
20 Hong L, Piao Y, Han Y, Wang J, Zhang X, Du Y, Cao
S, Qiao T, Chen Z & Fan D (2005) Zinc ribbon domain-
containing 1 (ZNRD1) mediates multidrug resistance of
leukemia cells through regulation of P-glycoprotein and
Bcl-2. Mol Cancer Ther 4, 1936–1942.
21 Xu X, Chua CC, Gao J, Chua KW, Wang H, Hamdy
RC & Chua BH (2008) Neuroprotective effect of
humanin on cerebral ischemia/reperfusion injury is
mediated by a PI3K/Akt pathway. Brain Res 1227,
12–18.
22 Fantappie
`
O, Solazzo M, Lasagna N, Platini F, Tessito-
re L & Mazzanti R (2007) P-glycoprotein mediates
celecoxib-induced apoptosis in multiple drug-resistant
cell lines. Cancer Res 67, 4915–4923.
23 Santuccione A, Sytnyk V, Leshchyns’ka I & Schachner
M (2005) Prion protein recruits its neuronal receptor
NCAM to lipid rafts to activate p59fyn and to enhance
neurite outgrowth. J Cell Biol 169, 341–354.
24 Frossi B, Rivera J, Hirsch E & Pucillo C (2007) Selec-
tive activation of Fyn/PI3K and p38 MAPK regulates
IL-4 production in BMMC under nontoxic stress condi-
tion. J Immunol 178, 2549–2555.
25 Kuo MT, Liu Z, Wei Y, Lin-Lee YC, Tatebe S, Mills GB
& Unate H (2000) Induction of human MDR-1 gene
expression by 2-acetylaminofluorene is mediated by effec-
tors of the phosphoinositide 3-kinase pathway that acti-

vate NF-kappaB signaling. Oncogene 21, 1945–1954.
26 An H, Zhou S & Fan D (1997) Establishment
and characteristics of an adriamycin resistant human
gastric carcinoma cell line. J Dig Dis Endosc 2,
108–113.
27 Guo CC, Ding J, Yao LP, Sun L, Lin T, Song Y, Sun
LJ & Fan DM (2005) Tumor suppressor gene Runx3
sensitizes gastric cancer cells to chemotherapeutic drugs
by downregulating Bcl-2, MDR-1 and MRP-1. Int J
Cancer 116, 155–160.
PI3K/Akt in PrP
C
-induced MDR J. Liang et al.
694 FEBS Journal 276 (2009) 685–694 ª 2008 The Authors Journal compilation ª 2008 FEBS