Tài liệu Báo cáo khoa học: Role of K22 and R120 in the covalent binding of the antibiotic fosfomycin and the substrate-induced conformational change in UDP-N-acetylglucosamine enol pyruvyl transferase docx

Role of K22 and R120 in the covalent binding of the antibiotic
fosfomycin and the substrate-induced conformational change in
UDP-
N
-acetylglucosamine
enol
pyruvyl transferase
Alison M. Thomas
1,
*, Cristian Ginj
1,
*, Ilian Jelesarov
2
, Nikolaus Amrhein
1
and Peter Macheroux
1
1
Eidgeno
¨
ssische Technische Hochschule Zu
¨
rich, Institute of Plant Sciences, Department of Agricultural and Food Sciences and
Department of Biology, Zu
¨
rich, Switzerland;
2
Universita
¨
tZu
¨

rich, Institute of Biochemistry, Zu
¨
rich, Switzerland
UDP-N-acetylglucosamine enolpyruvyl transferase (MurA),
catalyzes the first step in the biosynthesis of peptidoglycan,
involving the transfer of the intact enolpyruvyl moiety from
phosphoenolpyruvate to the 3¢-hydroxyl group of UDP-N-
acetylglucosamine (UDPNAG). The enzyme is irreversibly
inhibited by the antibiotic fosfomycin. The inactivation is
caused by alkylation of a highly conserved cysteine residue
(C115) that participates in the binding of phos-
phoenolpyruvate. The three-dimensional structure of the
enzyme suggests that two residues may play a decisive role in
fosfomycin binding: K22 and R120. To investigate the role
of these residues, we have generated the K22V, K22E, K22R
and R120K single mutant proteins as well as the K22V/
R120K and K22V/R120V double mutant proteins. We
demonstrated that the K22R mutant protein behaves simi-
larly to wild-type enzyme, whereas the K22E mutant protein
failed to form the covalent adduct. On the other hand, the
K22V mutant protein requires the presence of UDPNAG
for the formation of the adduct indicating that UDPNAG
plays a crucial role in the organization of productive inter-
actions in the active site. This model receives strong support
from heat capacity changes observed for the K22V/R120K
and R120K mutant proteins: in both mutant proteins, the
heat capacity changes are markedly reduced indicating
that their ability to form a closed protein conformation is
impeded due to the R120K exchange.
Keywords: transferase; fosfomycin; antibiotic; mutagenesis;

protein conformation.
A rigid cell wall is essential for the survival of most bacteria.
Compounds that interfere with cell wall biosynthesis or
function, such as b-lactams, are powerful antibiotics and the
bacterial enzymes involved in cell wall biosynthesis are
attractive targets for the development of new drugs [1]. The
biosynthesis of the cell wall component peptidoglycan (or
murein) commences with the transfer of the intact enolpyr-
uvyl moiety of phosphoenolpyruvate to the 3¢-hydroxyl
group of UDP-N-acetylglucosamine (UDPNAG) [2]. This
reaction, catalysed by UDP-N-acetylglucosamine enol-
pyruvyl transferase (MurA), leads to the generation of
UDP-N-acetylenolpyruvylglucosamine (Scheme 1A). The
naturally occurring antibiotic fosfomycin, produced by some
Streptomyces and Pseudomonas species [3–5], irreversibly
inhibits MurA activity by alkylating the thiol group of a
catalytically important cysteine residue, C115 (Scheme 1B)
[6].
The rate of MurA inactivation by fosfomycin is increased
considerably in the presence of UDPNAG [7]. This accel-
erating effect is not due to a change in the reactivity of the
thiol group, as the pK
a
of the thiol group is not affected by
UDPNAG binding [8]. Crystallographic studies have shown
that MurA is subject to a large conformational change upon
binding of UDPNAG and fosfomycin or UDPNAG and
(Z)-3-fluorophosphoenolpyruvate, respectively, to the free,
unliganded enzyme [9–11] (Fig. 1). In the unliganded form,
the active site of MurA is readily accessible (ÔopenÕ confor-

mation) whereas in the liganded form (ÔclosedÕ conforma-
tion) a loop in the upper domain forms a lid on the active
site, thereby shielding the ligands from solvent and gener-
ating a compact structure. This loop movement places the
reactive C115 closer to fosfomycin or (Z)-3-fluorophos-
phoenolpyruvate in the active site (Fig. 1). Hence it can be
assumed that fosfomycin and the thiol group of C115 are
optimally positioned in the closed conformation, so that the
nucleophilic attack of the thiol group is facilitated.
In a recently initiated site-directed mutagenesis program,
we have discovered that replacement of K22 leads to a more
than 300-fold decrease in enzymatic activity [12]. Using
isothermal titration calorimetry (ITC), fosfomycin binding
was detected for the conservative mutation K22R in the
presence of UDPNAG while the K22V and K22E mutant
proteins appeared to have lost this ability completely [12].
According to the three-dimensional structure of MurA [11],
Correspondence to P. Macheroux, Graz University of Technology,
Institute of Biochemistry, Petersgasse 12/II, A-8010 Graz, Austria.
Fax: + 43 316 873 6952, Tel.: + 43 316 873 6450,
E-mail:
Abbreviations: fosfomycin, (1R,2S)-1,2-epoxypropylphosphonic acid;
glyphosate, N-(phosphonomethyl)-glycine; ITC, isothermal titration
calorimetry; MurA, UDP-N-acetylglucosamine enolpyruvyl trans-
ferase; TPCK,
L
-(tosylamido-2-phenyl) ethyl chloromethyl ketone;
UDPNAG, UDP-N-acetylglucosamine; DC
p
, heat capacity change;

DG, free energy change; DH, enthalpy change; DS, entropy change.
*Note: The first two authors contributed equally to this work.
(Received 16 February 2004, revised 26 April 2004,
accepted 30 April 2004)
Eur. J. Biochem. 271, 2682–2690 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04196.x
the positively charged side chain of K22 participates in
fosfomycin binding, thus providing a rationale for the loss of
fosfomycin binding to the K22V and K22E mutant proteins.
However, two other positively charged amino acid side
chains, R397 and R120, are also involved in fosfomycin
binding, and in view of the multitude of interactions, it was
assumed that deletion of a single interaction would not lead
to a complete loss of fosfomycin binding. Therefore it was
argued that K22 may play a role in the transition of the open
and closed conformations, i.e. it is part of a molecular switch
mechanism.
To shed more light on the energetics of the conform-
ational change, we have recently completed a thermody-
namic study of UDPNAG binding to MurA [13]. Based on
the analysis of the measured heat capacity changes (DC
p
),
and on surface accessibility calculations, we have proposed
that binding of UDPNAG alone is accompanied by a
significant structural shift toward the closed conformation,
in agreement with evidence from studies of small angle
X-ray scattering [14] and the protective effect of UDPNAG
on proteolysis of MurA [15]. Here we report the thermo-
dynamic profile of UDPNAG binding to two MurA single
mutants, K22V and R120K, and the double mutant K22V/

R120K. The emphasis is put on analysis of the heat
capacity decrement as this parameter is a sensitive indicator
of both the changes in hydration and the conformational
changes involved in protein–ligand interactions [16,17], and
thus may provide further information on the molecular
mechanism of fosfomycin and UDPNAG binding to
MurA.
Fig. 1. Structural representation of MurA in
the open (A, PDB entry 1NAW [9]), and closed
(B, PDB entry 1UAE [11]), conformation. The
thiol group of C115 is highlighted in green and
the nitrogen atoms of R120 and K22 in blue.
The open form of MurA is unliganded (A) and
the closed conformation (B) contains fosfo-
mycin (orange) and UDPNAG (purple) in the
active site. The loop that carries C115 and
R120 is highlighted in yellow (A) and red (B),
respectively. The figure was prepared using the
program
MOLMOL
[24].
Scheme 1. Reaction catalyzed by MurA (pathway for biosynthesis of UDP-N-acetylmuramic acid) (A) and inactivation mechanism of MurA by
fosfomycin as a result of the covalent linkage between Cys115 of MurA and fosfomycin (B).
Ó FEBS 2004 Lysine 22 and arginine 120 in MurA (Eur. J. Biochem. 271) 2683
In a previous study, we have combined proteolysis with
MALDI-TOF mass spectrometry analysis to demonstrate
that fosfomycin forms the covalent adduct with C115 of
wild-type MurA even in the absence of UDPNAG [13].
Unlike ITC, which relies on measurable heat changes, this
method is independent of the thermodynamic and kinetic

properties of the binding process and is solely based on the
detectability of the peptides of interest. We have used this
method to show that binding of fosfomycin to the K22
mutant proteins strongly depends on the charge of the
amino acid side chain occupying this position. Taken
together, our combined calorimetric and protein chemical
approach leads to a more detailed understanding of the role
of K22 and R120 with respect to fosfomycin binding as well
as the ligand-induced conformational switch.
Experimental procedures
Chemicals and enzymes
Fosfomycin (disodium salt) and UDP-N-acetylglucosamine
(sodium salt) were from Sigma, Buchs, Switzerland. 1,4-
dithio-
D
,
L
-threitol, EDTA, isopropyl thio-b-
D
-galactopyr-
anoside and Hepes were from Fluka, Buchs, Switzerland.
Tris was from BDH Laboratory Supplies, Poole, England.
Trypsin (EC 3.4.21.4) from bovine pancreas
(12 200 UÆmg
)1
; TPCK-treated to inactivate any remaining
chymotryptic activity) was from Sigma, Buchs, Switzerland.
Site-directed mutagenesis
Mutagenesis was carried out using the Quik-change site-
directed mutagenesis kit from Stratagene as previously

described [18]. The following oligonucleotides were used to
change the R120 to a lysine and a valine, respectively (the
codon changes are underlined): 5¢-primer (R to K): 5¢-GGT
TGCGCCATTGGCGCG
AAACCTGTTGACCTGC
ATATC-3¢;3¢-primer (R to K): 5¢-GATATGCAGGTCA
ACAGG
TTTCGCGCCAATGGCGCAACC-3¢;5¢-primer
(R to V): 5¢-GGTTGCGCCATTGGCGCG
GTTCCTGT
TGACCTGCATATC-3¢;3¢-primer (R to V): 5¢-GATATG
CAGGTC
AACAGGAACCGCGCCAATGGCGCA
ACC-3¢.
The template used for amplification was the pKK233-2
plasmid containing Enterobacter cloacae MurA wild-type
(for generation of the R120K single mutant) or the plasmid
encoding the K22V mutant (for generation of the K22V/
R120K double mutant) [12]. The whole gene was resequ-
enced after site-directed mutagenesis in order to confirm
the introduction of the desired mutation and to exclude
that unwanted mutations occurred elsewhere in the gene
(Microsynth, Balgach, Switzerland).
Expression and purification of proteins
Wild-type MurA (from Enterobacter cloacae)andtheK22V,
K22E, K22R, R120K, K22V/R120V and K22V/R120K
mutant proteins were expressed and purified as previously
described [12,19]. The yield of purified K22V/R120V protein
was very low (< 1% as compared to wild-type) shown by
the lack of binding to the ÔReactive YellowÕ material used

in affinity chromatography. Therefore microcalorimetric
measurements (see below) could only be performed with the
K22V, R120K and K22V/R120K mutant proteins.
The protein concentration was determined using an
extinction coefficient of 24 020
M
)1
Æcm
)1
at 280 nm or with
Bradford reagent (Pierce) using bovine serum albumin
(BSA) for calibration.
MALDI-TOF-MS analysis of fosfomycin binding
Wild-type MurA, the K22V, K22R and K22E single
mutant proteins and the K22V/R120K and K22V/R120V
double mutant proteins (100 l
M
) were incubated for 50 min
at 25 °Cin50m
M
Tris/HCl, pH 7.4 under each of the
following conditions: (a) no substrates; (b) 10 m
M
fosfo-
mycin; (c) 10 m
M
fosfomycin and 1 m
M
UDPNAG; and
(d) 1 m

M
fosfomycin and 10 m
M
UDPNAG. Trypsin
(0.5 mgÆmL
)1
) was added to the reaction and incubated
for 16 h at 25 °C. Removal of excess substrates was
achieved by desalting the reactions using pre-equilibrated
Sep-Pak C
18
columns (Waters) as previously described
[13,18]. MALDI-TOF-MS spectra were recorded with a
Voyager Elite mass spectrometer using the reflectron mode
for increased mass accuracy; interpretation of the spectra
was based on the analysis reported earlier [15].
Isothermal titration calorimetry
All measurements were carried out in 50 m
M
Hepes/NaOH,
pH 7.4, containing 2 m
M
dithiothreitol and 0.5 m
M
EDTA.
Sample preparation and titrations were performed as
described previously [12] using a MCS isothermal titration
microcalorimeter from Microcal Inc. The K22V, R120K
and K22V/R120K MurA variants (200–420 l
M

)were
titrated with UDPNAG from a 5 m
M
stock solution at
temperatures between 10 and 30 °C. The double mutant
proteins were not stable at 30 °C with stirring in the ITC
cell; the data obtained at this temperature was not included
in the analysis. The raw data were integrated and normal-
ized for molar concentration. The dissociation constants, K
d
values, enthalpies of binding and stoichiometries were
determined from the binding isotherm by fitting a 1 : 1
binding model to the data using the software provided by
the manufacturer.
Results
Reaction of fosfomycin with wild-type and
the K22V, K22E and K22R mutant proteins
We have shown previously by ITC that fosfomycin binding
to wild-type MurA and the K22 mutant proteins in the
presence of UDPNAG is accompanied by heat release in the
case of wild-type enzyme and the K22R mutant protein, but
is calorimetrically silent with the K22V and K22E mutant
proteins. This was interpreted as a lack of fosfomycin
binding to these mutant proteins [12]. Binding of fosfomycin
to either wild-type MurA or the K22 mutant proteins in the
absence of UDPNAG is not associated with a heat change
in any case.
To gain further information on fosfomycin binding to
MurA, we have developed a rapid and reliable method to
detect the covalent adduct formed between the thiol group

2684 A. M. Thomas et al. (Eur. J. Biochem. 271) Ó FEBS 2004
of C115 and fosfomycin (Scheme 1B). Trypsinolysis of wild-
type MurA and the K22 mutant proteins (Fig. 2A and B)
produces a peak at 1616 Da (m/z) comprising amino acids
104–120 [15]. Incubation of wild-type MurA with fosfo-
mycin prior to trypsinolysis in the absence or presence
of UDPNAG results in the appearance of a new peak at
1754 Da (m/z) which is assigned to the Cys115–fosfomycin
covalent adduct (observed mass difference ¼ 138 Da, as
expected) (Fig. 2C, E and G). At the same time the peak of
the unlabeled peptide fragment disappears or becomes
Fig. 2. Comparison of MALDI-TOF spectra between the masses of 1600 and 1800 for wild-type Enterobacter cloacae MurA (left) and the K22V
mutant protein (right). (A and B) Tryptic digest of wild-type MurA and the K22V mutant protein (no additions). (C and D) Wild-type E. cloacae
MurA and the K22V mutant protein incubated with 10 m
M
fosfomycin prior to digestion. (E and F) Wild-type MurA and the K22V mutant
protein incubated with 1 m
M
UDPNAG and 10 m
M
fosfomycin prior to digestion. (G and H) Wild-type MurA and the K22V mutant protein
incubated with 10 m
M
UDPNAG and 1 m
M
fosfomycin prior to digestion. The mass peak of 1616 (m/z) is due to the peptide of amino acids 104–
120 and on binding of fosfomycin this mass shifts to 1754 (m/z). The peak at 1657 (m/z) is attributed to the peptide fragment comprising amino acids
295–310 and is attributed to tryptic and chymotryptic cleavage.
Ó FEBS 2004 Lysine 22 and arginine 120 in MurA (Eur. J. Biochem. 271) 2685
much less intense. When the same experiment is carried out

with the K22 mutant proteins, marked differences are
observed: in the case of the K22V mutant protein, covalent
binding of fosfomycin requires the presence of UDPNAG
(Fig. 2D, F and H) while the K22E mutant protein lacks the
ability to form the covalent adduct completely (Table 1). On
the other hand, the K22R mutant protein behaves very
similar to wild-type enzyme (data not shown). While the
results obtained with the K22R and K22E mutant proteins
are in agreement with the ITC measurements, the K22V
mutant protein clearly binds fosfomycin covalently, albeit
only in the presence of UDPNAG. This finding is in
contrast to the lack of a heat signal in ITC measurements.
Hence it can be concluded that the absence of an ITC signal
with this mutant protein is not due to a lack of adduct
formation, but rather indicates that the binding process is
not associated with a measurable net heat change.
The finding that binding of UDPNAG to the K22V
mutant protein restores the ability to form the covalent
adduct with fosfomycin raises a question about the
molecular mechanism of this salvage process. The three-
dimensional structure of the ternary complex [11] indicates
that UDPNAG interacts with the phosphonate group of
fosfomycin and also with the guanidinium group of R120,
which in turn forms a salt-bridge to the phosphonate group
(see below). This amino acid residue is invariant in all
known MurA sequences and is part of the loop region that
forms a lid on the active site upon the formation of the
closed protein conformation (Fig. 1). Hence, it is plausible
that UDPNAG plays a direct role and/or an indirect role to
engage residues in the loop for binding interactions with the

phosphonate group of fosfomycin (or with the phosphate
group of phosphoenolpyruvate during normal catalysis). In
order to investigate the importance of R120 for the
formation of the covalent fosfomycin adduct, we construc-
ted the K22V/R120V and K22V/R120K double mutants
(see Materials and methods) and repeated the analysis of
adduct formation in the absence and presence of UDP-
NAG. As shown in Fig. 3, the K22V/R120K mutant
Table 1. Covalent adduct formation with fosfomycin and enzymatic
activity of wild-type MurA and the protein mutants investigated in this
study. Proteins were incubated with fosfomycin alone (10 m
M
final
concentration) or with fosfomycin and UDPNAG. The latter experi-
ment was performed using either 10 m
M
fosfomycin and 1 m
M
UDPNAG or 1 m
M
fosfomycin and 10 m
M
UDPNAG, respectively.
The results obtained under these two different conditions were essen-
tially the same. +, indicates detection of the fosfomycin-labelled
tryptic fragment comprising amino acids 104–120; –, no detection. The
effect of the mutation(s) on catalytic activity is also listed. *, Residual
activities too small to be measured reliably.
Protein Fosfomycin
Fosfomycin +

UDPNAG
Activity
(%)
Wild-type + + 100
K22R + + 0.3
K22V – + 0.03
K22E – – 0.05
R120K – – <0.05
K22V/R120K – – *
K22V/R120V – – *
Fig. 3. Incubation of the K22V/R120K double mutant protein with
fosfomycin followed by MALDI-MS analysis. The experimental con-
ditions are as described in the legend to Fig. 2. (A) The double mutant
proteinwithnoadditions;(B)incubationwith10m
M
fosfomycin;
(C) incubation with 10 m
M
fosfomycin and 1 m
M
UDPNAG and
(D) incubation with 1 m
M
fosfomycin and 10 m
M
UDPNAG. The
peak of the unlabeled tryptic fragment (amino acids 295–310) is at 1588
(m/z) and when labelled with fosfomycin a peak at 1726 (m/z)is
expected. The position of the expected mass of the fosfomycin-labelled
peak is marked by an arrow in each panel.

2686 A. M. Thomas et al. (Eur. J. Biochem. 271) Ó FEBS 2004
protein did not form the covalent fosfomycin adduct, even
in the presence of UDPNAG (Fig. 3C,D). Note that the
mass shift of the unlabeled fragment (amino acids 104–120)
from 1616 Da (MH
+
) to 1588 Da (MH
+
) is due to the
arginine to lysine exchange in position 120 (expected mass
shift ¼ 28 Da).
The data collected for wild-type MurA, the three single
and two double mutant proteins are summarized in Table 1.
From this analysis, it is clear that even a conservative amino
acid exchange from arginine to lysine at position 120
disables the UDPNAG-dependent rescue mechanism for
the formation of a covalent adduct. This in turn suggests
that UDPNAG assists in the assembly of the proper
interactions in the active site by stabilizing the closed
conformation of the protein. In the closed conformation,
R120 moves from an ÔoutsideÕ position into an ÔinsideÕ
position close to the negatively charged phosphonate (in the
case of fosfomycin) or phosphate (in the case of phos-
phoenolpyruvate) group (Fig. 1, compare panel A and B).
From this it would follow that R120 is an important residue
in the stabilization of the closed conformation of the
protein. This hypothesis can be tested by assessing the extent
of the conformational change occurring upon addition of
UDPNAG to a mutant protein carrying a different amino
acid residue in position 120. The experimental strategy

chosen to test our hypothesis was recently established with
wild-type enzyme demonstrating that the conformational
changes occurring upon ligand binding are accompanied by
significant heat capacity changes.
Determination of the heat capacity changes for the K22V,
R120K and K22V/R120K mutant proteins
In a recent study, we measured the thermodynamic
parameters for UDPNAG binding to wild-type enzyme as
a function of temperature [13]. The heat capacity change
(DC
p
) was obtained from the slope of Kirchoff’s plots (DH
vs. T). Analysis of the experimental DC
p
with DC
p
calculated from the change of solvent accessible surface
upon transition from the open to the closed MurA
conformation, indicates that UDPNAG binding alone
induces the formation of the closed conformation to a large
extent [13]. We have carried out the same analysis with the
K22V and R120K single and the K22V/R120K double
mutant proteins in order to obtain information on how the
replacement of these two important side chains affect the
protein conformational change.
The binding of UDPNAG is only slightly weaker
(threefold) for the single and double mutant proteins.
Therefore, the experiments were conducted under similar
experimental conditions as for wild-type enzyme [12]. All
thermodynamic parameters derived from our experiments

are summarized in Table 2. As shown in Fig. 4B, binding of
UDPNAG to the K22V mutant protein is exothermic, and
DH, DS and DC
p
are the same (within error) as the values
reported previously for wild-type enzyme [13]. On the other
hand, UDPNAG binding to the K22V/R120K double
mutant protein (Fig. 4A) is less exothermic in the entire
temperature interval and DC
p
¼ 1.38 kJÆmol
)1
ÆK
)1
is sig-
nificantly smaller than DC
p
measured for both the wild-type
MurA and the K22V variant ()1.9 kJÆmol
)1
ÆK
)1
and
)2.0 kJÆmol
)1
ÆK
)1
, respectively). The unfavorable entropic
contribution is also reduced. As the strength of UDPNAG
binding is not much affected by either mutation, the

thermodynamic profiles indicate that replacement of K22
by valine does not interfere with the conformational change
induced by UDPNAG binding, whereas the additional
replacement of R120 by lysine reduces the probability of
forming the fully closed form of the protein.
The results obtained with the K22V/R120K double
mutant protein point toward a central role of arginine 120
in the conformational process occurring during catalysis.
Therefore, we have generated the R120K single mutant
protein to define its importance in catalysis and the
conformational change. Similarly, the heat capacity change
observed for UDPNAG binding is the same as for the
K22V/R120K double mutant protein, supporting a model
in which R120 plays the crucial role in the open-closed
transformation in MurA.
Discussion
MurA undergoes a pronounced, conformational change
upon ligand binding. The loop region of the upper domain
moves towards the active site of the enzyme, thus shielding
the substrates (and ligands) from bulk solvent. A detailed
thermodynamic study of this process has indicated that the
shift of the equilibrium towards the closed conformation is
induced to a large extent by UDPNAG [13]. Here we have
shown that the thermodynamic characteristics of this
process are identical in the K22V mutant protein, indicating
that the mode and extent of the conformational change is
very similar to wild-type MurA. This finding is in clear
contrast to an earlier hypothesis that K22 plays a key role in
Table 2. Thermodynamic parameters for the binding of UDPNAG to the K22V, R120K and K22V/R120K mutant proteins in comparison to wild-type
MurA. Values at 20 °C were chosen as example. All measurements were performed in 50 mm Hepes, pH 7.4. The calculated values for DH, DG,

TDS and K
d
are from duplicate experiments. DC
p
was calculated from the slope of the regression of DH vs. T. All values except K
d
and DC
p
are in
kJÆmol
)1
. K
d
is in l
M
and DC
p
is in kJÆmol
)1
ÆK
)1
. DG was calculated from DG ¼ RT ln K
d
. The errors are estimated to be ± 1% for DG,±3%
for DH,±9%forDS and 15% for DC
p
. The calculated and experimental DC
p
for wild-type MurA was taken from a previous report [13].
wt MurA K22V MurA R120K MurA K22V/R120K MurA

DH )46.8 )44.0 )45.9 )33.8
DG )25.5 )23.0 )23.0 )22.8
TDS )21.4 )21.0 )22.9 )11.0
K
d
(l
M
) 28.4 80.5 80.0 87.6
DC
p
)1.9 )2.0 )1.4 )1.38
Ó FEBS 2004 Lysine 22 and arginine 120 in MurA (Eur. J. Biochem. 271) 2687
the conformational change, possibly as part of a molecular
switch mechanism [12]. On the other hand, analysis of
tryptic fragments obtained after incubation with fosfomycin
alone and in combination with UDPNAG have provided
further insight into the molecular mechanism driving the
formation of the covalent C115–fosfomycin adduct. A
conservative exchange of K22 to arginine maintains fosfo-
mycin binding, while a charge reversal in the K22E mutant
enzyme completely abolishes the ability to form the covalent
adduct (Table 1).
Inspection of the three-dimensional structure of MurA
complexed with fosfomycin and UDPNAG provides a
rationale for these findings: the side chain amino group of
K22 engages in a salt-bridge interaction with the phospho-
nate group of fosfomycin (Fig. 5). Clearly, the guanidinium
group of arginine can, at least in part, fulfil this function
while the negatively charged glutamate side chain weakens
or even prohibits fosfomycin binding due to charge–charge

repulsions. Most interestingly, the uncharged valine side
chain completely abolishes fosfomycin binding in the
absence of UDPNAG. Clearly, UDPNAG binding creates
additional favorable interactions that promote fosfomycin
binding to the enzyme. As shown in Fig. 5, UDPNAG may
exhibit a direct and/or an indirect effect on the binding
environment of fosfomycin. The direct influence comes
from two hydrogen bonds formed by the nitrogen of the
N-acetyl group and the 3¢-oxygen to the phosphonate and
hydroxyl group of fosfomycin, respectively (Fig. 5). An
indirect effect of UDPNAG may be exerted via a salt-bridge
of its diphosphate group to the distal guanidinium nitrogen
atom of the invariant R120 (Fig. 5). R120 is located in the
flexible loop and hence does not interact with fosfomycin in
the open form of the protein. However, as the closed
conformation of the protein is stabilized by UDPNAG,
R120 is recruited as a binding partner for fosfomycin. Thus
the bidentate character of the H-bonding network involving
R120 appears to be critical for formation of the fosfomycin–
MurA covalent adduct. The critical role of R120 in
generating productive interactions in the active site, is
emphasized by the 2000-fold decrease in catalytic activity
(Table 1) that is greater than the loss of activity found with
all other single mutant proteins characterized so far [12,18].
We envisage the following putative mechanism: K22
provides an essential binding site by positioning and/or
stabilizing the fosfomycin phosphonate group via an
Fig. 4. Temperature dependence of DH (circles, solid lines), DG
(squares, dotted line) and –TDS (triangles, dashed lines) for UDPNAG
binding to the K22VR120K (A), K22V (B) and R120K mutant proteins

(C). Thermodynamic data for wild-type MurA is included for com-
parison and is represented by filled symbols in (A)–(C). Open symbols
are parameters measured for the corresponding mutant. In a typical
experiment 200–420 l
M
protein was titrated with 5 m
M
UDPNAG.
DC
p
was determined from the slope of the regression line describing the
temperature dependence of DH.
Fig. 5. Schematic respresentation of the active site of MurA with
UDPNAG and fosfomycin bound. The dashed lines indicate hydrogen
bond interactions and the numbers give the distances in A
˚
(based on
the structure reported in [11]).
2688 A. M. Thomas et al. (Eur. J. Biochem. 271) Ó FEBS 2004
H-bond. If the N
e
atom of K22 is missing (as in the K22V
mutant), the fosfomycin binding/reaction with C115 occurs
only in the presence of UDPNAG as the substrate promotes
the interaction of R120 and fosfomycin in order to form a
complex optimal for the nucleophilic attack of the thiol
group. This complex greatly resembles the closed confor-
mation. The observed lack of fosfomycin binding and
covalent attachment to the K22V/R120K double mutant
protein supports this scenario. Lysine in position 120 cannot

form simultaneously the H-bonds depicted in Fig. 5. If
fosfomycin is not initially oriented/bound by K22, a lysine
in position 120 possibly makes (if at all) only a single
H-bond to the N-acetyl group of UDPNAG. As the lysine
side chain is somewhat shorter than the arginine side chain,
it is no longer positioned in an optimal way to form
potential H-bonds with fosfomycin. As a consequence, the
required H-bonding partners of fosfomycin are not present
in the K22V/R120K MurA variant and the covalent adduct
is no longer formed. At the same time, formation of the
intricate H-bond pattern involving two H-bond donors for
bidentate interaction (Fig. 5) may be a stringent prerequisite
for the complete closure of the lid.
The thermodynamic profile of UDPNAG binding to the
MurA variants studied here supports this model. UDPNAG
binds with very similar affinities to wild-type MurA and its
K22V, R120K and K22V/R120K variants. The free energy
difference, DDG ¼ DG
mut
– DG
wt
, is only 2–3 kJÆmol
)1
,and
DG
R120K
and DG
K22V
equal DG
K22V/R120K

within error.
Moreover, we have demonstrated that the presence of
fosfomycin is also not critical to UDPNAG binding [13]. It
follows that UDPNAG binds in a preformed pocket and
does not require significant interactions with either K22 or
with fosfomycin, nor with the guanidinium group of R120.
Also, the heat capacity decrement associated with UDP-
NAG binding is not related to interactions involving K22.
However, the heat capacity decrement is dependent on the
presence of a short H-bond with R120, as it is significantly
lower in the K22V/R120K and R120K mutant proteins.
Replacement of R120 by lysine causes a 25% reduction of
DC
p
for both the single R120K and the K22V/R120K
double mutant protein indicating that the lysine plays a
pivotal role in formation of the closed conformation, i.e. the
closure of the lid. This is supported by the decrease in
enthalpy and the reduction of unfavorable entropy in the
double mutant protein that is compatible with a less ordered
structure of the lid making fewer contacts with the body of
the protein. Alternatively, the observed changes in the
thermodynamic parameters for the K22V/R120K and
R120K mutant proteins might be caused by differences in
the thermal/vibrational content of the complex. As the
structure of the binary complex of MurA with bound
UDPNAG is not available, it is not possible to calculate
how much of the heat capacity change is due to hydration
effects. Also, the lack of a binary structure does not allow us
to evaluate the extent to which the conformational change is

impeded by the mutations. However, our results clearly
demonstrate that (a) the interaction between UDPNAG
and R120 is the critical driving force triggering the
conformational transition from the open to the closed state,
and (b) the lid closes completely only if all interactions
between properly positioned UDPNAG, fosfomycin, K22
and R120 take place.
The structurally and functionally related enzyme
5-enolpyruvylshikimate 3-phosphate synthase has an invari-
ant arginine residue in a corresponding position (R124). The
three-dimensional structure of this enzyme in complex with
the reversible inhibitor glyphosate also demonstrates that
R124 forms a salt-bridge to the phosphonate group of
glyphosate [20]. In contrast to MurA, however, 5-enolpyr-
uvylshikimate 3-phosphate synthase lacks the flexible loop
including the cysteine residue and, moreover, the enolpyr-
uvyl-accepting substrate, shikimate-3-phosphate, does not
interact with R124 in the ternary complex [20]. Hence, the
mechanism of binding of fosfomycin by reinforcement of an
initial binding site (mainly K22 and R397) through recruit-
ment of secondary binding partners located in a flexible
loop (R120) cannot be envisaged for 5-enolpyruvylshiki-
mate 3-phosphate synthase. Despite phylogenetic, structural
and mechanistic similarities between 5-enolpyruvylshiki-
mate 3-phosphate synthase and MurA, it appears that these
two enzymes have developed different strategies to bind the
substrate and to shield the active site against bulk solvent
during the catalytic process.
As UDPNAG binding to the K22V mutant protein
overcomes the constraints on fosfomycin adduct formation,

then why is this mutant protein catalytically inactive [12]?
Although phosphoenolpyruvate was shown to be capable of
reacting with the thiol group of C115 in a fashion similar
to fosfomycin [19,21], this adduct appears to be an off-
pathway species that releases phosphoenolpyruvate in the
active site of MurA, which then reacts with the 3¢-hydroxyl
group of bound UDPNAG to form a O-phosphothioketal
[22,23]. This species then eliminates phosphate to yield the
product UDP-N-acetylenolpyruvylglucosamine. The stereo-
chemical course of the reaction (anti-addition, syn-elimin-
ation [10]) also dictates that the reacting molecules are
properly positioned by neighboring amino acid residues.
Hence, productive catalysis is subject to various chemical
and steric constraints in contrast to the comparably simple
adduct formation with fosfomycin. It follows that the role
of K22 in catalysis is to provide a binding partner for the
phosphate group of phosphoenolpyruvate as well as to
achieve proper alignment of the reactants during the critical
addition–elimination steps.
Acknowledgements
This work was supported by the ETH through an internal research
grant to P. M. and N. A. (0-20-515-98). We would also like to thank
A. K. Samland for many stimulating discussions and for providing the
K22V, K22E and K22R mutant plasmids. We are also grateful to
T. Etezady-Esfarjani for his help in preparing Fig. 1.
References
1. El Zoeiby, A., Sanschagrin, F. & Levesque, R.C. (2003) Structure
and function of the Mur enzymes: development of novel
inhibitors. Mol. Microbiol. 47, 1–12.
2. Bugg, T.D.H. & Walsh, C.T. (1992) Intracellular steps of bacterial

cell wall peptidoglycan biosynthesis: Enzymology, antibiotics, and
antibiotic resistance. Natural Product Reports. 9, 199–215.
3. Hendlin, D., Stapley, E.O., Jackson, M., Wallick, H., Miller,
A.K., Wolf, F.J., Miller, T.W., Chaiet, L., Kahan, F.M., Foltz,
E.L., Woodruff, H.B., Mata, J.M., Hernandez, S. & Mochales, S.
Ó FEBS 2004 Lysine 22 and arginine 120 in MurA (Eur. J. Biochem. 271) 2689
(1969) Phosphonomycin, a new antibiotic produced by strains of
streptomyces. Science 166, 122–123.
4. Katayama, N., Tsubotani, S., Nozaki, Y., Harada, S. & Ono, H.
(1990) Fosfadecin and fosfocytocin, new nucleotide antibiotics
produced by bacteria. J. Antibiotics. 43, 238–246.
5. Shoji,J.,Kato,T.,Hinoo,H.,Hattori,T.,Hirooka,K.,Matsu-
moto, K., Tanimoto, T. & Kondo, E. (1986) Production
of fosfomycin (phosphonomycin) by Pseudomonas syringae.
J. Antibiotics. 39, 1011–1012.
6. Kahan, F.M., Kahan, J.S., Cassidy, P.J. & Kropp, H. (1974) The
mechanism of action of fosfomycin (phosphonomycin). Ann. NY
Acad. Sci. 235, 364–385.
7. Marquardt, J.L., Brown, E.D., Lane, W.S., Haley, T.M., Ich-
ikawa, Y., Wong, C H. & Walsh, C.T. (1994) Kinetics, stoichio-
metry, and identification of the reactive thiolate in the inactivation
of UDP-GlcNAc enolpyruvoyl transferase by the antibiotic
fosfomycin. Biochemistry 33, 10646–10651.
8. Krekel, F., Samland, A.K., Macheroux, P., Amrhein, N. & Evans,
J.N.S. (2000) Determination of the pK
a
value of C115 in
MurA (UDP-N-acetylglucosamine enolpyruvyltransferase) from
Enterobacter cloacae. Biochemistry 39, 12671–12677.
9. Scho

¨
nbrunn, E., Sack, S., Eschenburg, S., Perrakis, A., Krekel, F.,
Amrhein, N. & Mandelkow, E. (1996) Crystal structure of UDP-
N-acetylglucosamine enolpyruvyltransferase, the target of the
antibiotic fosfomycin. Structure 4, 1065–1075.
10. Skarzynski, T., Kim, D.H., Lees, W.J., Walsh, C.T. & Duncan, K.
(1998) Stereochemical course of enzymatic enolpyruvyl transfer
and catalytic conformation of the active site revealed by the crystal
structure of the fluorinated analogue of the reaction tetrahedral
intermediate bound to the active site of the C115A mutant of
MurA. Biochemistry. 37, 2572–2577.
11. Skarzynski, T., Mistry, A., Wonacott, A., Hutchinson, S.E., Kelly,
V.A. & Duncan, K. (1996) Structure of UDP-N-acetylgluco-
samine enolpyruvyl transferase, an enzyme essential for the
synthesis of bacterial peptidoglycan, complexed with substrate
UDP-N-acetylgucosamine and the drug fosfomycin. Structure 4,
1465–1474.
12. Samland, A.K., Amrhein, N. & Macheroux, P. (1999) Lysine 22 in
UDP-N-acetylglucosamine enolpyruvyl transferase from
Enterobacter cloacae is crucial for enzymatic activity and the
formation of covalent adducts with the substrate phosphoenol-
pyruvate and the antibiotic fosfomycin. Biochemistry 38,
13162–13169.
13. Samland, A.K., Jelesarov, I., Kuhn, R., Amrhein, N. & Macher-
oux, P. (2001) Thermodynamic characterization of ligand-
induced conformational changes in UDP-N-acetylglucosamine
enolpyruvyl transferase. Biochemistry 40, 9950–9956.
14. Scho
¨
nbrunn, E., Svergun, D.I., Amrhein, N. & Koch, M.H.J.

(1998) Studies on the conformational changes in the bacter-
ialcellwallbiosyntheticenzymeUDP-N-acetylglucosamine
enolpyruvyltransferase (MurA). Eur. J. Biochem. 253, 406–412.
15. Krekel, F., Oecking, C., Amrhein, N. & Macheroux, P. (1999)
Substrate and inhibitor-induced conformational changes in the
structurally related enzymes UDP-N-acetylglucosamine
enolpyruvyl transferase (MurA) and 5-enolpyruvylshikimate
3-phosphate synthase (EPSPS). Biochemistry 38, 8864–8878.
16. Spolar, R.S. & Record, M.T. Jr (1994) Coupling of local folding
to site-specific binding of proteins to DNA. Science 263, 777–
784.
17. Baker, B.M. & Murphy, K.P. (1998) Prediction of binding
energetics from structure using empirical parameterization.
Methods Enzymol. 295, 294–315.
18. Samland, A.K., Etezady-Esfarjani, T., Amrhein, N. & Macher-
oux, P. (2001) Asparagine 23 and aspartate 305 are essential
residues in the active site of UDP-N-acetylglucosamine
enolpyruvyl transferase from Enterobacter cloacae. Biochemistry
40, 1550–1559.
19. Wanke, C. & Amrhein, N. (1993) Evidence that the reaction of the
UDP-N-acetylglucosamine 1-carboxyvinyltransferase proceeds
through the O-phosphothioketal of pyruvic acid bound to Cys115
of the enzyme. Eur. J. Biochem. 218, 861–870.
20. Scho
¨
nbrunn, E., Eschenburg, S., Shuttleworth, W.A., Schloss,
J.V., Amrhein, N., Evans, J.N.S. & Kabsch, W. (2001) Interaction
of the herbicide glyphosate with its target enzyme 5-en-
olpyruvylshikimate 3-phosphate synthase in atomic detail. Proc.
NatlAcad.Sci.USA98, 1376–1380.

21. Brown, E.D., Marquardt, J.L., Lee, J.P., Walsh, C.T. &
Anderson, K.S. (1994) Detection and characterization of a
phospholactoyl-enzyme adduct in the reaction catalyzed by UDP-
N-acetylglucosamine enolpyruvoyl transferase, MurZ. Biochem-
istry. 33, 10638–10645.
22. Marquardt, J.L., Brown, E.D., Walsh, C.T. & Anderson,
K.S. (1993) Isolation and structural elucidation of a tetrahedral
intermediate in the UDP-N-acetylglucosamine enolpyruvoyl
transferase enzymatic pathway. J. Am. Chem. Soc. 115, 10398–
10399.
23. Ramilo,C.,Appleyard,R.J.,Wanke,C.,Krekel,F.,Amrhein,N.
& Evans, J.N.S. (1994) Detection of the covalent intermediate of
UDP-N-acetylglucosamine enolpyruvyl transferase by solution-
state and time-resolved solid-state NMR spectroscopy. Biochem-
istry 33, 15071–15079.
24. Koradi, R., Billeter, M. & Wu
¨
thrich, K. (1996) MOLMOL: a
program for display and analysis of macromolecular structures.
J. Mol. Graph. 14, 29–32.
2690 A. M. Thomas et al. (Eur. J. Biochem. 271) Ó FEBS 2004