Báo cáo khoa học: Phytoene synthase genes in tomato (Solanum lycopersicum L.) – new data on the structures, the deduced amino acid sequences and the expression patterns doc

Phytoene synthase genes in tomato (Solanum
lycopersicum L.) – new data on the structures, the deduced
amino acid sequences and the expression patterns
Giovanni Giorio, Adriana Lucia Stigliani and Caterina D’Ambrosio
Metapontum Agrobios, Metaponto, Italy
Fruits are the mechanism by which angiosperms dis-
perse seeds and are the result of a tight co-evolution
between plants and their seed dispersers [1]. Tomato
(Solanum lycopersicum L.) belongs to the Solanaceae
(Nightshade) family, which contains many differenti-
ated taxa occurring worldwide. Its fruit type is the
berry: red, fleshy and with a pulpy interior rich in
seeds [2]. Among the 12 wild relatives of tomato, there
is only one (Solanum pimpinellifolium B. Juss.) with a
red berry and two with yellow, yellow–green or orange
fruits [Solanum cheesmaniae (L. Riley) Fosberg; Sola-
num galapagense S.C. Darwin and Peralta], whereas all
Keywords
carotenoid metabolism; chloroplast;
chromoplast; fruit colour; phytoene synthase
Correspondence
G. Giorio, Metapontum Agrobios, SS Jonica
Km 448.2, Metaponto, MT 75010, Italy
Fax: +39 0835 740204
Tel: +39 0835 740276
E-mail:
All authors contributed equally to this work
(Received 22 October 2007, revised 27
November 2007, accepted 3 December
2007)
doi:10.1111/j.1742-4658.2007.06219.x

The fruit of tomato (Solanum lycopersicum L.) is a berry: red, fleshy and
rich in seeds. Its colour is due to the high content of lycopene whose syn-
thesis is activated by the phytoene synthase 1 (PSY1) enzyme, encoded by
Psy1 which is distinct from Psy2. In the present study, we report on the
genomic structures of the Psy1 and Psy2 genes and on their transcription
patterns in different tomato tissues. Our results have completely clarified
the structure of the Psy1 and Psy2 genes in the coding sequence region.
The two genes were shown to have an highly conserved structure, with
seven exons being almost identical and six introns being much more vari-
able. For Psy1 and Psy2, respectively, the sequenced regions were 4527 and
3542 bp long, the coding sequences were 1239 bp and 1317 bp long,
whereas the predicted protein sequences were 412 and 438 amino acids.
The two proteins are almost identical in the central region, whereas most
differences are present in the N-terminus and C-terminus. Quantitative real
time PCR analysis showed that Psy2 transcript was present in all tested
plant tissues, whereas Psy1 transcript could be detected in chromoplast-
containing tissues, particularly in fruit where it activates and boosts lyco-
pene accumulation. Interestingly, the organ with the highest relative content
of Psy2 transcript is the petal and not the leaf. Psy1 is a Psy2 paralog
derived through a gene duplication event that have involved other genes
encoding rate controlling enzymes of the carotenoid pathway. Duplicate
genes have been recruited to allow carotenoid synthesis in petals and fruits.
However, recruitment of carotenoid metabolism for fruit pigmentation
could have occurred later in the evolution, either because phytoene syn-
thase gene duplication occurred later or because the fruit pigmentation pro-
cess required a more sophisticated mechanism involving tight control of
the transcription of other genes.
Abbreviations
cTP, chloroplastic transit peptide; PSY, phytoene synthase; qRT-PCR, quantitative RT-PCR.
FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS 527

the other species have green, yellow–green, dark green
or black fruits [3,4].
During the development of tomato fruit, the shift
from green to red colour is due to the degradation of
chlorophylls and the accumulation of the carotenoid
lycopene.
Carotenoid pathways in plants have been described
in great detail using genetic, biochemical and mole-
cular data, mainly from Arabidopsis [5,6].
The first step in the synthesis of lycopene is the
condensation of two molecules of geranylgeranyl
diphosphate to form the 15-cis-isomer of phytoene.
This two-step reaction is catalysed by the enzyme
phytoene synthase (PSY). Following four desaturations
and probably two [7] isomerization steps, the 15-cis
phytoene is converted to all-trans lycopene by phyto-
ene desaturase, f-carotene desaturase and carotene
isomerases. At this point, the pathway is branched
because the lycopene can be converted to lutein, which
appears to be the end-product of the first branch, or
to zeaxanthin, which can be further converted to
violaxanthin. In plants, carotenoids are mainly
involved in photosynthesis as accessory pigments, in
photoprotection (quenching and xanthophylls cycle)
and in the formation of abscisic acid. Moreover, many
species use them to make coloured flowers and fruits
to attract pollinators and seed dispersers. In tomato,
for example, the flower has a bright yellow–orange
corolla resulting from the combined effect of chromo-
phores of neoxanthin, violaxanthin and lutein [8],

whereas its fruit, owing to the high content of
lycopene, is of a deep red colour at the end of the
developmental process. However, in tomato, two active
forms of PSY have been described, PSY1 and PSY2,
each encoded by its own gene, Psy1 and Psy2.
Although the first report on the cDNA sequence of
Psy1 gene (pTOM5) in tomato (X60440) can be traced
back to Ray et al. [9], the last annotation of the
derived protein (P08196) still reports the presence of
conflicting data. Moreover, the Psy2 cDNA sequence
available in the NCBI database (L23424) is incomplete
because it is devoid of the 5¢-region coding for the pro-
tein amino-terminus. The correct DNA and proteic
sequences of PSY1 were first reported by Bartley et al.
[10], who demonstrated the correctness of the hypothe-
sis of Armstrong et al. [11], which proposed that
pTOM5 may encode the tomato homolog of the
bifunctional red pepper PSY [12]. As for the Psy2
gene, the first report on the DNA sequence was pro-
vided by Bartley and Scolnik [13]. These authors dem-
onstrated that the genomic clone F (X60440), which
was considered to be a PSY1 pseudogene by Ray et al.
[14], was indeed the DNA sequence of the paralogous
PSY1 gene coding for a PSY enzyme active in photo-
synthetic tissues.
In the present study, we report on the genomic
structures of Psy1 and Psy2 genes and the transcrip-
tion patterns of both genes in different tomato tissues.
The role of carotenoids as secondary metabolites in
the pigmentation of tomato flowers and fruits has been

also reanalysed in the light of these results.
Results
Isolation of tomato Psy1 and Psy2 genes
Using the sequences M8474 and L23424 reported in the
NCBI database corresponding, respectively, to tomato
Psy1 and Psy2 mRNAs, an extended database search-
ing using blast program was conducted aiming to
reconstruct the entire coding sequences of the two
genes.
The need for a reconstruction was based on the lack
of information regarding the 5¢-region in the Psy2
DNA sequence and from the conflicting evidence avail-
able in the database records of the PSY1 gene. Using
the reconstructed sequences, a set of primers was
designed and used to amplify the cDNAs derived from
fruit or leaf RNAs of tomato cultivar Red Setter
(Table 1). The Psy1 and Psy2 cDNAs were cloned in
suitable vectors, sequenced and deposited in the NCBI
database as EF534739 and EF534738. Combining
these two mRNA sequences with those of GTOM5
(X60441) and clone F (X60440), two sets of primers
were designed to amplify genomic DNA fragments
corresponding to the introns of the two genes. The
fragments were sequenced and enabled the complete
reconstruction of the Psy1 and Psy2 genes with the
annotation of introns and exons. The GenBank acces-
sion numbers of the two genes are EF534740 (Psy1)
and EU021055 (Psy2). However, the UTR regions for
both genes were only partially reconstructed.
The comparison of the two genes (Fig. 1 and

Table 2) showed a strong conservation of the gene
structure. The sequenced regions of the two genes were
4527 and 3542 bp long, respectively, for Psy1 and
Psy2. The two genes contain at least seven exons and
six introns. The data are not conclusive because the
UTR regions were only partially sequenced. The cod-
ing sequences were 1239 bp for Psy1 and 1317 bp for
Psy2, with the latter being longer in the 5¢-region. The
start codon is located in the second exon in both
genes. Intron and exon numeration was changed com-
pared to the original annotation of the Psy1 gene
based on the GTOM5 sequence (X60441) because we
discovered an additional intron upstream of the start
Tomato colours – why the flower is yellow and the fruit is red? G. Giorio et al.
528 FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS
of the GTOM5 clone. Length of the first intron is
942 bp in Psy1 and 153 bp in Psy2. Corresponding
exons in the central part of the two genes (i.e. exons
3, 4, 5 and 6) have the same length. Exons 2 and 7
have different length between the two genes because
they code for the regions in which the two proteins
are different. Exon 1 shows the greatest difference
because it was only partially sequenced in both genes
and, therefore, the start of characterization was dif-
ferent in the two genes. As expected, a comparison of
intron lengths between the two genes revealed great
variability.
Table 1. Oligonucleotide primer and probe sequences used for cloning and for transcript quantitation using qRT-PCR analysis of Psy1 and
Psy2 genes.
Gene Primer or probe name Primer nucleotide sequences (5¢-to3¢)

GenBank accession
number
Amplicon
(bp) Use
18SrRNA Le18SrRNA-F-118 GAAACGGCTACCACATCCAAG BH012957 61 RT-PCR
Le18SrRNA-R-179 CCCCGTGTTAGGATTGGGT
TaqMan-Le18s-140 AAGGCAGCAGGCGCGCAAA
Psy1 Psy1F312 TGACGTCTCAAATGGGACAAGT EF534739 69 RT-PCR
Psy1R381 CCTCGATGAATCAAAAAAACGG
TaqManPsy1 TCATGGAATCAGTCCGGGAGGGAA
Psy2 Psy2F952 AGGCAAGGCTGGAAGATATTTTT EF534738 72 RT-PCR
Psy2R1024 GAAACAGTGTCGGATAAAGCTGC
TaqManPsy2 ACGGGCGGCCATTTGATATGCTTG
Psy1 PSY1For21 GGCCATTGTTGAAAGAGAGG EF534739 1522 Cloning
PSY1Rev1522 TCATGCTTTATCTTTGAAGAGAGG
Psy2 PSY2For27 TCTCTACGTGTATCAAAGGTAGTAAGG EF534738 1674 Cloning
PSY2Rev1674 TGGCATTTAGAAACTTCATTCA
Fig. 1. Comparison of the structures of the Psy1 and Psy2 genes.
Table 2. Structure of tomato Psy1 and Psy2 genes.
Gene
DNA (nt)
a
mRNA (nt)
a
Protein
Exon Intron
Length 5¢-UTR CDS 3¢-UTR Length
Integral cTP
b
Mature

1234567123456
Amino
acids kDa
Amino
acids kDa
Psy1 32 656 51 173 236 193 181 942 120 423 313 518 689 4527 276 1239 7 1522 412 45.32 62 38.50
Psy2 112 710 51 173 236 193 199 153 107 710 273 227 398 3542 338 1317 19 1674 438 48.18 86 38.72
a
Exons 1 and 7 were only partially sequenced as well as the 5¢- and 3¢-UTRs.
b
Predicted by the TARGETP.
G. Giorio et al. Tomato colours – why the flower is yellow and the fruit is red?
FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS 529
The predicted protein sequences were 412 and 438
amino acids for PSY1 and PSY2, respectively. Align-
ment of the two protein sequences (Fig. 2) showed
78% residue identity (341 ⁄ 438). The central part of
two proteins are similar, whereas the major differences
are present in the N-terminus. In particular, both
protein sequences start with the sequence
MSVALLWVVSP and the PSY2 protein has two
sequences of four and 19 residues that are not present
in the PSY1 sequence. Moreover, the last four resi-
dues, SLQR, at C-terminus of PSY1 are replaced by
the sequence SPLAKT in PSY2. targetp and predo-
tar software were used to predict the presence of
putative N-terminal targeting sequences [15,16]. Both
proteins were predicted by predotar to have a plastid
target signal. Conversely, targetp predicted a chloro-
plastic transit peptide (cTP) of 62 amino acids only for

the PSY1 protein. In this case, a mature PSY1 in the
plastids would have a predicted size of 38.5 kDa,
which is agreement with previous experimental evi-
dence [17]. targetp failed to predict a subcellular
localization for PSY2 when the entire sequence was
submitted. However, when the query sequence con-
tained residues 1 to 91–95 of PSY2 protein, the soft-
ware always detected a chloroplastic transit peptide of
86 amino acids. This may be due to the presence of
specific motifs beyond the first 95 residues that inter-
fere with the prediction.
Transcription analysis in tomato tissues
Psy1 and Psy2 transcript contents were estimated in
RNA samples derived from root, leaf, petal, anther,
ovary and fruit at three developmental stages (Mature
Green, Pink and Ripe) using quantitative RT-PCR
(qRT-PCR) with gene-specific fluorescent probes
(Fig. 3).
Since the estimates of Psy1 and Psy2 relative tran-
script contents were normalized onto the 18S rRNA
(endogenous reference) transcript contents and com-
pared to normalised petal transcript content (calibra-
tor), it is possible for each gene to make an easy
comparison of the relative transcript contents among
the nine tissues (Figs 4 and 5). Psy1 transcript was
absent in root RNA, whereas it could be detected in
leaf, sepal, ovary and in the fruit at mature green
stage. However, in these tissues, Psy1 transcript con-
tent ranged between 2% and 3% of the content in the
petal. This organ appeared to contain a considerable

amount of Psy1 transcript. As expected, Psy1 tran-
script showed a typical increase between the Mature
Green and Pink and a reduction between the Pink and
Ripe stages.
The Psy2 transcription pattern was quite unpredict-
able in that the organ with the highest content was
shown to be the petal instead of the leaf where the
PSY2 enzyme has a pivotal role in the assembly of
photosynthetic apparatus. Very similar amounts of this
transcript were detected in leaf, sepal and ovary
RNAs. Fruit RNAs contained Psy2 transcript at a
level allowing easy detection, although it was very low
compared to the content in petal RNA. By contrast to
Psy1, the Pys2 transcript was detectable in root RNA.
Estimates of the relative contents of the two tran-
scripts for each tissue were derived with the compara-
tive Ct methods. The differences between the estimates
Fig. 2. Sequence alignment of PSY1 and PSY2 protein derived from analysis with CLUSTAL W program (EMBL).
Tomato colours – why the flower is yellow and the fruit is red? G. Giorio et al.
530 FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS
A
B
C
D
MG P R
Fig. 3. Organs of tomato assayed for Psy1
and Psy2 transcript content. (A) Roots. (B)
Expanding leaf. (C) Flower organs: calyx
(sepals), corolla (petals), stamen cone (sta-
mens) and pistil (ovary, style and stigma).

(D) Fruit developmental stages: MG, Mature
Green; P, Pink; R, Ripe.
Fig. 4. Transcription analysis of tomato Psy1 gene carried out using
qRT-PCR with gene-specific fluorescent probes on transcripts from
nine different tissues. At least two RNA samples were assayed for
each tissue. Three replicated reactions were performed for each
sample, both in the construction of standard curve and in the quanti-
tation of samples. The estimates are expressed as the mean ± SD.
Fig. 5. Transcription analysis of tomato Psy2 gene carried out using
qRT-PCR with gene-specific fluorescent probes on transcripts from
nine different tissues. For details, see Fig. 4.
G. Giorio et al. Tomato colours – why the flower is yellow and the fruit is red?
FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS 531
of the threshold cycle means of the two genes for each
tissue were used as the exponent in the formula 2
(DCt)
.
Accordingly, and assuming that the efficiency of the
amplification of the two genes was equal, it is possible
to obtain an estimate for each tissue of the transcript
content of Psy1 relative to Psy2 (Fig. 6). In green tis-
sues (i.e. in leaf, sepal and ovary), the content of Psy1
transcript was 0.4-fold lower than that of Psy2 tran-
script. Conversely, in pigmented tissues, such as petal,
anther and fruit at Pink and Ripe stages, the content
of Psy1 was shown to be much greater than that of
Psy2 transcript. The estimates ranged between 5.2-fold
greater in the petal to 213.3-fold greater in the fruit at
the Pink stage.
Discussion

In the present study, we report on the molecular char-
acterization of the tomato Psy1 and Psy2 genes and
also provide the deduced complete amino acid
sequences of the two enzymes, together with new
insights into the transcriptional regulation of Psy1 and
Psy2 in chloroplast- and chromoplast-containing tis-
sues of tomato.
The results obtained have completely clarified the
structure of the Psy1 and Psy2 genes in the coding
sequence region. The two genes were shown to have a
highly conserved structure, with seven exons being
almost identical and six introns being much more vari-
able in sequence and length. The two deduced protein
sequences showed high similarity in the central part
(86% residue identity) beyond the putative transit pep-
tide cleavage site. The two putative cTPs, as predicted
by targetp, showed a greater diversity, with the PSY1
having two putative deletions of 4 and 19 residues.
Interestingly, the two proteins start with the sequence
MSVALLWVVSP, which is the longest stretch of iden-
tical residues in the N-terminus. A blast search
(blastp algorithm) of the NCBI protein database using
this sequence as a query resulted in the retrieval of all
PSY protein sequences belonging to dicotyledons.
Moreover, a search performed with the motif
MSXXXXWVVXP was also able to retrieve all these
proteins.
With respect to chloroplastic transit peptide func-
tion, the localization of PSY1 and PSY2 into the
sub-compartments of plastids has not yet been com-

pletely clarified, although extensive studies have been
carried out in tomato [13,18,19] and in Narcissus
[20–22]. The results obtained in tomato were not
conclusive, probably because of a confounding effect
due to the two different forms of PSY. However, as
noted by Gallagher et al. [23] in grass PSYs, differ-
ences in the N-terminus as well as the C-terminus of
the two proteins may result in differences in their
plastid localization.
Transcription analysis of the two genes using qRT-
PCR clearly showed that, with the exception of Psy1
in the roots, transcripts of both genes are detectable in
all tested tomato tissues. Unexpectedly, the organ with
the highest relative content of Psy2 transcript is the
petal and not the leaf. Psy2 transcript content in the
leaf is only approximately 25% of that in the petal.
This result could not be anticipated because Psy2 was
thought to be the chloroplast-specific PSY and no pre-
vious report had addressed gene expression in this
organ using a method as sufficiently sensitive as quan-
titative real time PCR. The high content of Psy2 tran-
script in tomato petals could also explain why the
flowers of yellow flesh mutants, r and r
y
, are pale or
normal, respectively, whereas, in the lines in which the
Psy1-derived transgene triggered a cosuppression of
PSY genes, the flowers were almost white [24].
In the fruit, Psy2 transcript is detectable at all tested
stages and appears to increase during ripening. Finally,

PSY2 must have some specific activities in the roots
because Psy2 transcript is present in this tissue in con-
trast to Psy1 transcript which is undetectable.
Psy1 transcription analysis results were in accor-
dance with those obtained in previous investigations
[25,26]. Psy1 transcript is almost undetectable in the
fruit from the onset of maturation until the Mature
Green stage. From the Breaker stage onward, the tran-
script level increases dramatically reaching its maxi-
mum at the Pink stage and decreasing slowing with
the progression of fruit ripening. Its content in the
fruit at Pink stage is almost three-fold greater than
Fig. 6. Transcript content of Psy1 relative to Psy2 across all
tissues.
Tomato colours – why the flower is yellow and the fruit is red? G. Giorio et al.
532 FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS
that in the petals. Nevertheless, Psy1 transcript content
in this organ was estimated to be 5.2-fold greater than
that of Psy2 which has its greatest expression in the
petal.
Taken together, these results confirm the specialized
role of PSY1 in the colouring of fruit and that of
PSY2 in the synthesis of carotenoids involved in pho-
tosynthesis, in photoprotection (quenching and xan-
thophylls cycle) and in the formation of abscisic acid.
Both genes appear, however, to be involved in the
flower colour process because their transcript contents
in the petal were very high, particularly Psy2 tran-
script.
Psy1 is a Psy2 paralog derived through a gene dupli-

cation event. After duplication, the two genes have
been maintained in the genome owing to subfunction-
alization, which, in this case, is in the form of a
division of gene expression [27]. The recruitment of
primary carotenoid metabolism as secondary metabo-
lism has been described in maize [23] as well as in
tomato for flower and fruit pigmentation [8]. However,
in tomato, it has been hypothesised that recruitment
required duplication of all genes encoding the rate-
controlling enzymes of the pathway, namely carotene
beta-hydroxylase, lycopene cyclase and PSY, and that
the duplicated pathway was exploited originally for
flower pigmentation and only later for fruit pigmenta-
tion [8]. The latter hypothesis serves to explain why all
13 tomato species have yellow coloured flowers,
whereas only three have red, yellow, yellow green or
orange coloured fruits [4]. However, it is not known
whether the recruitment of the metabolism for fruit
pigmentation has occurred on a second occasion
because the PSY gene ancestor duplicated later or
because the subfunctionalization of the two paralogs
was more complex, thus requiring more time.
By comparing the protein sequences of the PSY par-
alogs and that of carotene beta-hydroxylase paralogs
(CrtR-b1, CAB55625; CrtR-b2, ABI23730), it is found
that a reduced similarity (73.7% residue identity and
82.6% similarity) is seen for CRTR-Bs compared to
PSYs (77.8% residue identity and 85.3% similarity)
that could indicate an early duplication of the CrtR-b
gene ancestor. However, the recruitment of PSY1 for

fruit carotenoid metabolism has likely required a more
sophisticated mechanism involving the tight and timely
control of Psy1, Lcy-b and Lcy-e transcription during
fruit development. Accumulation of lycopene in
tomato fruit, and therefore the colour shift from green
to red, starts at the Mature Green stage when the
seeds have completed their development and are able
to give rise to new plants. This mechanism can be con-
sidered as a sort of light switch because the tomato
fruit is switched on at the appropriate time to appear
like a red light in the green background of the plant
canopy, thus alerting the seed dispersers.
Experimental procedures
Plant materials and nucleic acid extraction
Tomato plants (cv. Red Setter) were grown in a green-
house. Total genomic DNA and total RNA were extracted
by leaf and fruit tissue samples using standard protocols.
Complementary DNA was synthesized from 1.5 lgof
RNA using the ThermoScriptÔ RT-PCR System kit (Invi-
trogen, Carlsbad, CA, USA) with random hexamer primers
following the manufacturer’s instructions.
Primer design, amplification of genomic DNA and
cDNA and sequencing
Using the reconstructed sequences of Psy1 and Psy2
cDNAs, a set of primers were designed and used to amplify
the cDNAs synthesized from fruit or leaf RNAs of the
tomato cultivar Red Setter.
Amplification was performed with the kit PhusionÔ
High-Fidelity DNA Polymerase (Finnzymes Oy, Espoo,
Finland) in a PTC-200 thermal cycler (MJ Research, Bio-

Rad Laboratories Inc., Hercules, CA, USA) in 20 lL reac-
tion volume. After checking the specificity of the reactions
by agarose gel electrophoresis analysis, an aliquot of the
reaction was used to produce recombinant vectors with
pCRÒ-BLUNT II-TOPOÒ (Invitrogen), which were trans-
formed into competent Escherichia coli cells. Plasmid DNA
harbouring the two genes were isolated from recombinant
cells and used for sequence analysis.
Sequencing reactions were performed with the ABI
PRISMÒ BigDyeÒ Terminator v3.1 Cycle Sequencing kit
and analysed with the Applied Biosystems 3130 Genetic
Analyzer (Applied Biosystems, Foster City, CA, USA).
Using specific software, the Psy1 and Psy2 partial mRNA
sequences were assembled.
Combining these two mRNA sequences with those of
GTOM5 (X60441) and clone F (X60440), two sets of prim-
ers were designed to amplify genomic DNA fragments cor-
responding to the introns of the two genes. After PCR, the
amplified fragments were gel purified and sequenced using
the protocols reported above.
Quantitative analysis of Psy1 and Psy2 transcript
contents (qRT-PCR)
Transcription analysis of tomato Psy1 and Psy2 genes was
carried out using qRT-PCR with gene-specific fluorescent
probes. Transcript contents were estimated in RNA sam-
ples derived from root, leaf, petal, anther, ovary and fruit
G. Giorio et al. Tomato colours – why the flower is yellow and the fruit is red?
FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS 533
at three developmental stages (Mature Green, Pink and
Ripe).

Reactions were conducted in 96-well reaction plates in a
25 lL volume containing 12.5 lL of the PlatinumÒ Quanti-
tative PCR SuperMix-UDG (Invitrogen), 300 nm forward
primer, 300 nm reverse primer and 150 nm TaqMan probe.
One microlitre of the cDNA sample (75 ng of RNA) was
used for each reaction. qRT-PCR was performed using the
iCycler iQÔ Real Time PCR Detection System (Bio-Rad
Laboratories Inc.). Thermal cycling condition were 95 °C
for 3 min for activation of DNA polymerase, and 40 cycles
of 95 °C for 15 s and 60 °C for 1 min. Estimates of tran-
script content were derived using the standard curve
method [28] performing reactions in separate tubes. Stan-
dard curves were prepared for both the target transcripts,
Psy1 and Psy2, and the endogenous reference 18S rRNA
gene using a petal cDNA stock sample, by assembling a set
of reactions using three-fold serial dilutions with six points
for 18S rRNA and eight points for both Psy1 and Psy2.
Each PCR reaction was performed in triplicate, both for
the construction of the standard curves and for sample
quantitations. Gene starting quantities for each sample
were estimated using regression parameter estimates of the
standard curve. Estimates of Psy1 and Psy2 relative tran-
script contents were normalized onto the endogenous refer-
ence transcript (18S rRNA) to account for differences in
the amount of total RNA content among samples and com-
pared with the normalised transcript content of petal, which
was chosen as calibrator. Sequences of primers and Taq-
ManÒ probes were the same as those previously used [25]
and are reported in Table 1.
Acknowledgements

We wish to thank all colleagues of Metapontum Ag-
robios who collaborated in the project. We are grateful
to Professor Peter Beyer (Freiburg, Germany) for valu-
able comments and helpful suggestions and Professor
Gerhard Sandmann (Frankfurt, Germany) for critical
reading of the manuscript.
References
1 Knapp S (2002) Tobacco to tomatoes: a phylogenetic
perspective on fruit diversity in the Solanaceae. J Exp
Bot 53, 2001–2022.
2 Knapp S, Bohs L, Nee M & Spooner DM (2004) Solan-
aceae – a model for linking genomics with biodiversity.
Comp Funct Genomics 5, 285–291.
3 Peralta IE, Knapp S & Spooner DM (2006) Nomencla-
ture for wild and cultivated tomatoes. Rep Tomato
Genet Coop 56, 6–12.
4 Peralta IE & Spooner DM (2007) History, origin and
early cultivation of tomato (Solanaceae). In Genetic
Improvement of Solanaceous Crops, Vol. 2: Tomato
(Razdan MK & Mattoo AK, eds), pp. 1–27. Science
Publishers, Enfield, CT.
5 DellaPenna D & Pogson BJ (2006) Vitamin synthesis in
plants: tocopherols and carotenoids. Annu Rev Plant
Biol 57, 711–738.
6 Sandmann G, Ro
¨
mer S & Fraser PD (2006) Under-
standing carotenoid metabolism as a necessity for
genetic engineering of crop plants. Metab Eng 8,
291–302.

7 Li F, Murillo C & Wurtzel ET (2007) Maize Y9
encodes a product essential for 15-cis-f-carotene isomer-
ization. Plant Physiol 144, 1181–1189.
8 Galpaz N, Ronen G, Khalfa Z, Zamir D & Hirschberg
J (2006) A chromoplast-specific carotenoid biosynthesis
pathway is revealed by cloning of the tomato white-
flower locus. Plant Cell 18, 1947–1960.
9 Ray J, Bird C, Maunders M, Grierson D & Schuch W
(1987) Sequence of pTOM5, a ripening related cDNA
from tomato. Nucleic Acids Res 15, 10587.
10 Bartley GE, Viitanen PV, Bacot KO & Scolnik PA
(1992) A tomato gene expressed during fruit ripening
encodes an enzyme of the carotenoid biosynthesis path-
way. J Biol Chem 267, 5036–5039.
11 Armstrong GA, Alberti M & Hearst JE (1990) Con-
served enzymes mediate the early reactions of caroten-
oid biosynthesis in nonphotosynthetic and
photosynthetic prokaryotes. Proc Natl Acad Sci USA
87, 9975–9979.
12 Dogbo O, Laferriere A, d’Harlingue A & Camara B
(1988) Carotenoid biosynthesis: isolation and character-
ization of a bifunctional enzyme catalyzing the synthesis
of phytoene. Proc Natl Acad Sci USA 85, 7054–7058.
13 Bartley GE & Scolnik PA (1993) cDNA cloning, expres-
sion during development, and genome mapping of
PSY2, a second tomato gene encoding phytoene syn-
thase. J Biol Chem 268 , 25718–25721.
14 Ray J, Moureau P, Bird C, Bird A, Grierson D, Maun-
ders M, Truesdale M, Bramley P & Schuch W (1992)
Cloning and characterization of a gene involved in phy-

toene synthesis from tomato. Plant Mol Biol 19, 401–
404.
15 Emanuelsson O, Brunak S, von Heijne G & Nielsen H
(2007) Locating proteins in the cell using TargetP,
SignalP and related tools. Nat Protoc 2, 953–971.
16 Small I, Peeters N, Legeai F & Lurin C (2004) Predo-
tar: a tool for rapidly screening proteomes for N-termi-
nal targeting sequences. Proteomics 4, 1581–1590.
17 Fraser PD, Truesdale MR, Bird CR, Schuch W &
Bramley PM (1994) Carotenoid biosynthesis during
tomato fruit development (evidence for tissue-specific
gene expression).
Plant Physiol 105, 405–413.
18 Fraser PD, Kiano J, Truesdale M, Schuch W & Bram-
ley PM (1999) Phytoene synthase-2 enzyme activity in
Tomato colours – why the flower is yellow and the fruit is red? G. Giorio et al.
534 FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS
tomato does not contribute to carotenoid synthesis in
ripening fruit. Plant Mol Biol 40, 687–698.
19 Fraser PD, Schuch W & Bramley PM (2000) Phytoene
synthase from tomato (Lycopersicon esculentum) chlo-
roplasts – partial purification and biochemical proper-
ties. Planta 211, 361–369.
20 Kreuz K, Beyer P & Kleinig H (1982) The site of
carotenogenic enzymes in chromoplasts from Narcissus
pseudonarcissus L. Planta 154, 66–69.
21 Schledz M, Al-Babili S, Lintig JV, Haubruck H, Rab-
bani S, Kleinig H & Beyer P (1996) Phytoene synthase
from Narcissus pseudonarcissus: functional expression,
galactolipid requirement, topological distribution in

chromoplasts and induction during flowering. Plant J
10, 781–792.
22 Bonk M, Hoffmann B, Lintig J, Schledz M, Al-Babili
S, Hobeika E, Kleinig H & Beyer P (1997) Chloro-
plast import of four carotenoid biosynthetic enzymes
in vitro reveals differential fates prior to membrane
binding and oligomeric assembly. Eur J Biochem 247,
942–950.
23 Gallagher CE, Matthews PD, Li F & Wurtzel ET
(2004) Gene duplication in the carotenoid biosynthetic
pathway preceded evolution of the grasses. Plant
Physiol 135, 1776–1783.
24 Fray RG & Grierson D (1993) Identification and
genetic analysis of normal and mutant phytoene syn-
thase genes of tomato by sequencing, complementation
and co-suppression. Plant Mol Biol 22, 589–602.
25 Giorio G, Stigliani AL & D’Ambrosio C (2007) Agro-
nomic performance and transcriptional analysis of
carotenoid biosynthesis in fruits of transgenic HighCaro
and control tomato lines under field conditions. Trans-
genic Res 16, 15–28.
26 Giuliano G, Bartley GE & Scolnik PA (1993) Regula-
tion of carotenoid biosynthesis during tomato develop-
ment. Plant Cell 5, 379–387.
27 Zhang J (2003) Evolution by gene duplication: an
update. Trends Ecol Evol 18, 292–298.
28 ABI PRISM 7700 Sequence Detection System (2001)
Relative Quantitation of Gene Expression. User Bulletin
#2. AB Applied Biosystems, Foster City, CA.
G. Giorio et al. Tomato colours – why the flower is yellow and the fruit is red?

FEBS Journal 275 (2008) 527–535 ª 2007 Metapontum Agrobios. Journal compilation ª 2007 FEBS 535