Báo cáo khoa học: VEGF gene expression is regulated post-transcriptionally in macrophages pdf

VEGF gene expression is regulated post-transcriptionally
in macrophages
Min Du
1
, Kristen M. Roy
1
, Lihui Zhong
1
, Zheng Shen
1
, Hannah E. Meyers
1
and Ralph C. Nichols
1,2,3
1 Department of Microbiology and Immunology, Dartmouth Medical School, Hanover, NH, USA
2 Veterans Administration Research Service, White River Junction, VT, USA
3 Department of Medicine, Dartmouth Medical School, Hanover, NH, USA
The angiogenic cytokine vascular endothelial growth
factor (VEGF) is associated with macrophage cell infil-
tration in inflammation. Both VEGF and macrophage
cells play a critical role in inflammatory processes
including synovial joint inflammation [1–3], athero-
sclerosis [4], tumorigenesis [5], nephritis [6], corneal [7]
and diabetic [8] neovascularization. The relationship
between macrophages and VEGF protein is important
to the inflammatory response for several reasons:
(1) macrophages produce VEGF protein [9,10];
(2) neo-vascularization induced by VEGF contributes
to disease in the inflamed joint [11,12] and other
inflammatory diseases [13]; (3) macrophages express
VEGFR-1 (Flt-1) and respond to VEGF protein [14].

To better understand the contribution of VEGF to
inflammatory disease we investigated regulation of
VEGF gene expression in macrophages.
The relationship between macrophage activation and
VEGF has been poorly explored in part because the
macrophage cell expresses the VEGFR-1 receptor but
Keywords
VEGF; mRNA stability; 3¢ UTR; AURE;
macrophage
Correspondence
R.C. Nichols, Mailstop 151, Veterans
Administration Research Service, 215 North
Main Street, White River Junction,
VT 05009-0001, USA
Fax: +1 802 296 6308
Tel: +1 802 295 9363 extn 5891
E-mail:
(Received 4 April 2005, revised 12 December
2005, accepted 16 December 2005)
doi:10.1111/j.1742-4658.2006.05106.x
The macrophage is critical to the innate immune response and contributes
to human diseases, including inflammatory arthritis and plaque formation
in atherosclerosis. Vascular endothelial growth factor (VEGF) is an angio-
genic cytokine that is produced by macrophages. To study the regulation
of VEGF production in macrophages we show that stimulation of mono-
cyte-macrophage-like RAW-264.7 cells by lipopolysaccharide (LPS) increa-
ses expression of VEGF mRNA and protein. Three alternative splicing
VEGF mRNA isoforms are produced, and the stability of VEGF mRNA
increases following cellular activation. To study post-transcriptional regula-
tion of the VEGF gene the 3¢-untranslated region (3¢ UTR) was introduced

into the 3¢ UTR of the luciferase gene in a reporter construct. In both
RAW-264.7 cells and thioglycollate-elicited macrophages, the 3¢ UTR
sequence dramatically reduces reporter expression. Treatment with activa-
tors of macrophages, including LPS, lipoteichoic acid, and VEGF protein,
stimulates expression of 3¢ UTR reporters. Finally, mapping studies of the
3¢ UTR of VEGF mRNA show that deletion of the heterogeneous nuclear
ribonucleoprotein l binding site affects basal reporter expression in RAW-
264.7 cells, but does not affect reporter activation with LPS. Together these
results demonstrate that a post-transcriptional mechanism contributes to
VEGF gene expression in activated macrophage cells.
Abbreviations
AURE, adenosine-uridine-rich element; CAURE, cytidine-adenosine-uridine-rich element; CSD ⁄ PTB, cold shock domain ⁄ polypyrimidine tract
binding protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GLUT1, glucose transporter-1; hnRNP, heterogeneous nuclear
ribonucleoprotein; HuR, ELAV protein HuA; hVEGF, human vascular endothelial growth factor; LPS, lipopolysaccharide; LTA, lipoteichoic acid;
mVEGF, mouse vascular endothelial growth factor; TG-Mac, thioglycollate-elicited macrophages; TNFa, tumor necrosis factor-alpha; UTR,
untranslated region.
732 FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works
not the VEGFR-2 (Flk-1) receptor [14]. The VEGFR-1
receptor has been considered a decoy receptor on
endothelial cells where VEGFR-1 is considerably less
active (low kinase activity) than VEGFR-2 [15].
However, critical new reports show that the blockade
of VEGFR-1, but not VEGFR-2, reverses joint
destruction in the K ⁄ BxN mouse model of arthritis
[16,17]. In separate studies we show that the VEGFR-1
receptor is upregulated in activated macrophages
(K. Roy, R. Fava, R.C. Nichols, unpublished data),
suggesting that macrophages both produce and respond
to VEGF in inflamed tissues. Although an autocrine
mechanism of macrophage activation is suggested,

VEGFR-1 is also the target of placental growth factor
[17], and the role of VEGF in macrophage stimulation
is not fully understood.
Regulation of VEGF gene expression is controlled
by both transcriptional and post-transcriptional mech-
anisms [18], and post-transcriptional regulation is
responsible for a major increase in VEGF production
under hypoxia [18–25]. Post-transcriptional regulation
is mediated by mRNA binding proteins that act on
defined cis-acting elements, usually found in the 3 ¢-un-
translated region (3¢ UTR) of the targeted mRNA
[26,27]. Several reports have identified cis elements in
the 3¢ UTR of VEGF mRNA that are recognized by
heterogeneous nuclear ribonucleoprotein (hnRNP) L
[25], ELAV protein HuA (HuR) [23] and the cold
shock domain ⁄ polypyrimidine tract binding protein
(CSD ⁄ PTB) complex [28]. To extend these studies, we
now show that the 3¢ UTR of VEGF mRNA plays a
role in VEGF gene expression in mouse macrophages
under inflammatory conditions. We have introduced
the 3¢ UTR of mouse VEGF (mVEGF) into the 3¢
UTR of the luciferase reporter gene and show that
reporter activity increases when cells are treated with
lipopolysaccharide (LPS), lipoteichoic acid (LTA) or
VEGF protein. Finally, mapping studies of the 3¢
UTR suggests that the proximal region of the 3¢ UTR
contains cis elements important in activated macro-
phage cells. Together, these findings demonstrate that
VEGF gene expression in macrophages is controlled
by a post-transcriptional mechanism.

Results
Macrophage-like RAW-264.7 cells produce three
VEGF isoforms
Alternative splicing of VEGF mRNA produces mul-
tiple VEGF isoforms [29]. To determine which iso-
forms are produced in macrophage cells we designed
PCR primers homologous to sequences in exons 5 and
8. Three PCR products are produced from cDNA iso-
lated from RAW-264.7 cells (Fig. 1A). These PCR
products were sequenced and show that RAW-264.7
cells produce three VEGF isoforms, VEGF188,
VEGF164 (exon 6 skipped), and VEGF120 (exons 6
and 7 skipped). The same isoforms were expressed
by thioglycollate-elicited macrophages (TG-mac) from
C3H ⁄ HeN cells (data not shown). The VEGF120
isoform is the most abundant PCR product. The PCR
reaction is more efficient for smaller PCR products
and the abundance of the smallest VEGF isoform
may reflect this. In separate experiments we found
that immunoblotting of whole-cell RAW-264.7 lysates
with anti-VEGF antibody did not detect VEGF pro-
tein (data not shown), suggesting that most of the
VEGF protein is not cell associated and is exported
from macrophages. Finally, in experiments where
RAW-264.7 or thioglycollate-elicited macrophages
were stimulated, the VEGF mRNA levels of all three
isoforms increased but the relative amount of each
isoform did not change, suggesting that alternative
splicing of VEGF mRNA is not affected by cellular
activation.

Effects of stimulation of RAW-264.7 cells on
VEGF protein
Rheumatoid tissue is populated by macrophages, and
these cells produce VEGF mRNA and protein [1]. To
show that stimulated RAW-264.7 cells increase pro-
duction of VEGF we plated cells overnight, and then
treated cells with the Toll-like receptor-4 activator LPS
(100 ngÆmL
)1
) in fresh media for 4 h. Levels of VEGF
protein in culture media were measured by ELISA. As
shown in Fig. 1B, VEGF production increased by 60%
with LPS treatment. Treatment of RAW-264.7 cells
with tumour necrosis factor-a (TNFa) also increased
VEGF production (3.1 ± 0.6-fold increase with
10 ngÆmL
)1
TNFa for 4 h; mean ± SD for four experi-
ments). Finally we measured the effects of human
VEGF (hVEGF) on VEGF production by RAW-264.7
cells. Human VEGF is cross-reactive with mouse anti-
bodies (R & D Systems, Minneapolis, MN) used for
ELISA measurement. To correct for contaminating
hVEGF, parallel wells of were treated with cyclohexi-
mide (CHX), as described in Experimental procedures.
Cells were treated overnight without or with VEGF
protein (2 lgÆmL
)1
), media was replaced with media
not containing hVEGF protein, and mVEGF was

measured in the media after 4 h. As shown in Fig. 1C,
treatment with hVEGF (NCI Clinical Repository,
Frederick, MD) protein stimulated de novo protein
synthesis fivefold.
M. Du et al. Post-transcriptional regulation of VEGF in macrophages
FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works 733
Effects of stimulation of RAW-264.7 cells on
VEGF mRNA
We next measured the effects of cellular activation on
levels of endogenous VEGF mRNA and on the stabil-
ity of VEGF mRNA. Lipopolysaccharide activates
Toll-4 receptor; RAW-264.7 cells were untreated or
treated with LPS (100 ngÆmL
)1
for 4 h) and mRNA
levels were measured by RT ⁄ PCR. As shown in
Fig. 2A, levels of endogenous VEGF mRNA increased
by 45% in cells treated with LPS. To evaluate whether
VEGF mRNA was stabilized following LPS treatment,
RAW-264.7 cells were treated with LPS for 4 h fol-
lowed by no treatment or treatment with Actinomycin
D for 1 or 2 h. The levels of VEGF mRNA were
determined by RT ⁄ PCR and normalized to 18S rRNA.
We found that the half-life of VEGF mRNA was
increased in activated cells (Fig. 2B). The estimated
mRNA half-lives at 2 h were 0.86 h (untreated) and
1.6 h (LPS treated). This finding is comparable to the
45 min half-life of VEGF mRNA reported in unstimu-
lated monocyte-derived macrophages [30]. This result
shows that mRNA stabilization is one mechanism that

increases VEGF production in stimulated macro-
phages. The stability of VEGF mRNA is affected by
cis elements in the 3¢ UTR in other cell types
[19,23,25,28,31] and we next tested the activity of
AU-rich elements in macrophage cells.
Effects of AU-rich sequences on reporter activity
in macrophages
Post-transcriptional regulation is mediated by mRNA
binding proteins that act on cis elements in the 3¢
UTR [26–28,32]. Previous studies have shown that
both AU-rich elements (AURE) and non-AURE ele-
ments are active in the regulation of VEGF [19,23,
25,31]. To study AURE we created the AUUUA-luc
luciferase reporter that contains a 30-nt sequence with
multiple tandem repeats of the AUUUA pentamer and
includes six overlapping UUAUUUAUU nonamers.
Four hours after transfection in RAW-264.7 cells, the
activity of the AUUUA-luc reporter was 75% less than
the parent reporter pGL3 (Fig. 3). The activity of a
control reporter (AUGUA-luc), in which guanosine
A
B
C
Fig. 1. Production of VEGF by RAW-264.7 cells. (A) VEGF isoforms.
Primers specific to exons 5 and 8 were designed to amplify all
known mouse VEGF alternative splice isoforms from cDNA. The
PCR products for three isoforms (VEGF188, VEGF164, VEGF120)
were found. Bars show DNA size standards. (B) Effects of LPS on
VEGF protein production. To measure VEGF production, RAW-
264.7 were untreated or treated in fresh media for 4 h with LPS

(100 ngÆmL
)1
). Levels of VEGF protein (mean ± SD; P < 0.03) were
measured in the media from triplicate wells by ELISA. Results are
from one of two experiments with similar results. (C) Effects of
human VEGF protein on de novo VEGF protein production. To
measure the effects of human VEGF on VEGF production, RAW-
264.7 were untreated or treated with human VEGF (2 lgÆmL
)1
)
overnight. Medium was replaced with fresh media without VEGF,
and levels of VEGF protein (mean ± SD; P < 0.02) were measured
in the media from triplicate wells by ELISA. To correct for contami-
nating hVEGF, parallel wells were treated with CHX (20 l
M), as
described in Experimental procedures. Results are from one of two
experiments with similar results.
Post-transcriptional regulation of VEGF in macrophages M. Du et al.
734 FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works
residues were substituted for uridine residues in each
pentamer, was only 10% less than the parent con-
struct. The 30-nt AURE from glucose transporter-1
(AURE ⁄ GLUT1-luc) [33], which contains no AUUUA
pentamers, was 85% less than the parent reporter.
These results show that both AUUUA and non-
AUUUA AURE elements are active in RAW-264.7
cells. The 3¢ UTR of VEGF mRNA contains AURE
and we next tested the activity of the full-length 3¢
UTR using reporter constructs.
The effects of the 3¢-untranslated region of

mouse VEGF mRNA on gene expression in a
heterologous reporter
We evaluated the role of the 3¢ UTR in gene exp-
ression by introducing the SmaI ⁄ XbaI fragment (nt
209–1747) of the mouse 3¢ UTR into the 3¢ UTR of
the luciferase gene. The structure of the full-length
reporter (VEGF-FL-luc) and related 3¢ UTR reporters
is shown in Fig. 4A. The VEGF-FL-luc reporter con-
tains all regulatory elements (or homologous regions)
reported in rat, mouse, and hVEGF 3¢ UTR. The
native polyadenylation signal identified by Dibbens
et al. [34] was removed, and we used the more efficient
bovine growth hormone poly(A) signal [35] present
in the pcDNA-3.1 reporter construct. The poly(A)
sequence and poly(A) binding protein mediate transla-
tion of mRNA, and are not thought to affect mRNA
stability [36–38]. Further studies are needed to deter-
mine if the native poly(A) signal affects VEGF mRNA
stability. We transfected the parental reporter (3.1-luc)
or the VEGF-FL-luc reporter into nonactivated cells
and measured luciferase levels after 4 h. The basal
level of expression of the full-length 3¢ UTR reporter
was dramatically less than that of the parent vector
in both RAW-264.7 cells (80% reduction) and in
TG-Mac cells (65% reduction) (Fig. 4B and C). Well-
to-well variation was large in primary TG-Mac cells.
Therefore, we cotransfected TG-Mac cells with
sea pansy luciferase (renilla) and we express these
results as ‘normalized luciferase units.’ Together, these
results demonstrate that the 3¢ UTR of VEGF mRNA

inhibits expression of a heterologous reporter gene in
macrophages.
Effects of the 3¢ UTR of VEGF mRNA on
luciferase reporter mRNA levels
Regulation by cis elements in the 3¢ UTR can affect
mRNA levels or may affect translational efficiency
[39]. To determine how the introduction of the 3¢
UTR of VEGF mRNA affected luciferase mRNA lev-
els, we transfected RAW-264.7 cells with either the
parental reporter, 3.1-luc, or the VEGF-FL- luc repor-
ter and measured luciferase mRNA levels by
RT ⁄ PCR. As shown in Fig. 4D, luciferase mRNA was
reduced by 40% in cells expressing the VEGF-FL-luc
as compared to the parental luciferase mRNA. It is
important to note that the parental 3.1-luc and
VEGF-FL-luc constructs are driven by the same pro-
moter, and any differences between the luciferase
mRNA levels are due to actions on the 3¢ UTR
sequence of VEGF mRNA.
A
B
Fig. 2. Effects of macrophage activation on VEGF mRNA. (A) VEGF
mRNA levels. RAW-264.7 cells were not treated or treated with
LPS for 4 h and VEGF mRNA levels determined by RT ⁄ PCR. The
levels of the three VEGF isoform PCR products from each sample
were combined, and the sum was normalized to the level of 18S
rRNA PCR product from the same sample. Results are relative val-
ues, three samples per condition (mean ± SD; P < 0.04) and are
representative of two experiments. (B) Half-life determination of
VEGF mRNA. Decay of VEGF mRNA was measured in cells not-

treated or treated with actinomycin D for 1 or 2 h. Levels of VEGF
PCR products were normalized to levels of 18S rRNA from the
same sample. Results are set to unity for the zero time point, and
the mean ± SD of triplicate determinations are shown. VEGF
mRNA levels at 2 h were significantly less than at zero hour
(untreated, P < 0.005; LPS treated, P < 0.002). VEGF mRNA levels
were significantly greater in LPS-treated samples than in untreated
samples at 2 h (P < 0.015).
M. Du et al. Post-transcriptional regulation of VEGF in macrophages
FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works 735
Effects of agents that activate macrophages on
VEGF-FL-luc reporter activity
We show in Fig. 1 that stimulated macrophages
increase production of VEGF mRNA and protein. We
next tested the effects of macrophage activating agents
on VEGF-FL-luc reporter activity in RAW-264.7 cells.
Dose–response treatment with LPS showed that repor-
ter activity was maximal with 100 ngÆmL
)1
(1.82 ±
0.25-fold greater than untreated, mean ± SD).
Reporter activity increased for up to 6 h and did not
increase further after 24 h (data not shown). Because
LPS acts on the Toll-4 receptor, we next determined if
the Toll-2 receptor ligand, LTA [40], could affect the
VEGF-FL-luc reporter activity. When RAW-264.7
cells were treated with LTA (1 lgÆmL
)1
, 24 h), VEGF-
FL-luc reporter activity increased 1.69 ± 0.17-fold

over untreated controls. Next, we tested the effects of
VEGF protein on activation of VEGF-FL-luc reporter
activity.
Macrophage cells express the VEGFR-1 (Flt-1)
receptor [41] and macrophages migrate in response to
VEGF protein at levels as low as 12 ngÆmL
)1
[14]. To
determine if VEGF protein affects RAW-264.7 cells,
we first measured production of a primary marker
of macrophage activation, TNFa. Cells treated with
100 ngÆmL
)1
of recombinant hVEGF for 24 h
increased TNFa production by 9.3 fold (untreated,
1359 ± 186 pgÆmL
)1
: hVEGF treated, 12 604 ±
3461 pgÆmL
)1
; mean ± SD). We next measured the
effects of hVEGF on VEGF-FL-luc reporter expres-
sion in RAW-264.7 cells. Treatments with hVEGF as
low as 3.3 ngÆmL
)1
increased reporter activity with
maximal activity seen at 100 ngÆmL
)1
(2.2 ± 0.2 fold
increase over untreated; mean ± SD). Effects of acti-

vating agents on VEGF-FL-luc reporters are normal-
Fig. 3. AU-rich sequences reduce reporter activity. Sequences were introduced into the 3¢ UTR of the luciferase gene of the eukaryotic
expression vector pGL3-Control (Promega). Luciferase activity was measured in cell lysates 4 h after transfection of RAW-264.7 cells. On
the right are diagrams of the reporter constructs showing the nucleotide sequence of an artificial AU-rich element (AUUUA), a negative con-
trol (AUGUA) and the non-AUUUA AURE identified in the 3¢ UTR of GLUT1 mRNA (AURE ⁄ GLUT1) [33]. Error bars are SD. Results shown
are representative of five experiments. Results from cells transfected for 24 h were similar (data not shown).
Fig. 4. The effects of the 3¢ UTR of VEGF mRNA on reporter expression in macrophages. (A) Diagram of mVEGF reporter constructs.
Upper-most bar shows the 3¢ UTR region studied. Adenosine-uridine-rich (AU) and cytidine-adenosine-uridine-rich (CAU and CSD ⁄ PTD)
regions are noted. The parent construct, 3.1-luc, was created as described in Experimental procedures. The full-length reporter (VEGF-FL-luc)
construct contains nt-209–1747 of the 3¢ UTR of mVEGF mRNA, and the sequence is shown below. The CAURE site recognized by hnRNP
L (nt 322–342), the CAURE recognized by HuR (nt 1622–1665) [23], and the CSD ⁄ PTB binding site (nt 1727–39) [28] are shown in
bold ⁄ underlined type. Additional AU-rich sequences, including all AUUUA pentamers and nonomers, are shown in bold type. Engineering of
reporter constructs is described in Experimental procedures. (B, C) The 3¢ UTR of VEGF mRNA suppresses reporter activity in macrophages.
The effects on reporter activity of the 3¢ UTR of VEGF mRNA were measured in untreated macrophage cells by transfection of either the
control reporter construct (3.1-luc) or the full-length VEGF-3¢ UTR reporter (VEGF-FL-luc ). RAW-264.7 cells (B) or TG-Mac cells from
C3H ⁄ HeN mice (C) were lysed 4 h after transfection, and luciferase activity was read by luminometry. Similar results were seen after 24 h
(data not shown). Diagrams on the right show the construct used to transfect cells. Data are the mean ± SD, and are representative of at
least three experiments. (D) Luciferase mRNA levels. RAW-264.7 cells were transfected with the parent vector (3.1-luc) or with VEGF-FL-luc
for 24 h. Total RNA was prepared from cell cytoplasm and RT ⁄ PCR was performed with luciferase primers or GAPDH primers as described
in Experimental procedures.
Post-transcriptional regulation of VEGF in macrophages M. Du et al.
736 FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works
ized to parent reporter levels in cells treated in an iden-
tical manner (see Experimental procedures, and
Fig. 6). Treatment with hVEGF produced maximal
VEGF-FL-luc reporter activity in 4 h, with longer
times (up to 24 h) showing similar increases. Together,
these results demonstrate that pro-inflammatory agents
of bacterial origin (LPS, LTA) and endogenous origin
(VEGF) increase VEGF 3¢ UTR-dependent reporter

expression. In addition, these results show that the
reporter construct is a useful tool for mapping the 3¢
UTR.
A
C
B
D
M. Du et al. Post-transcriptional regulation of VEGF in macrophages
FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works 737
Mapping of the 3¢ UTR of VEGF mRNA
As shown in Fig. 4A, the 3¢ UTR of mVEGF mRNA
is complex. The region proximal to the coding region
contains a CAU-element [19,25] but no AUUUA pen-
tamers. The distal region contains: (1) two active
CAU-rich elements [23,28]; and (2) six AUUUA pen-
tamers and two nonomers, some of which are active
[31]. To isolate these regions we created luciferase
reporters that contain either the proximal region
(VEGF-209–750-luc) or the distal region (VEGF-751–
1747-luc) (see Fig. 4A). When transfected into RAW-
264.7 cells, neither construct displayed the level of
inhibition found with the full-length construct (Fig. 5).
Although we cannot rule out the possibility that a cis
element at nt 750 has been interrupted, this region
contains no AU- or CAU-rich sequence motifs. The
reporter activity of the proximal VEGF-209–750-luc
construct was most similar to the full-length construct.
In addition, the activity of the VEGF-209–750-luc
reporter increased in LPS-treated cells whereas the
VEGF-751–1747-luc was minimally affected by LPS

treatment (data not shown). For this reason we exam-
ined candidate elements in the proximal region of the
3¢ UTR.
The hnRNP L element
Shih and Claffey identified a cis element in the prox-
imal region of hVEGF that was recognized by the
mRNA binding protein, hnRNP L [25]. The hnRNP L
element is highly conserved between human and mouse
and we used site-directed mutagenesis to delete the
sequence (nt 322–42, CACCCACCCACAUACACA
CAU) from the full-length reporter. As shown in
Fig. 6, deletion of the hnRNP L element (VEGF-dL-
luc) reduced reporter activity by 25% in untreated
RAW-264.7 cells (compare columns 1 and 3). In cells
treated with LPS (100 ngÆmL
)1
), VEGF-FL-luc and
VEGF-dL-luc responded with similar increases in
reporter activity (VEGF-FL-luc increased 2.1-fold,
VEGF-dL-luc increased 2.5-fold). Treatment of RAW-
264.7 cells with hVEGF protein produced similar
effects on these reporters (data not shown). We con-
clude that the hnRNP L element affects basal levels of
VEGF reporter activity but does not affect increases in
VEGF reporter found in activated cells. We are cur-
rently extending this mapping analysis to identify addi-
tional 3¢ UTR regulatory elements that are active in
macrophages.
Discussion
The VEGF cytokine plays a major role in cancer by

controlling neo-vascularization in solid tumours [13].
In arthritis, VEGF stimulates vascularization that
supports the ’tumour-like’ phenotype of the inflamed
synovium [12]. However, VEGF also plays a role
in vascular permeability and as a chemoattractant
[11,12,14], suggesting that the role of VEGF in
inflamed joints may be complex. Macrophages in rheu-
matoid joints produce VEGF [1], and we have found
that VEGFR-1 is upregulated in activated macro-
phages (K. Roy, R. Fava, R.C. Nichols, unpublished
data). Together these facts suggest that macrophages
at the site of inflammation both respond to VEGF and
contribute to the inflammatory response by producing
VEGF protein. In this report we confirm that macro-
Fig. 5. Mapping of the 3¢ UTR from VEGF mRNA. Reporter constructs were created that separated the proximal and distal regions of the 3¢
UTR from VEGF mRNA (see Fig. 4A). The reporter VEGF-209–750-luc contains the proximal region (nt 209–750). The reporter VEGF-751–
1747-luc contains the distal region (nt 751–1747). Reporter constructs were transfected into RAW-264.7 cells and luciferase activity meas-
ured in cell lysates after 4 h. Similar results were seen at 24 h (data not shown). Results are mean ± SD and are representative of five
independent experiments.
Post-transcriptional regulation of VEGF in macrophages M. Du et al.
738 FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works
phages respond to VEGF and other inflammatory
mediators by increasing VEGF production. We also
show that macrophages produce multiple mRNA
VEGF isoforms, and the stability of VEGF mRNA
increases in activated cells. We demonstrate that macro-
phage activation increases expression of VEGF luci-
ferase reporters containing the mouse VEGF 3¢ UTR
region, and we present mapping analysis of the VEGF
3¢ UTR. Together, these results demonstrate that, as in

cancer models, VEGF expression is controlled at the
post-transcriptional level in macrophage-like cells.
Increased production of VEGF has been shown to
act by both transcriptional and post-transcript-
ional mechanisms [13]. Post-transcriptional regulation
involves mRNA binding proteins acting on cis ele-
ments to alter mRNA stability or the efficiency of
translation [32]. Post-transcriptional regulation affects
VEGF production in a cancer model [18], but it is
unclear whether post-transcriptional regulation affects
VEGF gene expression in macrophage cells. To
address this, we show here that under conditions in
which VEGF protein production increases: (a) VEGF
mRNA levels increased (Fig. 2A); and (b) VEGF
mRNA stability increased (Fig. 2B). However, these
increases in VEGF mRNA and protein production
may also result in part from increased transcription.
We are currently assessing transcriptional regulation in
activated macrophages, and only report here studies of
3¢ UTR-mediated regulation.
To study regulatory cis elements in VEGF mRNA
we introduced the 3¢ UTR of mVEGF mRNA into
the 3¢ UTR of the luciferase gene in a reporter
construct. Using this method, we can segregate post-
transcriptional regulation from both transcriptional
regulation of the native VEGF promoter, and post-
translational regulation acting on the VEGF pro-
tein. We show in both monocyte-macrophage-like
RAW-264.7 cells and thioglycollate-elicited macro-
phages that introduction of the full-length 3¢ UTR

construct significantly reduced luciferase mRNA levels,
and reduced basal reporter activity (Fig. 4B, C, D).
Next, we show that, under conditions in which VEGF
mRNA is stabilized (LPS activation), luciferase repor-
ter activity increased. These results suggest that the 3¢
UTR in VEGF mRNA contributes to the increases in
VEGF mRNA and protein found when macrophages
are stimulated. We are the first to show that the 3 ¢
UTR of VEGF mRNA affects gene expression
in macrophages.
Post-transcriptional regulation of mRNA is medi-
ated by mRNA binding proteins that recognize cis -act-
ing elements, most frequently found in the 3¢ UTR
region [26–28]. The most studied cis-acting elements
are AURE. Analysis of the human genome estimates
that 8% of human mRNAs contain AURE [42]. Three
classes of AURE have been identified [26,27], and
the 3¢ UTR of VEGF mRNA contains two of these
AURE classes: (a) Class I, nonoverlapping AUUUA
Fig. 6. The effects of the hnRNP L element on reporter activity. To test the activity of the cis element recognized by hnRNP L [25], the
sequence (CACCCACCCACAUACACACAU) was deleted from the full-length reporter construct. The deletant reporter, VEGF-dL-luc, produced
less activity in untreated RAW-264.7 cells (compare columns 1 and 3). In macrophages treated with LPS (100 ngÆmL
)1
for 24 h), both the
VEGF-FL-luc and VEGF-dL-luc reporters showed similar increases in reporter activity. Treatment with LPS affects the promoter of the repor-
ter construct. To account for this effect, luciferase units (mean ± SD) are normalized to luciferase units of the 3.1-luc parental construct trea-
ted in parallel wells. For example, the reporter values without LPS treatment were: 3.1-luc, 693 000 ± 97 000 luc units; VEGF-FL-luc,
104 000 ± 4000 luc units. Reporter values with LPS treatment were: 1157 000 ± 16 000 (3.1-luc) and 369 000 ± 24 000 (VEGF-FL-luc). The
normalized value for VEGF-FL-luc reporter activity is set at unity (column 1).
M. Du et al. Post-transcriptional regulation of VEGF in macrophages

FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works 739
pentamers and UUAUUUA
A
/
U
A
/
U
nonamers; (b)
Class III, adenosine-uridine rich and uridine-rich
sequences that lack AURE pentamers. Several reports
have analysed AU-rich elements in rat and human
VEGF 3¢ UTR [19,21–23,43–44]. One Class III AURE
element that was identified in rat VEGF is not con-
served in mouse or human [20]. Another type of cis
element, that we refer to as a CAU-rich element
(CAURE), contains adenosine, uridine and cytidine
residues, and CAURE have been identified in GLUT1
mRNA [45] (nt 2180–90) and in the 3¢ UTR of VEGF
mRNA [23,25,28,46]. The hnRNP L binding site
(nt 322–342) [25], HuR binding site (nt 1622–1665)
[23,46], and CSD ⁄ PTB complex binding site (nt 1727–
39) [28] in the 3¢ UTR of VEGF mRNA are CAU-
rich. Here we present our analysis of 3¢ UTR-mediated
regulation in mouse macrophage cells.
The 3¢ UTR of mVEGF mRNA contains cis ele-
ments in both the proximal and distal regions
[21,22,25,43,47]. The distal two-thirds of the mouse 3¢
UTR contains six AURE pentamers, two nonomers,
two CAURE and seven additional regions of 10 or

more AU nucleotides that lack AUUUA pentamers.
Several groups have shown that cis elements in the
distal region have strong affects on VEGF gene
expression under hypoxic stress [22,46]. Under norm-
oxia these distal cis elements contribute to VEGF
mRNA instability. It was surprising therefore to find
that when the distal region of the 3¢ UTR was
removed (to create VEGF-209–750-luc) reporter activ-
ity was similar to that of the full-length reporter
(Fig. 5). In addition, cells stimulated with LPS or
with VEGF showed increased VEGF-209–750-luc
reporter activity. In contrast, the VEGF-751–1747-luc
reporter responded poorly to cellular activation (data
not shown), suggesting that regulatory elements active
in macrophages reside in the proximal region of the
VEGF 3¢ UTR.
The proximal region of the 3¢ UTR contains a
CAURE in hVEGF that is recognized by hnRNP L
under both normoxic and hypoxic conditions in M21
melanoma cells [25]. The homologous mouse sequence
is nearly identical to the human CAURE, and deletion
of the hnRNP L element resulted in a decrease in
reporter activity in untreated RAW-264.7 cells. How-
ever, the activity of the wild-type and VEGF-dL-luc
reporters both increased in cells treated with LPS
(Fig. 6). Treatment with hVEGF produced similar
results (data not shown). Although there are no
AUUUA pentamers in the nt 209–750 region there is a
long AU-rich region (78-nt, 97% adenosine-uridine)
that is tandem to the hnRNP L element. This AURE

is interesting because we found that the GLUT1-
AURE luciferase reporter, which is also a long non-
AUUUA Class III, was very active in RAW-264.7 cells
(Fig. 3). Future studies will determine if this AURE or
other noncanonical cis elements in the proximal region
contribute to 3¢ UTR-dependent regulation in macro-
phages.
Three agents that stimulate macrophages (LPS, LTA
and VEGF) increased VEGF 3¢ UTR-dependent repor-
ter activity. One mechanism we considered was that
these agents act by initially stimulating production of
TNFa, and then TNFa stimulates VEGF gene expres-
sion. To investigate this, we first showed that LPS sti-
mulated production of TNFa (data not shown). Next
we determined whether TNF a affected VEGF 3¢ UTR-
dependent reporter activity. Although TNFa treatment
increased VEGF protein production, we found that
TNFa treatment decreased VEGF-FL-luc reporter
activity modestly but significantly (10%; data not
shown). We conclude that post-transcriptional stimula-
tion of VEGF gene expression by agents such as LPS
and VEGF do not act through TNFa by an autocrine
mechanism.
Activation of VEGF gene expression in RAW-264.7
cells with LPS and VEGF was distinct from treatments
with TNFa. Treatment with TNFa decreased reporter
activity and increased VEGF protein production.
Treatment with LPS or with VEGF protein increased
both reporter activity and VEGF protein production.
However, the effect of LPS on VEGF protein produc-

tion was modest compared to the effects of VEGF
treatment. These different profiles of VEGF gene
regulation by TNFa, VEGF and LPS may result from
different gene activation mechanisms. Our results
suggest that: (i) TNF a stimulates VEGF production
by a transcriptional mechanism, but inhibits the
post-transcriptional pathway; (ii) treatment with
VEGF stimulates both transcriptional and post-tran-
scriptional pathways; (iii) treatment with LPS acts
solely through a post-transcriptional mechanism, and
does not affect VEGF transcription. Studies of the
effects by these agents on transcription are on going. If
LPS acts solely by a post-transcriptional mechanism,
then long-term studies are needed to determine if the
modest effects by LPS result in sufficient production of
VEGF to initiate VEGF-driven autocrine production
of VEGF. Importantly, our results suggest that post-
transcriptional regulation of VEGF may be important
under conditions in which TNFa is not active, inclu-
ding under therapeutic conditions where TNFa action
is blocked.
Originally identified as a permeability factor, VEGF
is now known to play an essential role in arterio-
genesis [13], neo-vascularization in cancer [13], and
Post-transcriptional regulation of VEGF in macrophages M. Du et al.
740 FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works
inflammatory diseases [12]. Our studies with macroph-
ages demonstrate that the 3¢ UTR of VEGF contri-
butes to gene expression and provides a novel target to
treat active disease. Post-transcriptional regulation of

VEGF in macrophages is mediated by the action of
VEGF on its cognate receptor, VEGFR-1. Regulation
of VEGF by an autocrine mechanism in cancer has
been reviewed [48]. It is possible that VEGF and its
receptor interact intracellularly to regulate VEGF gene
expression [48]. The mechanism of regulation of the
macrophage VEGF receptor, VEGFR-1, is now under
study to determine if VEGF protein and its receptor
are coordinately regulated.
Experimental procedures
Cell culture, transfection and luciferase assay
The RAW-264.7 cell line was obtained from ATCC
(Manassas, VA) and maintained as described. Media was
DMEM supplemented with 10% heat-inactivated fetal
bovine serum (Hyclone, Logan, VT) and penicillin-strep-
tomycin. Cultured cells were plated 24 h prior to trans-
fection in six-well or 48-well plates. Cells were adherent
and were transfected at 40% confluence in Opti-MEM
media (Invitrogen-Gibco, Carlsbad, CA) with luciferase
constructs (plasmid constructs are described below). For
cell transfection, plasmid DNA was complexed with
Lipofectamine-2000, as described by the manufacturer
(Invitrogen-Gibco). Cells in 48-well plates were lysed with
100 lL cell culture lysis reagent lysis buffer (Promega).
After 4 or 24 h, luciferase activity in 20 lL of lysate was
measured following addition of luciferin substrate (Prome-
ga, Madison, WI) in a Molecular Dynamics luminometer.
Each transfection condition in 48-well plates was per-
formed in six wells. Two wells were pooled (10 lLÆwell
)1

)
to give triplicate readings for each experimental condi-
tion. Results are reported as the mean ± SD. All experi-
ments are representative of two or more independent
experiments performed on different days. The efficiency
of transfection in RAW-264.7 cells was evaluated by co-
transfection with renilla luciferase (pRL-SV40 Promega).
Cells in 48-well plates were transfected with 0.1 lg luci-
ferase and 0.01 lg renilla luciferaseÆwell
)1
and lysed in
Dual-Glo lysis buffer (Promega). The well-to-well vari-
ation of firefly luciferase activity in RAW-264.7 cells was
not improved by normalization to renilla luciferase.
The effect of cell activation on 3¢ UTR reporter activity
was measured by adding the activating agent (LPS, LTA,
or human VEGF) 2 h after transfection and cells were lysed
4 or 24 h later. In some experiments with macrophage acti-
vating agents the cell treatment affected the promoter of
the reporter construct. In these experiments parallel wells
were transfecting with the parental (empty) reporter. The
parallel wells were not treated ⁄ treated with activating agent
in an identical manner as wells transfected with VEGF
reporters. To account for effects on the construct promoter,
results were normalized to the parental luciferase values.
Thioglycollate-elicited macrophages (TG-Mac) were
obtained from C3H ⁄ HeN mice as previously described
[49]. Briefly, mice were injected with thioglycollate and
after 3 days, mice were killed by cervical dislocation.
Macrophages were removed from the peritoneum and

plated on 6- or 48-well tissue culture plates and main-
tained in the same media used for RAW-264.7 cells.
Nonadherent cells were removed after 24 h. The well-to-
well efficiency of transfection of primary TG-Mac was
monitored in reporter assays by cotransfection of pRL-
SV40 renilla luciferase. Reporter activity was normalized
to the value of renilla luciferase for each experimental
condition.
All experimental procedures were carried out in accor-
dance with NIH guidelines regarding the care and use of
experimental animals.
Measurement of VEGF and TNFa production
by ELISA
The effects of LPS, TNFa and hVEGF on mVEGF pro-
tein production was measured in cells plated 24 h before
treatment. After treatment, medium was collected and
stored at )80 °C. Cells were treated with LPS (generous
gift of H. Yohe, Veterans Administration Research
Service, White River Junction, VT) or human TNFa (gen-
erous gift of R. Fava, Veterans Administration Research
Service, White River Junction, VT). Human VEGF was
produced in baculovirus by R & D Systems, and obtained
from the NCI Clinical Repository. The activity of hVEGF
was lost following boiling [50]. Production of mVEGF
(mVEGF) was measured by ELISA (Mouse VEGF,
#MMV00, R & D Systems). Due to small but significant
cross-reactivity between mVEGF and hVEGF, we could
not directly measure mVEGF production by cells treated
with hVEGF. Therefore, production of mVEGF follow-
ing stimulation with hVEGF was determined as follows.

RAW-264.7 cells were not treated or treated with
2 lgÆmL
)1
hVEGF. After 24 h, cells were rinsed and incu-
bated with fresh media (without VEGF), and after 4 h
media were collected. To account for contaminating
hVEGF, all treatments were performed in parallel, and
these parallel wells were treated for 4 h with 20 lm CHX
to block de novo protein synthesis. Levels of de novo
VEGF protein was determined by subtracting VEGF lev-
els in parallel CHX-treated wells. Similar results were
found with hVEGF from another source (R & D Sys-
tems). Production of mouse TNFa was measured in media
by ELISA, according to the manufacturer’s directions
(Mouse TNFa, #MTA00, R & D Systems).
M. Du et al. Post-transcriptional regulation of VEGF in macrophages
FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works 741
Plasmid construction
VEGF 3¢UTR luciferase reporter constructs
The parental luciferase vector was created by introduction
of the luciferase gene from pGL3 (Promega) into the
multiple cloning site of pcDNA-3.1 (Invitrogen, Carlsbad,
CA) to create 3.1-luc. The 1549-bp SmaI ⁄ XbaI fragment
of the 3¢ UTR from mVEGF was released from the Sma4
plasmid (generously provided by Pat D’Amore, Harvard
University) and cloned into the 3¢ UTR of the luciferase
gene of 3.1-luc. The VEGF-FL-luc construct contains nt
209–1747 of the mVEGF 3¢ UTR where nt 1 is the first
base of the VEGF stop codon [34] (identical to bases
209–1747, GenBank #AF317892). The nt 1–208 region of

the 3¢ UTR contains no AUUUA pentamers or other can-
didate cis elements and was not included in the construct.
The nt 1748–1894 region contains the only active mVEGF
AUUAAA polyadenylation [poly(A)] signal, as described
by Dibbens et al. [34], and was not included in reporter
constructs. All reporter constructs utilized the bovine
growth hormone poly(A) signal in the parent vector
(pcDNA-3.1 vector). The XbaI ⁄ ApaI fragment that con-
tained the poly(A) signal was shown by others to not
affect mRNA stability [22]. Construct VEGF-209–750-luc
was created by deletion of the BamHI ⁄ XbaI fragment
from the VEGF-FL-luc construct. The VEGF-751–
1747-luc construct was created by deletion of the EcoRV ⁄
BamHI fragment from the VEGF-FL-luc construct. The
VEGF-dL-luc construct was created by deletion of the
hnRNP L cis-acting element (CACCCACCCACAUA
CA
CACAU nt 322–342) [25] from the VEGF-FL-luc
construct using PCR-based site-directed mutagenesis
(QuickChange, Stratagene, La Jolla, CA). One nucleotide
(C-388, underlined) in mouse is nonhomologous to human
(human U-358, GenBank #AF024710). Following muta-
genesis, the sequence of the VEGF-dL-luc was verified by
sequencing on both strands and then cloned into a 3.1-luc
parental vector that had not been subjected to PCR. The
integrity of all plasmid constructs was verified by sequen-
cing on both strands.
AURE luciferase constructs
Two constructs were created that contain AU-rich elements
(AURE). The AUUUA-luc construct contains a 30-nt AU-

rich sequence with pentamer repeats (5-AUUAUUUAUU
UAUUUAUUUAUUUAUUUAUU-3¢). A control repor-
ter (AUGUA-luc) was created in which AUGUA pentam-
ers replaced AUUUA pentamers (5¢-AUUAUGUAUGUA
UGUAUGUAUGUAUGUAUU-3¢). Constructs were
created by designing complementary sense and antisense
oligonucleotides with XbaI sites on the 5¢- and 3¢-ends.
The oligonucleotides were annealed and cloned into the
XbaI site in the 3¢ UTR of the luciferase gene in pGL3-
Control (Promega). The AURE ⁄ GLUT1-luc construct con-
tains the AU-rich sequence from the 3¢ UTR of human glu-
cose transporter-1 (GLUT1) [33] (5¢-UUUUAUAAUU
UUUUUAUUACUGAUUUUGUU-3¢ nt 1885–1914; Gen-
Bank #K03195). The AURE ⁄ GLUT1-luc construct was
created by site-directed mutagenesis (QuickChange, Strata-
gene) of the AUUUA-luc construct.
Obtaining RNA
Total RNA was obtained using RNeasy (Qiagen). The
quantity and quality of RNA were determined spectropho-
tometrically at 260 and 280 nm and by analysis on forma-
mide agarose gels.
RT/PCR
Oligonucleotide PCR primers for mVEGF, mouse glyceral-
dehyde-3-phosphate dehydrogenase (GAPDH), mouse 18S
rRNA, and luciferase genes were designed using Primer3
[51]. To determine levels of luciferase mRNA, total RNA
from the cytoplasmic fraction (as described in the RNeasy
kit, Qiagen) was treated twice with DNase to remove con-
taminating nuclear and plasmid DNA. Primers used to
measure VEGF mRNA were specific for sequences in exon

5 (sense primer) and exon 8 (antisense primer). For each
sample, cDNA was prepared from 1 lg of RNA using
Superscript (Gibco) and PCR was performed on 10% of
the cDNA in a 20-lL reaction using standard amplifying
conditions with Supermix PCR cocktail (Gibco). We per-
formed preliminary experiments to identify the range of
PCR cycle reactions that produced linear increments of
PCR product formation. We used the cycle number within
this range that produced PCR products from all samples.
VEGF and GAPDH PCR products were amplified from
regions of mRNA that crossed exon junctions. Large PCR
products resulting from genomic contamination were not
found. All PCR products were cloned into pCR-II-Topo
(Invitrogen) and sequenced on both strands. Sequences of
all primers used in this report are available upon request.
PCR products were stained with ethidium bromide, photo-
graphed, scanned into photoshop, and quantified using
nih image ( />Levels of VEGF mRNA are presented as the level of
VEGF PCR products normalized to level of 18S rRNA
PCR product from the same sample. Relative values are
presented as mean ± SD of triplicate independent samples
for each experimental condition.
VEGF mRNA stability
Stability of mRNA was measured by not-treating (0 h)
or treating cells with 5 lm actinomycin D for 1 or 2 h.
Levels of VEGF mRNA in triplicate samples were deter-
Post-transcriptional regulation of VEGF in macrophages M. Du et al.
742 FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works
mined by RT ⁄ PCR and normalized to levels of 18S
rRNA PCR product in the same sample. Half-life of

mRNA was calculated using the zero and two h time
points. Actinomycin D treatment did not affect levels of
18S rRNA.
Statistical analyses
Data are presented for representative experiments that
were repeated two or more times. Within each experi-
ment, treatments were performed in triplicate, as indica-
ted in the figure legends. Results were analysed by
Student’s t-test. A P value of < 0.05 was taken to indi-
cate significance.
Acknowledgements
We thank Xiao Wei Wang for excellent technical
assistance. We also thank Herb Yohe for mouse
macrophages and Pat D’Amore for the Sma4 plasmid
containing the mouse VEGF 3¢UTR. We are very
grateful to William Rigby and Roy Fava for advice
and helpful discussions.
This work was supported by a Merit Review Award
(to R.C.N) from the Department of Veterans Affairs,
and by National Institutes of Health Grants R03-
AR47393 (to R.C.N) and P20RR16437 (to R.C.N)
from the COBRE Program of the National Center for
Research Resources.
References
1 Fava RA, Olsen NJ, Spencer-Green G, Yeo KT, Yeo
TK, Berse B, Jackman RW, Senger DR, Dvorak HF &
Brown LF (1994) Vascular permeability factor ⁄ endo-
thelial growth factor (VPF ⁄ VEGF): accumulation and
expression in human synovial fluids and rheumatoid
synovial tissue. J Exp Med 18, 341–346.

2 Firestein GS (2003) Evolving concepts of rheumatoid
arthritis. Nature 423, 356–361.
3 Kinne RW, Brauer R, Stuhlmuller B, Palombo-Kinne E
& Burmester GR (2000) Macrophages in rheumatoid
arthritis. Arthritis Res 2, 189–202.
4 Shibata M, Suzuki H, Nakatani M, Koba S, Geshi E,
Katagiri T & Takeyama Y (2001) The involvement of
vascular endothelial growth factor and flt-1 in the pro-
cess of neointimal proliferation in pig coronary arteries
following stent implantation. Histochem Cell Biol 116,
471–481.
5 Hiratsuka S, Nakamura K, Iwai S, Murakami M, Itoh
T, Kijima H, Shipley JM, Senior RM & Shibuya M
(2002) MMP9 induction by vascular endothelial growth
factor receptor-1 is involved in lung-specific metastasis.
Cancer Cell 2, 289–300.
6 Shihab FS, Bennett WM, Isaac J, Yi H & Andoh TF
(2002) Angiotensin II regulation of vascular endo-
thelial growth factor and receptors Flt-1 and KDR ⁄
Flk-1 in cyclosporine nephrotoxicity. Kidney Int 62,
422–433.
7 Philipp W, Speicher L & Humpel C (2000) Expression
of vascular endothelial growth factor and its receptors
in inflamed and vascularized human corneas. Invest
Ophthalmol Vis Sci 41, 2514–2522.
8 Aiello LP, Avery RL, Arrigg PG, Keyt BA, Jampel
HD, Shah ST, Pasquale LR, Thieme H, Iwamoto
MA, Park JE et al. (1994) Vascular endothelial
growth factor in ocular fluid of patients with diabetic
retinopathy and other retinal disorders. N Engl J Med

33, 1480–1487.
9 Burke B, Giannoudis A, Corke KP, Gill D, Wells M,
Ziegler-Heitbrock L & Lewis CE (2003) Hypoxia-
induced gene expression in human macrophages: impli-
cations for ischemic tissues and hypoxia-regulated gene
therapy. Am J Pathol 163, 1233–1243.
10 Xiong M, Elson G, Legarda D & Leibovich SJ (1998)
Production of vascular endothelial growth factor by
murine macrophages, regulation by hypoxia, lactate,
and the inducible nitric oxide synthase pathway. Am J
Pathol 153, 587–598.
11 Afuwape AO, Kiriakidis S & Paleolog EM (2002) The
role of the angiogenic molecule VEGF in the pathogen-
esis of rheumatoid arthritis. Histol Histopathol 17, 961–
972.
12 Paleolog EM (2002) Angiogenesis in rheumatoid arthri-
tis. Arthritis Res 4, S81–S90.
13 Ferrara N (1999) Role of vascular endothelial growth
factor in the regulation of angiogenesis. Kidney Int 56,
794–814.
14 Sawano A, Iwai S, Sakurai Y, Ito M, Shitara K, Naka-
hata T & Shibuya M (2001) Flt-1, vascular endothelial
growth factor receptor 1, is a novel cell surface marker
for the lineage of monocyte-macrophages in humans.
Blood 97, 785–791.
15 Hiratsuka S, Maru Y, Okada A, Seiki M, Noda T &
Shibuya M (2001) Involvement of Flt-1 tyrosine
kinase (vascular endothelial growth factor receptor-1)
in pathological angiogenesis. Cancer Res 61, 1207–
1213.

16 De Bandt M, Ben Mahdi MH, Ollivier V, Grossin M,
Dupuis M, Gaudry M, Bohlen P, Lipson KE, Rice A,
Wu Y, Gougerot-Pocidalo MA & Pasquier C (2003)
Blockade of vascular endothelial growth factor receptor
I (VEGF-RI), but not VEGF-RII, suppresses joint
destruction in the K ⁄ BxN model of rheumatoid arthri-
tis. J Immunol 171, 4853–4859.
17 Luttun A, Tjwa M, Moons L, Wu Y, Angelillo-Scherrer
A, Liao F, Nagy JA, Hooper A, Priller J, De Klerck B
et al. (2002) Revascularization of ischemic tissues by
PlGF treatment, and inhibition of tumor angiogenesis,
M. Du et al. Post-transcriptional regulation of VEGF in macrophages
FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works 743
arthritis and atherosclerosis by anti-Flt1. Nat Med 8,
831–840.
18 Levy AP, Levy NS, Wegner S & Goldberg MA (1995)
Transcriptional regulation of the rat vascular endothe-
lial growth factor gene by hypoxia. J Biol Chem 270,
13333–13340.
19 Claffey KP, Shih SC, Mullen A, Dziennis S, Cusick JL,
Abrams KR, Lee SW & Detmar M (1998) Identification
of a human VPF ⁄ VEGF 3¢ untranslated region medi-
ating hypoxia-induced mRNA stability. Mol Biol Cell 9,
469–481.
20 Goldberg-Cohen I, Furneaux H & Levy AP (2002) A
40-bp RNA element that mediates stabilization of vas-
cular endothelial growth factor mRNA by HuR. J Biol
Chem 277, 13635–13640.
21 Levy AP, Levy NS & Goldberg MA (1996) Hypoxia-
inducible protein binding to vascular endothelial growth

factor mRNA and its modulation by the von Hippel-
Lindau protein. J Biol Chem 271, 25492–25497.
22 Levy AP, Levy NS & Goldberg MA (1996) Post-tran-
scriptional regulation of vascular endothelial growth
factor by hypoxia. J Biol Chem 271, 2746–2753.
23 Levy NS, Chung S, Furneaux H & Levy AP (1998)
Hypoxic stabilization of vascular endothelial growth
factor mRNA by the RNA-binding protein HuR. J Biol
Chem 273, 6417–6423.
24 Renner W, Kotschan S, Hoffmann C, Obermayer-
Pietsch B & Pilger E (2000) A common 936 C ⁄ T
mutation in the gene for vascular endothelial growth
factor is associated with vascular endothelial growth
factor plasma levels. J Vasc Res 37, 443–448.
25 Shih SC & Claffey KP (1999) Regulation of human
vascular endothelial growth factor mRNA stability in
hypoxia by heterogeneous nuclear ribonucleoprotein L.
J Biol Chem 274, 1359–1365.
26 Chen CY & Shyu AB (1995) AU-rich elements: charac-
terization and importance in mRNA degradation.
Trends Biochem Sci 20, 465–470.
27 Xu N, Chen CY & Shyu AB (1997) Modulation of the
fate of cytoplasmic mRNA by AU-rich elements: key
sequence features controlling mRNA deadenylation and
decay. Mol Cell Biol 17, 4611–4621.
28 Coles LS, Bartley MA, Bert A, Hunter J, Polyak S,
Diamond P, Vadas MA & Goodall GJ (2004) A multi-
protein complex containing cold shock domain (Y-box)
and polypyrimidine tract binding proteins forms on the
vascular endothelial growth factor mRNA. Potential

role in mRNA stabilization. Eur J Biochem 271, 648–
660.
29 Uthoff SM, Duchrow M, Schmidt MH, Broll R, Bruch
HP, Strik MW & Galandiuk S (2002) VEGF isoforms
and mutations in human colorectal cancer. Int J Cancer
101, 32–36.
30 Salomonsson L, Pettersson S, Englund MC, Wiklund O
& Ohlsson BG (2002) Post-transcriptional regulation of
VEGF expression by oxidised LDL in human macro-
phages. Eur J Clin Invest 32, 767–774.
31 Ciais D, Cherradi N, Bailly S, Grenier E, Berra E,
Pouyssegur J, Lamarre J & Feige JJ (2004) Destabili-
zation of vascular endothelial growth factor mRNA by
the zinc-finger protein TIS11b. Oncogene 23, 8673–8680.
32 Tourriere H, Chebli K & Tazi J (2002) mRNA degra-
dation machines in eukaryotic cells. Biochimie 84,
821–837.
33 Griffin ME, Hamilton BJ, Roy KM, Du M, Willson
AM, Keenan BJ, Wang XW & Nichols RC (2004) Post-
transcriptional regulation of glucose transporter-1 by
an AU-rich element in the 3¢UTR and by hnRNP A2.
Biochem Biophys Res Commun 318, 977–982.
34 Dibbens JA, Polyak SW, Damert A, Risau W, Vadas
MA & Goodall GJ (2001) Nucleotide sequence of the
mouse VEGF 3 ¢UTR and quantitative analysis of
sites of polyadenylation. Biochim Biophys Acta 1518,
57–62.
35 Goodwin EC & Rottman FM (1992) The 3¢-flanking
sequence of the bovine growth hormone gene contains
novel elements required for efficient and accurate poly-

adenylation. J Biol Chem 267, 16330–16334.
36 Thomas MG, Martinez Tosar LJ, Loschi M, Pasquini
JM, Correale J, Kindler S & Boccaccio GL (2005)
Staufen recruitment into stress granules does not affect
early mRNA transport in oligodendrocytes. Mol Biol
Cell 16, 405–420.
37 Kedersha N, Stoecklin G, Ayodele M, Yacono P,
Lykke-Andersen J, Fitzler MJ, Scheuner D, Kaufman
RJ, Golan DE & Anderson P (2005) Stress granules
and processing bodies are dynamically linked sites of
mRNP remodeling. J Cell Biol 169, 871–884.
38 Mangus DA, Evans MC & Jacobson A (2003) Poly (A)
-binding proteins: multifunctional scaffolds for the post-
transcriptional control of gene expression. Genome Biol
4, 223.
39 Keene JD & Tenenbaum SA (2002) Eukaryotic mRNPs
may represent posttranscriptional operons. Mol Cell 9,
1161–1167.
40 Iwahashi M, Yamamura M, Aita T, Okamoto A, Ueno
A, Ogawa N, Akashi S, Miyake K, Godowski PJ &
Makino H (2004) Expression of Toll-like receptor 2 on
CD16+ blood monocytes and synovial tissue macro-
phages in rheumatoid arthritis. Arthritis Rheum 50,
1457–1467.
41 Matsumoto Y, Tanaka K, Hirata G, Hanada M,
Matsuda S, Shuto T & Iwamoto Y (2002) Possible
involvement of the vascular endothelial growth factor-
Flt-1-focal adhesion kinase pathway in chemotaxis and
the cell proliferation of osteoclast precursor cells in
arthritic joints. J Immunol 168, 5824–5831.

42 Bakheet T, Frevel M, Williams BR, Greer W & Khabar
KS (2001) ARED: human AU-rich element-containing
mRNA database reveals an unexpectedly diverse func-
Post-transcriptional regulation of VEGF in macrophages M. Du et al.
744 FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works
tional repertoire of encoded proteins. Nucl Acids Res
29, 246–254.
43 Levy NS, Goldberg MA & Levy AP (1997) Sequencing
of the human vascular endothelial growth factor
(VEGF) 3¢untranslated region (UTR): conservation
of five hypoxia-inducible RNA-protein binding sites.
Biochim Biophys Acta 1352, 167–173.
44 Pages G, Berra E, Milanini J, Levy AP & Pouyssegur
J (2000) Stress-activated protein kinases (JNK and
p38 ⁄ HOG) are essential for vascular endothelial
growth factor mRNA stability. J Biol Chem 275,
26484–26491.
45 Boado RJ & Pardridge WM (2002) Glucose deprivation
and hypoxia increase the expression of the GLUT1 glu-
cose transporter via a specific mRNA-acting regulatory
element. Neurochemistry 80, 552–554.
46 Tang K, Breen EC & Wagner PD (2002) Hu protein
R-mediated posttranscriptional regulation of VEGF
expression in rat gastrocnemius muscle. Am J Physiol
Heart Circ Physiol 283, 1497–1504.
47 Sirenko OI, Lofquist AK, DeMaria CT, Morris JS,
Brewer G & Haskill JS (1997) Adhesion-dependent
regulation of an A+U-rich element-binding acti-
vity associated with AUF1. Mol Cell Biol 17,
3898–3906.

48 Gerber HP & Ferrara N (2003) The role of VEGF in
normal and neoplastic hematopoiesis. J Mol Med 81,
20–31.
49 Ecsedy JA, Yohe HC, Bergeron AJ & Seyfried TN
(1998) Tumor-infiltrating macrophages influence the gly-
cosphingolipid composition of murine brain tumors.
J Lipid Res 39, 2218–2227.
50 Weihrauch D, Tessmer J, Warltier DC & Chilian WM
(1998) Repetitive coronary artery occlusions induce
release of growth factors into the myocardial intersti-
tium. Am J Physiol 275, H969–H976.
51 Rozen S & Skaletsky H (2000) Primer3 on the WWW
for general users and for biologist programmers.
Methods Mol Biol 132, 365–386.
M. Du et al. Post-transcriptional regulation of VEGF in macrophages
FEBS Journal 273 (2006) 732–745 ª 2006 FEBS No claim to original US government works 745