Báo cáo khoa học: Investigation of the contribution of histidine 119 to the conduction of protons through human Nox2 pptx

Investigation of the contribution of histidine 119 to the conduction
of protons through human Nox2
Tosti J. Mankelow*, X. Wen Hu, Kate Adams and Lydia M. Henderson
Department of Biochemistry, School of Medical Sciences, University of Bristol, UK
The conduction of protons through human Nox2 has pre-
viously been shown to be dependent upon His115. Align-
ment of sequences for both animal and plant Nox proteins
indicated that histidines 115 and 119 are both highly con-
served, while His111 was co nserved among animal homo-
logues of Nox1–4. T o investigate t he possible r ole that these
histidine residues m ight play in the conduction of proton s
through Nox2, we have introduced both paired and single
mutations into these histidine residues. Each construct was
used to generate a CHO cell line in which the expression of
the m utated Nox2 was assessed. Nox2 was e xpressed in e ach
of the C HO cell lines generated, however, the level of
expression of H111/115L in CHO cells was lower and that of
H111L very much reduced, compared to that of wild-type
Nox2. The arachidonic acid activated proton flux was
absent in the CHO cell lines expressing the mutations of
H111/115L, H111/119L or H115/119L, compared to that
observed for wild-type Nox2. Similarly only a small efflux of
protons was observed from CHO cells expressing either
H119L or H111L. In all c ases the expected proton flux was
elicited through the addition of the protonophore, carbonyl
cyanide m-chlorophenylhydrazone. Conclusions regarding
the role of His111 in the conduction of protons cannot be
drawn due to the reduced expression. We can, however,
conclude th at His119, in addition to His115, is required for
the conduction of protons through Nox2. His119 has been
identified as a highly conserved residue for w hich no fu nction

has p reviously been proposed.
Keywords:gp91
phox
; membranes; NADPH oxidase; proton
transport.
The phagocytic white blood cells engulf, kill and digest
microorganisms within the body. These cells possess a
membrane bound enzyme, NADPH oxidase, which gener-
ates superoxide (O
Æ À
2
) and contributes to the killing of the
engulfed microorganisms within the phagosome. The
NADPH oxidase is composed of two membrane subunits,
gp91
phox
and p22
phox
, a nd three cytosolic proteins, p67
phox
,
p47
phox
and p40
phox
. The predicted binding sites for the
enzyme cofactors, FAD and the two b-type heme, are
located within gp91
phox
[1].

A number o f proteins with amino acid sequ ences similar
to that of the human gp91
phox
have been described in
human [2–4], mouse, rat, Caenorhabditis elegans, Dictyo-
stelium,rice[5],tomatoandArabidopsis [6,7] g enomes. The
identification of multiple sequences with similarity to
gp91
phox
within the human genome led to the need to
rename and number the family of proteins from p hox
(phagocyte oxidase) to Nox (NADPH oxidase-like). Of the
Nox family members, Nox2 is the originally described
human phagocyte protein gp91
phox
. In addition, genes
encoding dual oxidases (Duox), which contain both a
peroxidase and N ox have been identified in a number of
different genomes [8].
The generation of superoxide by the phagocytic NADPH
oxidase is associated with an e fflux of protons [9]. The
expression of wild-type Nox2 in CHO cells has previously
been shown to b e associated with the presence o f a
characterized arachidonic a cid activated proton cond uction
pathway [10,11]. T he membrane topology of gp91
phox
is
predicted to consist of 4–6 transmembrane domains located
within the N-terminal half of the protein followed by a
hydrophilic, cytosolic domain [12]. The third predicted

transmembrane domain of Nox2 contains a sequence
of three regularly spaced histidine residues, HSAIHT-
IAH(111–119). The mut ation of His115 to Leu has
previously been shown to greatly reduce p roton conduction,
Correspondence to L. M. Henderson, Department of Biochemistry,
School of Medical Sciences, University of Bristol, University Walk,
Bristol, BS8 1TD, UK. Fax: +44 117 9288274,
Tel.: +44 117 9289046, E-mail:
Abbreviations: BCECF-AM, 2¢,7¢-bis-(2-carboxyethyl)-5-(and -6-)-
carboxyfluorescein, acetoxymethyl ester; cPLA
2
, cytosolic phospho-
lipase A
2
; CHO91, CHO cell line resulting from the transfection of
CHO cells with full-length wild-type human Nox2; CHO91H111/
115L, CHO/Nox2 cell line with His111 and H is115 mutated to Leu;
CHO91H115/119L, CHO/Nox2 cell line with His115 and His119
mutated to Leu; CHO91H111/119L, CHO/Nox2 cell line w ith His111
and His119 mutated to Leu; CHO91H119L, C HO/Nox2 cell line with
single mutation His119 to Leu; CHO91H111L, CHO/Nox2 cell line
with single mutation His111 to Leu.
*Present address: Bristol Institute for Transfusion Sciences,
Southmead Hospital, Bristol, UK.
Present address : Department of Biochemistry, University of Oxford,
UK.
Note: T he data prese nted in t his paper have previously been pu blished
as an abstract for the 56th Harden conference on ÔBiological
electron and proton transferÕ Plymouth, UK, 2003.
(Received 1 6 July 2004, accepted 20 August 2004)

Eur. J. Biochem. 271, 4026–4033 (2004) Ó FEBS 2004 doi:10.1111/j.1432-1033.2004.04340.x
whether introduced into the full-length Nox2 [13] or only
the N-terminal membrane spanning domains [14]. Similarly,
proton conduction was greatly reduced if all three hist idine
residues were mutated to leucine [13,14]. Therefore the
ability of Nox2 to act as proton conduction pathway has
previously b een demonstrated to be dependent upon
His115.
An alignment of the amino acid sequences for Nox
and Duox proteins available in the genome databases
demonstrated that His115 and His119 in human Nox2
are both conserved through out the animal and plant
sequences of Nox and Duox proteins (Fig. 1A). Only the
sequence of Arabidopsis RbohE appeared to lack the
His119 residue. However, t he introduction of a four
amino acid gap in the s equence improved the sequence
alignment and suggested that both His115 and 119 are
also conserved in RbohE (Fig. 1B). His111 is conserved
in Nox2 sequences from different animal species (Fig. 1).
Histidines 101, 115, 209 and 222 have been proposed to
function as the 5th and 6th coordinate ligands for the
two b-type hemes due to similarities in sequence position
and spacing of the histidine residues t o those of yeast
ferric reductase [15]. However, no function has previ-
ously been proposed for a conserved histidine residue at
position 119.
The contribution of His119 and/or His111 to the
conduction of protons through Nox2 has not previously
been investigated. To determine whether the mechanism for
the conduction of protons through Nox2 requires His111

and/or His119, we have established a number of CHO cells
lines which express human Nox2 containing mutations to
each of the possible pair of histidine residues (111 + 115,
115 + 119 and 111 + 119) o r to individual histidine
residues (111 or 119). The CHO cell lines expressing each
of these mutations failed to show an arachidonic acid
activated proton flux. However the mutation of His111 to
Leu resulted in a reduced level of expression of full-length
Nox2. Therefore, we conclude that the conduction of
protons through Nox2 requires His119 as well as the
previously demonstrated role for H is115. The possible role
for H is111 in proton conduction through Nox2 cannot be
established from the current data.
Fig. 1. Amino acid seque nce a lignment o f Nox
and Duox proteins with the third predicted
transmembrane domain of human Nox2. Th e
amino acid sequences for 40 Nox and Duox
proteins were obtained from the P ubMed
nucleotide and protein databases. (A) The
alignment of the amino acids from each Nox
and Duox protein with sequence similarity to
that of residues 100–131 in human Nox2. The
arrow indicates the conserved His residue
(119) in addition to t he previously reported
conserved histidine at position 115. T he
sequences shown include the Arabidopsis
(Rboh), rice (RbohAOsp), tomato (Rboh-
Tomato) and induced in tomato by w hitefly
(RbohTomIn), potato (Strboh) and Dictyos-
telium (DictoNox2). The pig and rabbit

Nox1 are incomplete partial sequences lacking
the N-terminus. There are s equences for
human Nox5 with and without the extended
N-terminal containing the EF-hands. The
residues numbers for both are shown. (B) The
introduction of a gap of four amino acids into
the RbohE sequence (residues 473–503) is
necessary to align the histidine re sidues with
those of the other Arabidopsis,plantand
human Nox2.
Ó FEBS 2004 Histidine 119 and conduction protons through Nox2 (Eur. J. Biochem. 271) 4027
Materials and methods
The composition o f the salt solutions used are as described
previously [11,13].
Sequence alignment
The PubMed protein and nucleotide databases contain
sequence data for a number o f Nox and Duox proteins from
human, mouse, rat, cow, bison, pig, dolphin, rabbit, guinea-
pig, Japanese puffer fish, Dictyostelium, Arabidopsis, rice,
tomato, potato and C. elegans. Alignment o f these sequences
in species groups identified a region of sequence similarity
including and in a ddition to the previously described
conserved histidine at position 115 in human Nox2. The
amino acids with sequence homology to residues 100–131 of
human Nox2 were identified in each Nox and Duox
sequences and aligned using
GENEDOC
and
DNASTAR
.The

histidine residues 115 and 119 (human Nox2) are conserved
throughout the 40 sequences currently available. Amino
acids 100–129 of human Nox2 are predicted to form the third
transmembrane domain.
Mutagenesis of His111, 115 and/or 119 to Leu
in full-length Nox2
cDNAs encoding full-length Nox2 containing each of the
following mutations: His111 & 115 to Leu (H111/115L);
His115 & 119 to Leu (H115/119L); His111 & 119 to Leu
(H111/119L); His111 to Leu (H111L) and His119 to Leu
(H119L) wer e generated from two overlapping PCR
products as described p reviously [14], using the specific
oligonucleotide primers contained in Table 1. The two
fragments were annealed and joined by extension from the
overlap region before final P CR amplification using ÔFull-
length Nox2 fw dÕ and ÔFull-length Nox2 revÕ oligonucleotide
primers (Table 1). These PCR products were inserted as a
HindIII/BamHI fragment into the multiple cloning site of
the p lasmid pMEP4 (Invitrogen). Oligonucleotides were
synthesized by MWG-Biotech AG.
Construction and maintenance of transfected
CHO cell lines
Stable CHO cell lines expressing each of the mutant forms
of full-length human Nox2 (CHO91) were established
following transfection by electroporation (230 V, 975 lF)
of the constructs described above, followed by s election
with 100 lgÆmL
)1
hygromycin b as described previously
[11,14]. The following stable ce ll lines were established:

CHO91H111/115L (Nox2 with histidines 111 and 115
mutated to leucine); CHO91H115/119L (Nox2 with histi-
dines 115 and 119 mutated to leucine); CHO91H111/119L
(Nox2 with histidines 111 and 119 mutated to leucine);
CHO91H111L (Nox2 with histidine 111 only mutated to
leucine) and CHO91H119L (Nox2 w ith histidine 119 only
mutatedtoleucine).
All CHO cell lines were maintained in Ham’s F-12
nutrient mixtu re with GlutaMAX-I, 10% (v/v) fetal bovine
serum, 50 UÆmL
)1
penicillin and 50 lgÆL
)1
streptomycin.
The c ells were divided 1 : 2 once a week following
trypsinization [11].
Expression of the mutant Nox2 proteins
Verification of the expression of each of the mutant Nox2
proteins and determination of their cellular l ocalization
were assessed by i mmunostaining a nd confocal microscopy
as previously described [11,13]. The immunocytochemistry
was performed with an antipeptide [PRGVHFIFN
KENF(558–570)] polyclonal antibody [11,16] upo n each
of the CHO91 mutant cell lines. Expression of Nox2 was
driven from the inducible metallothionein promoter in
pMEP4 through the preincubation of the cells with 10 l
M
Cd
2+
for 16–24 h. The CHO cell lines were grown on r ound

cover slips for 40–48 h prior to fixation in 4% (v/v)
formaldehyde for 10 min and permeabilization with 0.2%
(v/v) Triton in phosphate buffered s aline (2 min). Binding of
the antibody raised against Nox2 was detected with a
fluorescein isothiocyanate-labelled anti-rabbit Ig. An image
of an optical plane through the cells was collected with a
Table 1. Sequences of the oligonucleotide primers used for the introduction of mutations in full-length Nox2. ÔFull-length Nox2 fwdÕ contains a HindIII
restriction site (underlined) for the directionalinsertionintopMEP4andcoverstheN-terminal initiating Met codon (bold) of Nox2. ÔFull-length
Nox2 revÕ contains a BamHI restriction site (underlined) for the d irectional insertion into th e expression vector, pMEP4 and covers the stop codon
of the C-terminus of Nox2 (bo ld). Full-length No x2 mu tants we re genera ted fro m two ove rlapping PCR products (nucleotide 1–352 and 336–1713)
which we re annealed and joined by extension before final PCR amplification using ÔFull-length Nox2 fwdÕ and ÔFull-length Nox2 revÕ.Bold
underlined single nucleotides are the s ubstitutions in the m utant and groups of three n ucleotid es underlined show the positions of the h istidine
residues.
Primer name Primer sequence Mutants constructed
Full-length Nox2 fwd CTCAGCT
AAGCTTGCCACCATGGGGAAC All full length constructs
Full-length Nox2 rev AGCTGA
GGATCCCTACCCACGTACAATTCG All full length constructs
His111Leu rev CAATGGTGTGAATCGCAG
AGAGAAGTG His111/119Leu and His111Leu
His115Leu fwd TGCGATTC
TCACCATTGCACATCTATTT His111/115Leu
His115Leu rev CAATGGTG
AGAATCGCAGAGTGAAGTGC His115/119Leu
His119Leu fwd TGCGATTCACACCATTGCA
CTTCTATT His111/119Leu and His119Leu
His111/115wt rev CAATGGT
GTGAATCGCAGTGAGAAGTG His119Leu
His115/119wt fwd TGCGATT
CACACCATTGCACATCTATT His111Leu

His115/119Leu fwd TGCGATTC
TCACCATTGCACTTCTATTT His115/119Leu
His111/115Leu rev CAATGGTG
AGAATCGCAGAGAGAAGTGC His111/115Leu
4028 T. J. Mankelow et al.(Eur. J. Biochem. 271) Ó FEBS 2004
Bio-Rad MRC 600 inverted confocal microscope and
presented as a Kalman average of five successively collected
scans, with excitation at 488 nm. The expression levels of all
the mutants were compared to that observed for wild-type
Nox2 in CHO91 cells (positive control). N onspecific
binding of the antibodies was assessed in nontransfected
CHO cells ± 10 l
M
Cd
2+
(negative co ntrol).
Transmembrane proton flux in mutant CHO91 cell lines
The conduction of protons through the arachidonate
activated, NADPH oxidase associated H
+
channel was
assessed as change in pH
i
with 2¢,7¢-bis-(2-carbox yethyl)-5-
(and -6-)-carboxyfluorescein, acetoxymethyl e ster (BCECF-
AM) for all m utant CHO91 cell lines, a s described
previously [11,13,14]. The pH of the external solution
was rapidly altered by the addition of HEPES (pH 6.6) or
Tris (pH 8.3). The addition of the potassium ionophore,
valinomycin, equilibrates K

+
ions across the plasma
membrane, d epolarizing t he membrane potential of cells
in a high K
+
solution and hyperpolarizing the membrane
potential if cells are in a Na
+
solution (low K
+
).
Therefore, the addition of Tris and v alinomycin to cells
in a high K
+
medium establishes a strong electrochemical
gradient for the efflux of protons. A gradient favouring
the influx of protons is established following the addition
of HEPES and valinomyc in to cells in a Na
+
solution
(low K
+
).
The predicted third transmembrane helix for Nox2
A predicted structure for amino acids 98–129 of human
Nox2 was modelled by C. Dempsey (Department of
Biochemistry, University of Bristol, UK) based on the
assumption that the a mino acids of t he third predicted
transmembrane domain adopt an a-helix conformation.
Results

The conduction of protons through Nox2 was previously
observed to be greatly redu ced in CHO cells expressing
Nox2 in which His115 h ad been mutated to L eu and when
all three histidines, 111, 115 and 119, were mutated to Leu
[13,14]. The alignment of Nox protein sequences indicates
that His119 is highly conserved and His111 is conserved in
Nox2 proteins from different animal species. However, the
contribution of histidines 111 and 119 to the conduction of
protons through Nox2 has not previously been invest igated
despite their p ossible location on the same face of an a-helix
as His115. To determine th e contribution of histidines 111
and 119 to the conduction of protons through human Nox2,
we have established CHO cells that express Nox2, into
which mutations to either paired or single histidine residues
within the third transmembrane domain have been intro-
duced. The exp ression of the r esulting protein and condu c-
tion of protons in re sponse to arachidonic acid was assessed
for each of the cell lines.
Expression of Nox2 histidine mutations in CHO cells
Table 1 contains the sequences o f the o ligonucleotide PCR
primers used to introduce the mutations of His fi Leu for
the three histidine residues of interest within the third
transmembrane domain of Nox2. Each of the three possible
combinations of pairs of histidine residues were mutated to
leucine ( 111/115, 115/119 and 111/119) and used to establish
stable CHO cell lines, CHO91H111/115L, C HO91H115/
119L and C HO91H111/119L. Transcription and t ransla-
tion of the Nox2 gene is under the control of an inducible
metalothionine promoter (10 l
M

Cd
2+
for 16 h). Immuno-
staining, using an antibody raised against the Nox2
C-terminal, was used to assess the inducible expression of
Nox2proteinineachofthecellslines.
The immunostaining was observed to be greater
for CHO91 (Fig. 2A), CHO91H115/119L (Fig. 2C),
CHO91H111/115L (Fig. 2E) and C HO91H111/119L
(Fig. 2G) when the cells had be en g rown in the presence of
10 l
M
Cd
2+
compared to the same CHO cell lines grown in
the absence of Cd
2+
(Figs 2B,D,F,H, respectively). Non-
transfected CHO cells showed low l evels of immunostaining
whether grown in the presence (Fig. 2I) or absence (Fig. 2J)
of Cd
2+
. Therefore, each of the CHO cell lines show an
induced expression of protein, which was dependent upon
transfection with Nox2 cDNA. The level of expression
observed in CHO91H111/115L cells, in which histidines 111
and 115 were both mutated to leucines (Fig. 2E) was lower
than that observed for CHO91 with the wild-type Nox2
(Fig. 2A), while the expression of Nox2 in each of the
remaining m utant C HO ce ll lines (Fig. 2 C,G) was compar-

able to that observed for CHO91 cells (Fig. 2A) as observed
previously [11,13,14].
Arachidonic acid activated proton conduction
The arachidonic acid activated proton conduction pathway
has previously been reported to be greatly reduced by the
mutation of His115 to Leu compared to that observed for
wild-type Nox2 [13,14]. To assess the contribution of
histidines 119 and 111 to the conduction of p rotons th rough
Nox2, the ability of CHO91H111/115L, CHO91H115/119L
and CHO91H111/119L cells to conduct protons in response
to stimulation by arachidonic acid was assessed. Electro-
chemical gradients for either proton influx (Fig. 3A–C) or
proton efflux (Fig. 3D,E) were imposed upon the cells prior
to the addition of arachidonic acid. CHO91H115/119L
(Fig. 3C) cells showed little change in pH
i
in response
to arachidonic acid compared with the response of
CHO91 ce lls (Fig. 3A) expressing human Nox2. A similar
low conduction of protons following the addition of
sodium arachidonate was observed for CHO91H111/115L
(Fig. 3E). The observed very low conduction of protons for
both CHO91H111/119L and CHO9H115/119L cells is as
would b e pred icted and may be the result s olely of the
mutation of His115 to Leu in both of these cell lines.
However, CHO91H111/119L cells failed to exhibit an
arachidonic acid activated conduction of protons whether
assessed as a proton influx (Fig. 3B) or as a proton efflux
(Fig. 3D). The subsequent addition of the protonophore,
carbonyl cyanide m-chlorophenylhydrazone, resulted i n the

observed pH
i
change expected for the established proton
electrochemical gradient in all cases (Fig. 3A–E). CHO91,
CHO91H111/115L, C HO91H115/119L and CHO91H111/
119L all demonstrated a similar pH
i
change in response to a
sodium acetate i mposed acid pulse (Fig. 3F) indicating that
Ó FEBS 2004 Histidine 119 and conduction protons through Nox2 (Eur. J. Biochem. 271) 4029
Fig. 2. Expression of wild-type and double histidine mutations o f Nox2 in CHO cell lines. The expression of full-length Nox2 was determined by
immunocytochemistry as described in the Materials and methods. The inducible e xpression of Nox2 was determined for CHO91 (A and B),
CHO91H115/119L (C and D), C HO91H111/115L (E and F), CHO91H111/119L (G and H) and for nontransfected CHO cells (I and J). The
CHO cells were incubated in the presence of 10 l
M
Cd
2+
for 16 h prior to fixation and staining (A, C, E, G and I). The images are Kalman
averages of five successively collected scans. The intensity o f th e fl uorescen ce is represented by a pseudocolour scale wh ere r ed is highest and blu e
is lowest.
4030 T. J. Mankelow et al.(Eur. J. Biochem. 271) Ó FEBS 2004
the cytoplasm in e ach of these cell lines has a similar
buffering capacity, with that of CHO91H111/119L a little
lower. The calibration of BCECF-AM response to pH
i
was similar in all four cell lines (Fig. 3G). We therefore
conclude that the absence of an arachidonate activated
proton conduction in CHO91H111/119L cells suggests t hat
His111 and/or His119 are r equired, in addition to His115,
for the conduction of protons through Nox2.

Mutation of individual histidine residues in human Nox2
To investigate the individual roles of His111 and His119, in
the conduction of protons through Nox2, two CHO cells
lines were constructed, CHO91H111L and CHO91H119L,
in which the single His fi Leu mutations had been intro-
duced. The expression of Nox2 in which the histidine at
position 119 had been mutated to leucine was inducible in
CHO91H119L cells (Fig. 4A) and the protein was expressed
at a level comparable with that observed for wild-type
Nox2 (Fig. 2A). However, the expression of Nox2 in
CHO91H111L cells, in which the histidine at position 111
had been mutated to leucine, although enhanced by
activation of the inducible promoter, was observed t o be
significantly lower than that of w ild-type Nox2 (Figs 4B
and 2A).
CHO91H119L cells in the presence of a transmembrane
gradient for the efflux of protons exhibited a very small
conduction of protons following the addition of arachido-
nate (Fig. 4E). The efflux of protons was similar to that
observed for CHO91H111/119L cells (Fig. 3D). The efflux
of protons was only observed following the subsequent
addition of carbonyl cyanide m-chlorophenylhydrazone
(Fig. 4E). The reduction in proton efflux observed for
CHO91H119L cells is not due to a reduction in the level of
protein expression as a result of the introduction of this
mutation into Nox2. Therefore, we can conclude that the
reduced proton efflux is as a c onsequence of the mutation of
His119 to Leu, and therefore that His119 is required for the
conduction of protons through Nox2.
We note that proton efflux was also not observed

following the addition of arachidonate to CHO91H111L
cells suspended in a K
+
medium (not shown). However,
due to the reduced level of expression of H111L Nox2 in
CHO compared with wild-type and the other mutations
described here and reported p reviously [13,14], no conclu-
sions can be draw regarding the role o f His111 in the
conduction of protons through Nox2.
Therefore, we can conclude that the conduction of
protons through human Nox2 requires both His119 and
His115.
Fig. 3. Arachidonic acid stimulated proton flux. The CHO cell lines were inc ubated with 10 l
M
Cd
2+
for 16 h prior to the assay. Cells from each of
the CHO cell lines were harvested and lo aded with BCECF-AM as described in t he Materials and me thods. Following the addition of t he potassium
ionophore, valinomycin (2.7 l
M
), t he transmembrane potassium gradient dictat es the membr ane potential. T he addition of 5 m
M
HEPES rapidly
decreases the external pH to 6.6, or to pH 8.3 following th e addition of 5 m
M
Tris. This established an electrochemical gradient for the influx (A–C)
or effl ux (D and E ) of protons. T he influx of p rotons was assessed for control C HO91 cells expressing wild-t ype gp91
phox
(A), CHO91H111/119L
(B) and CHO91H115/119L (C), all suspended in the Na

+
medium. In addition the efflux of protons w as assessed in both CHO91H111/119L (D)
and CHO91H111/115L (E) with c ells suspended i n a K
+
medium. (A–E) The opening of the proton conduction pathway and the t ransport of
protons was monitored as an alteration in i nternal pH, following the addition of 10 l
M
arachidonic a cid (AA). The maximum change in pH
i
was
determined following the addition of the protonophore, carbonyl cyanide m-chlorophenylhydrazone (CCCP; 66 l
M
) where indictated. The
requirement for a s econd addition of CCCP in (E), in order to elicit a full pHi change, probably results from a l arger number of cells. The buffering
capacity was asse ssed fo llowing the addition of 26 m
M
NaAc (F) to CHO91H115/119L, CHO91H111/119L, CHO91, CHO91H111/115L (left to
right) and the response of the BCECF-AM to pH was calibrated (G) in CHO91 (j), CHO91H111/119L (m), CHO91H115/119L (d)and
CHO91H111/115L ( r).
Ó FEBS 2004 Histidine 119 and conduction protons through Nox2 (Eur. J. Biochem. 271) 4031
Discussion
It has previously been shown that His115 is required for the
conduction of proton s through human Nox2, in either the
full-length protein [13] or the N-terminal membrane domain
alone [14]. The third transmembrane domain of Nox2
contains three histidine residues separated from each other
by three amino acid residues [14]. In this paper we have
generated CHO cell lines expressing human Nox2 into
which double and single mutations to histidines 111, 115
and 119 had been introduced. Mutation of His119 to Leu

severely reduced the arachidonic acid activated conduction
of protons. We therefore conclude that His119, as well as
His115, is required for the conduction of protons through
human Nox2. The role of His111 in proton cond uction
cannot be firmly established f rom the current data. T he
alignment of sequences for Nox proteins indicates that
His119 is a highly conserved residue and yet no role for the
His119 has previously been proposed.
The M2 protein is an integral membrane, coat protein of
the influenza A virus. It has previously been reported to
function as a proton channel [17–21]. The virus enters the
cells via endocytosis. The M2 protein proton channel is
opened by the acidic pH environment of the endosomes,
resulting in a fall in pH of the v iral particle, l eading to
dissociation of the viral coat and release of the viral
genome [17,22]. Amantidine, an anti-influenza drug, acts as
an inhibitor of the influenza A M2 proton channel and
hence prevents the uncoating of the viral particle and
release of its genome into the cell [18,23]. Therefore, the
influx of protons through the M2 protein is important in
the life cycle of the virus. The M2 protein has a histidine
residue, His37, located in the transmembrane domain,
which is required for th e open ing of the channel by acidic
pH and for the influx of protons through the channel
[22,24]. A possible cation–p interaction between the prot-
onated imidazole ring of His37 and the indole r ing o f
Trp41 has been identified. It has recently been proposed
that the Trp41 side chain blocks t he pore of the channel
and that the in teraction between protonated His37 and
Trp41 pulls the Trp41 side chain out of the pore of the

channel, thereby opening the M2 proton channel [22,25]. A
tryptophan o ccurs at position 125 of human Nox2, located
within the transmembrane domain that also contains
His111, 115, and 119. The model of this region as an
a-h elix places Trp125 two turns of the helix above His119
and not on the same face o f the helix. Therefore, the
distance and the orientation of His119 to Trp125 i s too
great to permit a cation–p interaction similar to that
described for the pH stimulated gating of the M2 protein
by the Trp41–His37 interaction [22,25].
A role f or cytosolic phospholipase A
2
(cPLA
2
)inthe
opening of the NADPH oxidase associated proton channel
has previously been demonstrated through the development
and use of a cPLA
2
deficient PLB-985 cell line (PLB-D cells)
[26–28]. Gating o f the proton channel formed by either full-
length human Nox2 [27] or just the N-terminal membrane
domain alone [28] have both been reported to be deficient in
PLB-D cells. The requirement for cPLA
2
for both the
activation of superoxide generation [26] and the gating of
the proton channel [27,28] can be over come by the addition
of arachidonate acid. The site of interaction with and the
mechanism by which arachidonate results in the activation

of both the NADPH oxidase and the gating of the proton
channel is at present unknown.
In this paper we have demonstrated a requirement for
His119 in the conduction of protons through human Nox2.
This, combined with the previously described role for
His115 in proton conduction, suggests a mechanism that
involves passage of the p roton from one histidine residue to
the next.
Acknowledgements
The au thors wish to thank Dr Chris Dempsey, Department of
Biochemistry for the modelling of the transmembrane domain as an
a-helix. The work was supported by Grant No. HO604 from the
Arthritis Research Campaign and a MRC PhD studentship to
T.J.M.
E
AB
DC
Fig. 4. Expression of the single mutations, H119L and H111L, in CHO
cells and determination of proton e fflux from CHO91H119L cells. The
expression of mutant Nox2 in CHO91H119L (A and B) and
CHO91H111L cells (C and D) was assessed as described i n the
Materials a nd methods. The CHO91H119L (A) and CHO91H111L
(C) were g rown in the presence (A,C) or absence (B,D) of 10 l
M
Cd
2+
for 16 h prior to the assay. The efflux of protons from CHO91H119L
cells preincubated with 10 l
M
Cd

2+
(E) was determined as described in
the Materials and methods. The CHO91H119L cells were resuspended
in a K
+
medium and additions of 2.7 l
M
valinomycin, 5 m
M
Tris,
10 l
M
arachidonate (AA) and 6 6 l
M
carbonyl c yanide m-chlorophe-
nylhydrazone (CCCP) were m ade where indicated i n the figure (E).
4032 T. J. Mankelow et al.(Eur. J. Biochem. 271) Ó FEBS 2004
References
1. Segal, A.W., West, I., Wient jes, F., Nugent, J .H.A., Chavan, A.J.,
Haley, B., Garcia, R.C., Rosen, H. & Scrace, G. (1992) Cyto-
chrome b-245 is a flavocytochrome containing FAD and the
NADPH-binding s ite of the microbicidal oxidase of phagocytes.
Biochem. J. 284, 781–788.
2. Lambeth, J.D., Cheng, G., Arnold, R.S. & Edens, W.A. (2000)
Novel hom ologs of gp91
phox
. Trends in Bioc hem. Sci 25, 459–461.
3. Banfi, B., Molnar, G., Maturana, A., Steger, K., Hegedus, B.,
Demaurex, N. & Krause, K.H. (2001) A Ca
2+

-activated NADPH
oxidase in testis, spleen, and lymph nodes. J. Biol. Chem. 276,
37594–37601.
4. Cheng, G., C ao, Z., Xu, X., Meir, E.G. & Lambeth, J.D. (2001)
Homologs of gp91
phox
: cloning and tissue expression of Nox3,
Nox4, and Nox5. Gene 269, 131–140.
5. Groom, Q.J., Torres, M.A., Fordham- Skelton, A.P., Ha mmond-
Kosack, K.E., Robins on, N.J. & Jones, J.D. (1996) rbohA,arice
homologue of the mammalian gp91
phox
respiratory burst oxidase
gene. Plant J. 10, 515–522.
6. Keller, T., Damude, H.G., Werner,D.,Doerner,P.,Dixon,R.A.
& L amb, C. (1998) A plant homolog of the neutrophil NADPH
oxidase gp91
phox
subunit ge ne encodes a plasma membrane pro-
tein with Ca
2+
binding motifs. Plant Cell 10, 255–266.
7. Torres, M.A., Onouchi, H., Hamada, S., Machida, C., Ham-
mond-Kocak, K.E. & Jones, J.D.G. (1998) Six Arabidop sis thali-
ana homologues of the human respiratory burst oxidase
(gp91
phox
). Plant J. 14, 365–370.
8. Dupuy, C., Pomerance, M., Ohayon, R., Noel-Hudson , M.S.,
Deme, D., Chaaraoui, M., Franc on, J . & Virion, A. (2000)

Thyroid oxidase (THOX2) gene expression in the rat thyroid cell
line FRTL-5. Biochem. Biophys. Res. Commun. 277, 287–292.
9. Henderson, L.M., Chappell, J.B. & Jones, O.T. (1987) The
superoxide-generating NADPH oxidase of h uman neutrophils is
electrogenic and a ssociated w ith a n H
+
channel. Biochem. J. 246,
325–329.
10. Henderson, L.M. & Chappell, J.B. (1992) The NADPH-oxidase-
associated H
+
channel is opened by arachidonate. Biochem.
J. 283, 171–175.
11. Henderson, L.M., Banting, G. & Chappell, J.B. (1995) The ara-
chidonate-activable, NADPH oxidase-associated H
+
channel.
Evidence that gp91
phox
functions as an essential part of t he
channel. J. Biol. Chem. 270, 5909–5916.
12. Hend erson, L.M., Thomas, S., Banting, G. & Chap pell, J.B.
(1997) The arachidonate-activatable, NADPH oxidase-associated
H
+
channel is contained within the multi-membrane-spanning
N-terminal region of gp 91
phox
. Biochem. J. 325, 701–705.
13. Mankelow, T.J. & Henderson, L. M. (2003) Proton conduction

through full-length gp91
phox
requires histidine 115. Protoplasma
221, 101–108.
14. Henderson, L.M. (1 998) NADPH Oxidase associated H
+
chan-
nel: role for histidines identified by mutagenesis. J. Biol. Chem.
273, 33216–33223.
15. Finegold, A.A., Shat well, K.P., Segal, A.W., Klausner, R.D. &
Dancis, A. (1996) Intramembrane bis-heme motif for trans-
membrane electron transport conserved in a y east iron reductase
and the human NADPH oxidase. J. Biol. Chem. 271, 31021–
31024.
16. Rotrosen, D., Kleinberg, M.E., Nunoi, H., Leto, T., Gallin, J.I. &
Malech, H.L . (19 90) Ev idence f or a f unc tional cy topl asmic
domain of phagocyte oxidase cytochrome b558. J. Biol. Ch em.
265, 8745–8750.
17. Pinto, L.H., Holsinger, L.J. & Lamb, R.A. (1992) Influenza virus
M2 protein h as ion channel activity. Cell 69, 517–528.
18. Duff, K.C. & Ashley, R.H. (1992) The transmembrane domain of
influenza A M 2 p rotein forms amantadine sensitive proton
channels in planar lipid bilayers. Virology 190, 485–489.
19. Tosteson,M.T.,Pinto,L.H.,Holsinger,L.J.&Lamb,R.A.(1994)
Reconstitution of the influenza virus M2 ion channel in lipid
bilayers. J. M embr. Biol. 42, 117–126.
20. Wang, C., Lamb, R.A. & Pinto, L.H. (1994) Direct measurement
of th e influenza A virus M2 protein io n channel activity in
mammalian cells. Virology 205 , 133–140.
21. Chizhmakov, I.V., Geraghty, F.M., Ogden, D.C., Hayhurst, A.,

Antoniou, M. & Hay, A.J. (1996) Selective proton permeability
and pH regulation of the influenza virus M2 channel expressed in
mouse erythroleukaemia c ells. J. Physiol. 494, 329–336.
22. Okada, A., Miura, T. & Takeuchi, H. (2001) Protonation of
histidine and histidine–tryptophan interaction in the activation
of the M2 ion channel from influenza A virus. Biochemistry 40,
6053–6060.
23. Wang, C., Takeuchi, K., Pinto, L.H. & Lamb, R.A. (1993) Ion
channel a ctivity of influenza A virus M2 protein: c haracterizatio n
of the amantidine block. J. Virol. 67, 5 585–5594.
24. Wang, C., Lamb, R .A. & Pinto, L.H. (1995) Activation of the M2
ion channel of influenza virus: a ro le for the transmembrane
domain histidine residue. Biophys. J. 69, 1363–1371.
25. Tang, Y., Zaitseva, F., Lamb, R.A. & Pinto, L.H. (2002) The gate
of the influe nza virus M2 proton channel is formed by a single
tryptophan residue. J. Biol. Chem. 277, 39880–39886.
26. Dana, R., Leto, T.L., Male ch, H .L. & Levy, R. (1998) Essential
requirement of cytosolic phospholipase A
2
for activation o f the
phagocyte NADPH oxidase. J. Biol. Chem. 273, 441–445.
27. Lowenthal, A. & Levy, R. (1999) Essential requirement of cyto-
solic phospholipase A
2
for a ctivation of the H
+
channel in pha-
gocyte-like cells. J. Biol. Chem. 274, 21603–21608.
28.Mankelow,T.J.,Pessach,E.I.,Levy,R.&Henderson,L.M.
(2003) The requirement of cytosolic phospholipase A

2
for the
PMAactivationofprotonefflux through the N-terminal 230-
amino-acid fragment of gp91
phox
. Biochem. J. 374, 315–319.
Supplementary material
The following material is available f rom http://www.
blackwellpublishing.com/products/jour nals/suppmat/
EJB/EJB4340/EJB4340sm.htm
Table S1. The Nox and Duox gene sequences used to
construct the alignment in Fig. 1.
Fig. S1. The third predicted t ransmembrane helix of Nox2.
Ó FEBS 2004 Histidine 119 and conduction protons through Nox2 (Eur. J. Biochem. 271) 4033